Síntesis y caracterización de un profármaco Aspirina-fumarato que inhibe la actividad de NFkB y de la mama células madre del cáncer

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Kastrati, I., Delgado-Rivera, L., Georgieva, G., Thatcher, G. R., Frasor, J. Synthesis and Characterization of an Aspirin-fumarate Prodrug that Inhibits NFκB Activity and Breast Cancer Stem Cells. J. Vis. Exp. (119), e54798, doi:10.3791/54798 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

La inflamación es un sello distintivo del cáncer que subyace en la incidencia del cáncer y la promoción y progresión finalmente a la metástasis. Por lo tanto, la adición de un fármaco anti-inflamatorio a regimientos estándar contra el cáncer puede mejorar los resultados del paciente. Uno de estos fármacos, la aspirina (ácido acetilsalicílico, ASA), se ha explorado para la quimioprevención del cáncer y de la actividad anti-tumor. Además de inhibir el eje 2-prostaglandina ciclooxigenasa, actividades contra el cáncer de ASA también se han atribuido a la inhibición del factor nuclear ĸB (NFĸB). Dado que el uso prolongado puede causar ASA toxicidad gastrointestinal, una estrategia de profármaco se ha aplicado con éxito. En este profármaco diseñar el ácido carboxílico de ASA se enmascara y farmacóforos adicionales se incorporan.

Este protocolo describe cómo se sintetizó un profármaco de aspirina fumarato, GTCpFE, y caracterizado su inhibición de la vía NFĸB en células de cáncer de mama y el cáncer de atenuación de tallo-como adecuadacorbatas, un fenotipo NFĸB dependiente importante. GTCpFE inhibe eficazmente la vía NFĸB en líneas celulares de cáncer de mama, mientras que ASA carece de cualquier actividad inhibidora, indicando que la adición de fumarato a la estructura ASA contribuye significativamente a su actividad. Además, GTCpFE muestra una actividad significativa de células madre contra el cáncer mediante el bloqueo de la formación mammosphere y atenuando el CD44 asociado a las células madre del cáncer + CD24 - inmunofenotipo. Estos resultados establecen una estrategia viable para desarrollar mejores medicamentos anti-inflamatorios para la quimioprevención y tratamiento del cáncer.

Introduction

La inflamación es una característica que subyace en múltiples aspectos de la tumorigénesis, como la incidencia y la promoción y progresión finalmente a la metástasis 1. En el cáncer de mama, esto se ve apoyado por observaciones epidemiológicas que muestran que el uso regular de la aspirina fármaco no esteroide anti-inflamatorio clásica (ácido acetil salicílico, ASA) se asocia con una reducción tanto en la incidencia de cáncer de mama, y ​​el riesgo de metástasis y recurrencia 2,3. ASA actúa principalmente mediante la inhibición de la actividad de la ciclooxigenasa-2, que a menudo se regula positivamente en el cáncer de mama 4,5. Sin embargo, los efectos anticancerígenos de ASA también puede ser mediada por la supresión del factor nuclear kappa B aberrante (NFkB) de señalización 6-8. Esto es importante porque una vía de NFkB desregulado promueve la supervivencia de células tumorales, proliferación, migración, invasión, la angiogénesis, y la resistencia a la terapia 9-11. activación de la vía NFkB también es fundamental para el montajeuna respuesta inmune. Por lo tanto, para la terapia contra el cáncer en el que se requiere la inhibición prolongada NFkB, hay que considerar los efectos secundarios perjudiciales que implican la supresión inmune de larga duración. Por lo tanto, ASA puede servir como un buen punto de partida para la optimización terapéutica.

Una limitación para la aplicación de ASA en la terapia del cáncer es las dosis elevadas requeridas para la ciclooxigenasa 2 y la inhibición de NFkB, que están asociados con toxicidad gastrointestinal, tales como úlceras y sangrado estomacal 12,13. Sin embargo, la conversión de ASA en profármaco en forma de éster, pueden reducir la toxicidad gastrointestinal de ASA. Para mejorar aún más la potencia y / o añadir funcionalidad, los elementos estructurales adicionales o farmacóforos auxiliares también se pueden incorporar en el diseño del profármaco de éster. Uno de tales farmacóforo añade para mejorar ASA potencia contra la vía de NFkB es fumarato, que hemos demostrado previamente que es importante para la inhibición de la vía NFkB 14,15.

15, GTCpFE, y planteó la hipótesis de que dicha molécula híbrida sería seguro todavía potente contra la vía NFkB. Hemos probado su actividad anti-NFkB en las células de cáncer de mama y su capacidad para bloquear las células madre de cáncer de mama (CSC) 15, que dependen de NFkB señalización para la supervivencia y el crecimiento de 16-21. Nos encontramos con que la potencia de GTCpFE contra la vía NFkB se mejora significativamente en AAS 15. Además, la formación de bloques GTCpFE mammosphere y atenúa el CSC marcador de superficie CD44 + CD24 - fenotipo inmune, lo que indica que GTCpFE es capaz de erradicar los CAC 15. Estos resultados establecen que el profármaco aspirina-fumarato como un agente anti-inflamatorio eficaz que también pueden dirigirse a células madre cancerosas de mama. En cuanto a la terapia del cáncer de mama, GTCpFE puede tener el potencial para tratar la enfermedad agresiva y mortal.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Síntesis de la aspirina-fumarato del profármaco GTCpFE

  1. El uso de un émbolo de la jeringa de plástico, medir 0,81 ml (20 mmol) de metanol y se mezcla en agua (10 ml) en un matraz de fondo redondo. Se enfría la mezcla resultante a 0 ° C colocando el matraz en un baño de hielo-agua. Añadir alcohol 4-hidroxibencil (2,48 mg, 20 mmol) y se agita la mezcla de reacción hasta que la solución es clara.
  2. Preparar una solución de cloruro de O -acetylsalicyloyl (3,77 mg, 19 mmol) en tolueno anhidro (10 ml) pesando la cantidad deseada de cloruro de O -acetylsalicyloyl y disolviéndolo en el disolvente en un matraz separado. El uso de un émbolo de la jeringa de plástico, añadir esta solución a la mezcla preparada en la etapa 1.1, y dejar la reacción agitar a 0 ° C.
  3. Controlar la reacción mediante cromatografía en capa fina (TLC). Las placas de TLC deben tener sílice como fase estacionaria.
    1. Preparar una fase móvil compuesta de 20:80 acetato de etilo (AcOEt) / hexano. En una cámara de TLC(O recipiente pequeño) añadir 5 ml de fase móvil para cubrir el fondo de la cámara.
      NOTA: La cantidad de fase móvil depende de la cámara seleccionada. Siempre añadir una cantidad suficiente para cubrir el fondo, pero una vez que el TLC se coloca en el interior, la línea de disolvente no debe sobrepasar la altura donde se detectaron los compuestos.
    2. Tomar una muestra de la reacción con una jeringa (0,2 ml), colocarlo en un pequeño vial, y se diluye con acetato de etilo (2-3 gotas). Con un observador TLC, tomar cuidadosamente una muestra de la mezcla de reacción se diluyó y la mancha en el TLC.
      NOTA: Los puntos deben ser 1-2 mm y esto debe hacerse en la parte inferior de 1/4 pulgada de la placa de TLC.
    3. En el mismo TLC, colocar una gota de una solución de cloruro de O-acetilsaliciloílo (0,2 mg en 0,5 ml de acetato de etilo) como una comparación. Una vez que los puntos están secos, colocarla en la cámara y se deja correr hasta que el frente del solvente casi ha alcanzado la parte superior del TLC.
    4. Tome el TLC fuera, dejar secar y visualizarlo bajo una lámpara UV. la reacción se completa cuando el punto de cloruro de O -acetylsalicyloyl desaparece de la mezcla de reacción.
    5. Cuando se completa la reacción, se retira el baño de hielo-agua, y permitir que la reacción en agitación a temperatura ambiente durante 20 hr.
  4. Filtrar el precipitado usando un embudo Buchner con un disco fritado de porosidad media. Colocar el sólido en un vial de centelleo, y dejar el compuesto en vacío durante la noche en un desecador a temperatura ambiente. Utilice pentóxido de fósforo (P 2 O 5) como el desecante.
  5. Secar un matraz de fondo redondo, colocándolo en un horno a 80 ° C durante al menos dos días antes de la creación de esta reacción. Alternativamente, sellar el matraz con un septum y perforar con una aguja que está conectado a un sistema de bomba de vacío. Encienda la bomba de vacío y se seca el matraz con una pistola de calor. Dejar enfriar, y repetir este paso 2 veces más.
  6. Inflar un globo usando gas argón, y conectarlo a una jeringa de plástico (cuya h émbolocomo han eliminado) con una aguja. Apague la bomba de vacío y retire la aguja unida a ella que se insertó en el matraz de fondo redondo secado ahora. Insertar la aguja conectado al globo de argón a través de la sellar el matraz de fondo redondo septum.
    1. Añadir éster 4-hidroximetil fenol de 2-acetiloxibenzoico ácido (100 mg, 0,349 mmol), 4-dimetilaminopiridina (4 mg, 0,033 mmol) y trietilamina (53 mg, 0,523 mmol) a un matraz separado, y luego los disolvió en tetrahidrofurano anhidro (5 ml). Con una jeringa de plástico unida a una aguja, añadir esta solución al matraz de fondo redondo sellado. Se enfría la mezcla a 0 ° C colocando el matraz en un baño de agua helada.
  7. A la mezcla anterior, se añade una solución de cloruro de etilo fumaroyl (68 mg, 0,419 mmol) en tetrahidrofurano anhidro (5 ml), gota a gota durante un período de 10 min. Se agita la solución resultante a 0-5 ° C durante 2-4 horas.
  8. Se extrae la mezcla de reacción con acetato de etilo (100 ml) y salmuera (50 ml). <br /> NOTA: La salmuera es una solución saturada de cloruro de sodio (NaCl). Para prepararlo, colocar 200 ml de agua en un recipiente de vidrio limpio y luego empezar a añadir NaCl (mientras se agita) hasta que no se disuelva más.
    1. Después de la extracción, eliminar la fase acuosa y repetir el último paso dos veces más.
    2. Se seca la mezcla mediante la adición de sulfato de sodio a la fase orgánica, hasta que el sólido no se aglutinan cuando el material de vidrio se agita. El uso de otro embudo de Buchner con un disco fritado, se filtra la mezcla a un matraz de fondo redondo para retirar el sulfato de sodio, luego se evapora a sequedad usando un evaporador rotatorio con la temperatura ajustada a 40 ° C.
  9. El uso de un TLC, determinar una fase móvil adecuada para utilizar en cromatografía en columna.
    NOTA: Para este experimento se utilizó un gradiente de 20:80 AcOEt / hexano.
  10. Preparar una columna con gel de sílice y la fase de disolvente apropiado. Una vez que se ha añadido el compuesto, añadir una capa de sulfato de sodio (o arena) a PRotect se añade la columna como el disolvente.
    1. A medida que la columna se extiende, controlar el eluato por TLC. Detectar cualquier otro tubo de ensayo, ya que se recogen de la columna. Cuando el producto de interés se eluye, mezclar todas las muestras que contenían el producto puro en un gran matraz de fondo redondo, y secarlas usando un evaporador rotatorio con la temperatura del baño fijado en 40 ° C.
      NOTA: El producto debe aparecer como un sólido blanco.
  11. Para confirmar la estructura de GTCpFE, recoger protón y de carbono (1 H y 13 C, respectivamente) los espectros de resonancia magnética nuclear (NMR) según las instrucciones del fabricante.
    NOTA: En este estudio se utilizó un espectrómetro de 400 MHz FT NMR para recoger el 1 H y 13 C espectros. Ejecutar al menos 25 exploraciones a temperatura ambiente para obtener una resolución suficiente de datos. Los picos de RMN observados fueron los siguientes, 1 H RMN (CDCl3): δ 1,29 (t, 3 H, 3J = 7,0 Hz, CH 3); 2,31 (s, 3 H, CH 3); 4,26 (q, 2 H, 3J = 7,0 Hz, COOCH 2); 5,25 (s, 2 H, OCH 2); 6,89 (s, 2 H, HC = CH); 7,19 (m, 3 H, Ar); 7,42 (m, 3 H, Ar); 7,65 (m, 1 H, Ar); 8,22 (dd, 1 H, 3J = 7.8, 4J = 1,2 Hz, Ar). 13 C RMN (CDCl3): 169.70, 164.86, 164.75, 162.89, 151.28, 150.69, 134.76, 134.32, 133.26, 133.16, 132.25, 129.81, 126.26, 124.11, 122.47, 122.04, 66.40, 61.43, 21.05, 14.15.
  12. Además, recoger un espectro de masas de alta resolución utilizando la espectrometría de masa de cromatografía líquida en combinación con trampa de iones y el tiempo-de la tecnología de vuelo (LCMS-IT-TOF) para mediciones precisas de masa según las instrucciones del fabricante.
    NOTA: En este estudio (M + NH4 +) calculado: 430,1496; observado: 430.1477.

2. GTCPFE inhibe la actividad NFĸB en células de cáncer de mama

  1. Cultivo Celular Condiciones
    1. Mantener líneas celulares de cáncer de mama humano, MCF-7 y MDA-MB-231 como por cul celular estándartécnicas tura y propagarse en un incubador humidificado a 37 ° C con 5% de CO 2.
      1. Preparar MCF-7 medio de células de Roswell Park Memorial Institute (RPMI) 1640 con rojo fenol suplementado con 10% de suero bovino fetal (FBS), aminoácidos no esenciales al 1%, 2 mM L-glutamina, 1% de antibióticos de penicilina-estreptomicina y 6 ng / ml de insulina. Preparar medio de células MDA-MB-231 de la mejora de medio esencial mínimo (IMEM) suplementado con 5% de FBS, aminoácidos no esenciales al 1%, 2 mM L-glutamina y 1% antibióticos de penicilina-estreptomicina.
  2. Ensayo Reportero NFkB-RE Luciferase
    1. Trypsinize células MCF-7 de cáncer de mama utilizando tripsina al 0,25% durante 5 min a 37 ° C, el contador manualmente usando un hemocitómetro y semillas en placas de 24 pocillos a 90.000 células por densidad también.
    2. Las siguientes células día, co-transfectar con el plásmido de ADN de un elemento de respuesta NFkB (NFkB-RE) constructo de luciferasa, 1 mg / pocillo, along con el promotor de Renilla constructo de luciferasa, 0,2 mg / pocillo. Realizar transfecciones para cada grupo de tratamiento por triplicado.
      1. Lavar las células dos veces con PBS, e incubar con mezclas de ADN de plásmido y 1 l por pocillo de reactivo de transfección (por ejemplo, lipofectamina) en medio libre de suero. Después de 6 horas, cambiar el medio a 1 ml de medio normal (sin antibióticos penicilina y estreptomicina).
    3. Después de 16 horas, añadir 1 l de vehículo o diferentes soluciones madre de la GTCpFE o drogas ASA a cada pocillo. Disolver soluciones de fármacos de acciones (100, 50, 20, 10 y 1 mM) en sulfóxido de dimetilo a 1,000x concentración. Después de la adición de las drogas, las células se incuban durante 2 horas a 37 ° C.
    4. Para activar la vía de NFkB, añadir la citoquina pro-inflamatoria TNF (10 mg / ml solución madre) en cada pocillo para una concentración final de 10 ng / ml y se incuba durante 4 hr. Incluir un control solo TNFa. Aspirar el medio y almacenar la células a -80 ° C.
    5. Medir la luciferasa usando un sistema de ensayo indicador de luciferasa según las instrucciones del fabricante.
      NOTA: Cuando se utiliza el sistema de ensayo de luciferasa (por ejemplo, sistema de ensayo de luciferasa Dual), por primera vez, preparar una solución de reactivo de ensayo de luciferasa por la re-suspensión en 10 ml de tampón y su almacenamiento a -80 ° C en alícuotas de 1 ml.
      1. Preparar tampón de lisis 1x diluyendo 5x tampón madre con agua. lisar las células en cada pocillo con 100 l de tampón de lisis 1X. Se incuban las placas en un agitador orbital durante 15 min, a velocidad media.
      2. Etiquetar un tubo de 1,5 ml por muestra. Descongelar reactivo de ensayo de luciferasa a temperatura ambiente (se necesitarán 50 l por muestra) y mantener en papel de aluminio. Prepare reactivo de extinción 1x en un vial de vidrio, la dilución 01:49 en tampón y se vórtice (será necesario 50 l por muestra).
      3. Añadir 10 l de lisado celular a un tubo de microcentrífuga etiquetado. A continuación, añadir 50 l de reactivo de ensayo de luciferasa ysuavemente vórtice. Inmediatamente después, se coloca el tubo en un soporte y se mide la luminiscencia a través del programa de luciferasa dual en el luminómetro. Seleccione y pulse el siguiente: Ejecutar Protocolos Promega Dual → → Glo OK.
      4. Añadir 50 l de reactivo de temple al tubo de ensayo y suavemente vórtice. Medir la luminiscencia. Repita estos pasos para cada muestra.
      5. Analizar datos utilizando una hoja de cálculo mediante la normalización de NFkB-RE con el control interno de Renilla (NFkB-RE / Renilla). Comparar inhibidores de datos sólo para el Control TNF (TNF solamente se fija en el 100%).
  3. NFkB-Gen Objetivo Transcripción
    1. Semilla de células MCF-7 en placas de 6 pocillos a 250.000 células por pocillo en 2 ml de volumen medio preparado como se describe en la sección 2.1.
    2. El día siguiente, añadir 2 l de diferentes GTCpFE 1,000x existencias (100, 50, 20, 10 y 1 mM) durante 2 horas antes de la adición de TNFa 10 ng / ml durante 2 hr. Ejecutar cada tratamientopor triplicado. Incluir solo vehículo y controles de TNFa.
    3. Aislar el ARN utilizando el método de extracción de tiocianato de guanidinio-fenol-cloroformo de acuerdo con las instrucciones del fabricante 22. Determinar la concentración de ARN (en pirocarbonato de dietilo (DEPC) de agua tratada) y la pureza de ARN usando un espectrofotómetro. Mantener las muestras de ARN en el hielo o almacenar a -80 ° C. Utilice sólo consejos de barrera libre de RNasa al manipular el ARN.
    4. Transcripción inversa 0,5 g de ARN total usando un kit disponible comercialmente de Moloney virus de la leucemia murina (M-MLV) de la transcriptasa inversa.
      NOTA: El kit incluye 5x tampón y ditiotreitol (DTT), junto con la mezcla de dNTP, y la mezcla de hexámeros al azar.
      1. Añadir 0,5 g de ARN a 200 unidades de M-MLV, dNTPs 0,5 mM, 100 ng de hexámeros aleatorios, 10 mM de DTT, 1x tampón y agua DEPC a un volumen final de reacción de 10 l. Llevar a cabo la reacción de la transcriptasa inversa usando un ciclador de PCR durante 50 min a 37 ° C, y después 15 min a 70 y# 176; C para calentar-inactivar la enzima.
    5. Diluir el producto ADNc resultante a 100 l con agua bidestilada y el uso de 2 l para cada reacción posterior reacción en cadena de polimerasa cuantitativa (PCR).
      1. Mezclar cebadores directo e inverso para el gen de interés en 1,25 M de concentración cada uno. Preparar una mezcla maestra con 2 l de agua doblemente destilada, 1 l de 1,25 M mezcla de cebadores y 5 l de 2x del colorante para permitir la detección del ADN de doble cadena. Cargar los 2 l de cDNA y 8 l de mezcla maestra en placas de 96 pocillos de PCR.
    6. Llevar a cabo la PCR cuantitativa usando un sistema de PCR en tiempo real (40 ciclos, 95 a 60 ° C) de acuerdo con las instrucciones del fabricante y analizar manualmente los datos.
      NOTA: Todos los cebadores de PCR utilizados han sido validados y se informó anteriormente 23.
    7. Calcular la expresión génica cambio veces usando una hoja de cálculo mediante el método ΔΔCt, con la proteína ribosomal 36B4 ARNm que actúa como control interno 23.

3. GTCpFE inhibe las células madre del cáncer de mama in vitro

  1. Ensayo de Formación mammosphere
    1. Preparar mammosphere (MS), completándolo de Eagle modificado por Dulbecco: mezcla de nutrientes F-12 (DMEM / F12) fenol medio libre de rojo con 1% de metilcelulosa. Dejar que se disuelva por agitación suave durante la noche a 4 ° C. Filtro de esterilizar el medio y suplementar con B27 1x, 1% de penicilina y estreptomicina, 5 mg / ml de insulina, 1 mg / ml de hidrocortisona, y factor de crecimiento epidérmico 20 ng / ml recombinante humano.
    2. Preparar las células individuales de la línea celular MDA-MB-231 por digestión con tripsina (tripsina al 0,25% durante 5 min a 37 ° C) de cultivos en monocapa y filtrar a través de tamices de malla. contar manualmente las células disociadas sola y la placa en placas de 96 pocillos ultra-bajas de fijación a una densidad de 400 células / pocillo. Al día siguiente, añadir diferentes concentraciones de GTCPFE (por ejemplo, concentraciones GTCpFE finales: 1, 10, 20, 50 m) para un volumen final es de 100 microlitros. Llevar a cabo todos los tratamientos por triplicado.
    3. Después de 7 días de cultivo en la incubadora, adquirir imágenes a través de un software de imágenes utilizando un microscopio invertido. contar manualmente el número EM> 75 micras de diámetro. Comparar el tratamiento farmacológico para el control del vehículo.
      NOTA: El diámetro de la EM> 75 micras se determina utilizando el software de imágenes.
  2. CD44 + CD24 - CSC inmunofenotipo
    1. Tripsinizar las células MDA-MB-231 con 0,25% de tripsina durante 5 min a 37 ° C. Contar usando un hemocitómetro y semillas en placas de 10 cm a los 3 millones de células por placa en 10 ml de medio como se describe en la sección 2.1. Añadir vehículo (10 l dimetilsulfóxido) o GTCpFE (10 l de 50 mM) a las células durante 72 horas.
    2. Para los grupos de tratamiento de vehículos o GTCpFE, trypsinize células (como en el paso 3.2.1) y distribuir 1 millón de células en 'Test & #39; o tubos de 5 ml de poliestireno "control" que contienen 2 ml de solución salina equilibrada de Hank 1x (HBSS) de tampón suplementado con FBS al 2%.
    3. Para la tinción de la superficie CD44 y CD24 marcadores, las células de girar y añadir 20 l de cada anticuerpo conjugado y HBSS + FBS al 2% a tubos de ensayo para un final de 100 l de volumen general (dilución 1: 5). Añadir 100 l de HBSS + 2% de FBS a control los tubos. Incluir CD44-APC y anticuerpo conjugado anticuerpo CD24-PE controles de manchas individuales o los controles immunoisotype IgG.
    4. Se incuban las células en la oscuridad a 4 ° C durante 30 min. Centrifugar las células durante 5 min a 400 xg y reconstituir en 200 l de tampón HBSS con FBS al 2%. Mantener las células en hielo en la oscuridad.
    5. Realizar la clasificación celular activada por fluorescencia (FACS) de células vivas utilizando un instrumento analizador FACS de acuerdo con las instrucciones del fabricante. Recoge al menos 50.000 eventos para cada tubo. tratamientos por triplicado.
      NOTA: apertura de puerta se basa en controles de ninguna tinción (Control tubo), immunoisotypes IgG, y el CD44-APC y las manchas individuales CD24-PE.
    6. Analizar los datos utilizando un software de citometría de flujo disponible.
      NOTA: El porcentaje de células tratadas con GTCpFE con el CD44 + CD24 - inmunofenotipo se estima y se compara con el control del vehículo.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

En la Figura 1, la estructura química de la aspirina profármaco-fumarato, GTCpFE, y su actividad inhibidora de la citoquina inducida vía NFĸB en células de cáncer de mama se indican. GTCpFE inhibe ambos extremos NFĸB, NFĸB-RE actividad de luciferasa (Figura 1B) y la expresión de NFĸB genes diana, como la Molécula de Adhesión Intercelular 1 (ICAM1), quimiocina CC Motif ligando 2 (CCL2), y el factor de necrosis tumoral (TNF) (Figura 1C) en MCF-7 de cáncer de mama. Calculado concentración inhibitoria al 50% (IC 50) valor en ambos extremos es de ~ 20 M. IC 50 valor se calcula utilizando un software de gráficos. En comparación sí ASA incluso a 200 micras (10x IC 50 de GTCpFE) no muestra actividad inhibidora (Figura 1B, línea azul) en células de cáncer de mama. Esto indica que la estrategia de profármaco de la adición de farmacóforo fumarato de ASA SIGNIFICAntly mejora su actividad anti-NFĸB.

Para medir la actividad anti-CSC, se utilizaron dos ensayos: el mammosphere (MS) ensayo de formación y la población de células que expresan el CD44 + CD24 - inmunofenotipo, un marcador de superficie CSC de buena fe en el cáncer de mama 24. GTCpFE inhibe la formación de MS de MDA-MB-231 células de cáncer de mama de una manera dependiente de la dosis se muestra en la Figura 2A. Al igual que en la inhibición de la vía NFĸB en cultivos adherentes, el valor IC50 para la formación mammosphere es de ~ 20 mM. Se espera que esta coherencia, dado que se basan en los CAC NFĸB señalización para la supervivencia y propagación 16-21. Además, GTCpFE pre-tratamiento dio como resultado un agotamiento significativo de la CD44 + CD24 - población (Figura 2B) en células MDA-MB-231. En conjunto, estos resultados establecen la capacidad de GTCpFE para apuntar eficazmente células madre cancerosas de mama.

Figura 1
Figura 1: GTCpFE inhibe la vía NFĸB en células de cáncer de mama. (A) La estructura química de la aspirina profármaco-fumarato, GTCpFE. (B - C) MCF-7 células se trataron previamente durante 2 h con diversas concentraciones de GTCpFE, ASA, o vehículo seguido de tratamiento con TNF (10 ng / ml) durante 2-4 hr. Actividad (B) NFkB-RE se midió mediante un ensayo indicador de luciferasa dual. (C) Expresión de genes diana NFkB, ICAM1, CCL2 y TNF se midió mediante RT-qPCR. la actividad inhibidora de la droga se representa como% de TNF solo. Los datos se presentan como media ± SEM. Esta cifra ha sido modificado de referencia 15. Haga clic aquí para ver una versión más grande de esta figure.

Figura 2
Figura 2: GTCpFE inhibe la formación mammosphere y el CD44 + CD24 - inmunofenotipo de las células del cáncer de mama. (A) mammosphere (MS) formación de células MDA-MB-231 se midió después del tratamiento con diferentes concentraciones de GTCpFE. La cuantificación del crecimiento EM (izquierda) y las imágenes representativas de la EM a 20x (derecha) se muestran. El efecto de GTCpFE se representa como% de control del vehículo. (B) El CD44 + CD24 - población se determinó mediante análisis FACS de las células MDA-MB-231 tratadas con 50 mM GTCpFE de 72 hr. se muestra la cuantificación de cada porcentaje de la población (izquierda) y gráficos de dispersión representativos de FACS (derecha). Los datos se presentan como media ± SEM y análisis estadístico de ANOVA de 2 vías SSadeudado por Tukey post-test. *** P <0,001. Esta cifra ha sido modificado de referencia 15.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
RPMI 1640 Red Medium Life Technologies  11875-093 Warm up to 37 °C before use
IMEM Corning 10-024-CV Warm up to 37 °C before use
DMEM / F12 Medium ThermoFisher 21041-025 Warm up to 37 °C before use
MEM NEAA 10 mM 100x Life Technologies  11140
Penicillin Streptomycin Life Technologies  15140-122
L-Glutamine 100x Life Technologies  25030-081
Insulin Sigma-Aldrich I-1882
Fetal Bovine Serum  Atlanta Biologicals S11150
Trypsin 2.5% 10x Invitrogen 15090046
Methyl Cellulose Sigma  M0262
B27 Supplement 50x Gibco 17504-044
EGF Gibco PHG0311L
NFκB-RE Luciferase Construct  Clontech  pGL4.32
Renilla Luciferase Construct  Promega pGL4.70
Lipofectamine 2000 ThermoFisher 11668-019
Dual-Luciferase Reporter Assay  Promega 120000032
NanoDrop Spectrophotometer ThermoFisher
Eppendorf Mastercycler  Eppendorf
StepOne Real Time PCR System Thermo Scientific
Eclipse Microscope Nikon
CyAn ADP Analyzer  Beckman Coulter
QCapture Software QImaging
Summit Software Beckman Coulter
GraphPad Software Prism
TRIzol ThermoFisher 15596-018
M-MLV Reverse Transcriptase Invitrogen 28025-013
100 mM dNTP Set Invitrogen 10297-018
Random Hexamers  Invitrogen 48190-011
Fast SYBR Green Master Mix ThermoFisher 4385612
Costar 96W, ultra low attachment  Corning 3474
HBSS, 1x ThermoFisher 14025134
CD44-APC conjugated antibody  BD Pharmingen 560990 Store at 4 °C, protect from light
CD24-PE antibody BD Pharmingen 560991 Store at 4 °C, protect from light
Recombinant Human TNFα Fisher 210TA100 
CCL2 Primer Forward Sequence AGAATCACCAGCAGCAAGTGTCC
CCL2 Primer Reverse Sequence TCCTGAACCCACTTCTGCTTGG
ICAM1 Primer Reverse Sequence TGACGAAGCCAGAGGTCTCAG
ICAM1 Primer Forward Sequence AGCGTCACCTTGGCTCTAGG
TNF Primer Forward Sequence AAGGGTGACCGACTCAGCG
TNF Primer Reverse Sequence ATCCCAAAGTAGACCTGCCCA
36B4 Primer Forward Sequence GTGTTCGACAATGGCAGCAT
36B4 Primer Reverse Sequence GACACCCTCCAGGAAGCGA
Sodium Hydroxide Sigma-Aldrich S5881-500G
4-Hydroxybenzyl Alcohol Sigma-Aldrich 20806-10G
O-Acetylsalicyloyl Chloride Sigma-Aldrich 165190-5G
Phosphorous Pentoxide Sigma-Aldrich 79610-100G
Ethyl Fumaroyl Chloride Sigma-Aldrich 669695-1G
Sodium Sulfate Sigma-Aldrich 246980-500G
4-Dimethylaminopyridine Sigma-Aldrich 714844-100ML 0.5 M in tetrahydrofuran
Triethylamine Sigma-Aldrich T0886-100ML
Toluene Sigma-Aldrich 244511-100ML
Ethyl Acetate Sigma-Aldrich 270989-100ML
Tetrahydrofuran Sigma-Aldrich 401757-2L
400 MHz FT NMR spectrometer  See Bruker’s Avance User’s Manual, version 000822 for details

DOWNLOAD MATERIALS LIST

References

  1. Hanahan, D., Weinberg, R. A. Hallmarks of cancer: the next generation. Cell. 144, 646-674 (2011).
  2. Cuzick, J., et al. Aspirin and non-steroidal anti-inflammatory drugs for cancer prevention: an international consensus statement. Lancet Oncol. 10, 501-507 (2009).
  3. Terry, M. B., et al. Association of frequency and duration of aspirin use and hormone receptor status with breast cancer risk. JAMA. 291, 2433-2440 (2004).
  4. Wang, D., Dubois, R. N. Cyclooxygenase-2: a potential target in breast cancer. Semin Oncol. 31, 64-73 (2004).
  5. Howe, L. R. Inflammation and breast cancer. Cyclooxygenase/prostaglandin signaling and breast cancer. Breast Cancer Res. 9. 9, 210 (2007).
  6. Kopp, E., Ghosh, S. Inhibition of NF-kappa B by sodium salicylate and aspirin. Science. 265, 956-959 (1994).
  7. Yin, M. J., Yamamoto, Y., Gaynor, R. B. The anti-inflammatory agents aspirin and salicylate inhibit the activity of I(kappa)B kinase-beta. Nature. 396, 77-80 (1998).
  8. Pierce, J. W., Read, M. A., Ding, H., Luscinskas, F. W., Collins, T. Salicylates inhibit I kappa B-alpha phosphorylation, endothelial-leukocyte adhesion molecule expression, and neutrophil transmigration. J Immunol. 156, 3961-3969 (1996).
  9. Frasor, J., El-Shennawy, L., Stender, J. D., Kastrati, I. NFkappaB affects estrogen receptor expression and activity in breast cancer through multiple mechanisms. Mol Cell Endocrinol. 418, 235-239 (2014).
  10. Perkins, N. D. The diverse and complex roles of NF-kappaB subunits in cancer. Nat Rev Cancer. 12, 121-132 (2012).
  11. DiDonato, J. A., Mercurio, F., Karin, M. NF-kappaB and the link between inflammation and cancer. Immunol Rev. 246, 379-400 (2012).
  12. Scarpignato, C., Hunt, R. H. Nonsteroidal antiinflammatory drug-related injury to the gastrointestinal tract: clinical picture, pathogenesis, and prevention. Gastroenterol Clin North Am. 39, 433-464 (2010).
  13. Sostres, C., Gargallo, C. J. Gastrointestinal lesions and complications of low-dose aspirin in the gastrointestinal tract. Best Pract Res Clin Gastroenterol. 26, 141-151 (2012).
  14. Kastrati, I., et al. Dimethyl Fumarate Inhibits the Nuclear Factor kappaB Pathway in Breast Cancer Cells by Covalent Modification of p65 Protein. J Biol Chem. 291, 3639-3647 (2016).
  15. Kastrati, I., et al. A novel aspirin prodrug inhibits NFkappaB activity and breast cancer stem cell properties. BMC Cancer. 15, 845 (2015).
  16. Cao, Y., Luo, J. L., Karin, M. IkappaB kinase alpha kinase activity is required for self-renewal of ErbB2/Her2-transformed mammary tumor-initiating cells. Proc Natl Acad Sci U S A. 104, 15852-15857 (2007).
  17. Liu, M., et al. The canonical NF-kappaB pathway governs mammary tumorigenesis in transgenic mice and tumor stem cell expansion. Cancer Res. 70, 10464-10473 (2010).
  18. Korkaya, H., Liu, S., Wicha, M. S. Regulation of cancer stem cells by cytokine networks: attacking cancer's inflammatory roots. Clin Cancer Res. 17, 6125-6129 (2011).
  19. Hinohara, K., et al. ErbB receptor tyrosine kinase/NF-kappaB signaling controls mammosphere formation in human breast cancer. Proc Natl Acad Sci U S A. 109, 6584-6589 (2012).
  20. Kendellen, M. F., Bradford, J. W., Lawrence, C. L., Clark, K. S., Baldwin, A. S. Canonical and non-canonical NF-kappaB signaling promotes breast cancer tumor-initiating cells. Oncogene. 33, 1297-1305 (2014).
  21. Yamamoto, M., et al. NF-kappaB non-cell-autonomously regulates cancer stem cell populations in the basal-like breast cancer subtype. Nat Commun. 4, 2299 (2013).
  22. Rio, D. C., Ares, M., Hannon, G. J., Nilsen, T. W. Purification of RNA using TRIzol (TRI reagent). Cold Spring Harb Protoc. (2010).
  23. Frasor, J., et al. Positive cross-talk between estrogen receptor and NF-kappaB in breast cancer. Cancer Res. 69, 8918-8925 (2009).
  24. Al-Hajj, M., Wicha, M. S., Benito-Hernandez, A., Morrison, S. J., Clarke, M. F. Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci U S A. 100, 3983-3988 (2003).
  25. Vandermeeren, M., et al. Dimethylfumarate is an inhibitor of cytokine-induced nuclear translocation of NF-kappa B1, but not RelA in normal human dermal fibroblast cells. J Invest Dermatol. 116, 124-130 (2001).
  26. Loewe, R., et al. Dimethylfumarate inhibits TNF-induced nuclear entry of NF-kappa B/p65 in human endothelial cells. J Immunol. 168, 4781-4787 (2002).
  27. Seidel, P., et al. Dimethylfumarate inhibits NF-{kappa}B function at multiple levels to limit airway smooth muscle cell cytokine secretion. Am J Physiol Lung Cell Mol Physiol. 297, L326-L339 (2009).
  28. Wilms, H., et al. Dimethylfumarate inhibits microglial and astrocytic inflammation by suppressing the synthesis of nitric oxide, IL-1beta, TNF-alpha and IL-6 in an in-vitro model of brain inflammation. J Neuroinflammation. 7, 30 (2010).
  29. Peng, H., et al. Dimethyl fumarate inhibits dendritic cell maturation via nuclear factor kappaB (NF-kappaB) and extracellular signal-regulated kinase 1 and 2 (ERK1/2) and mitogen stress-activated kinase 1 (MSK1) signaling. J Biol Chem. 287, 28017-28026 (2012).
  30. Li, H. J., Reinhardt, F., Herschman, H. R., Weinberg, R. A. Cancer-stimulated mesenchymal stem cells create a carcinoma stem cell niche via prostaglandin E2 signaling. Cancer Discov. 2, 840-855 (2012).
  31. Li, X., et al. Intrinsic resistance of tumorigenic breast cancer cells to chemotherapy. J Natl Cancer Inst. 100, 672-679 (2008).
  32. Diehn, M., et al. Association of reactive oxygen species levels and radioresistance in cancer stem cells. Nature. 458, 780-783 (2009).
  33. Hollier, B. G., Evans, K., Mani, S. A. The epithelial-to-mesenchymal transition and cancer stem cells: a coalition against cancer therapies. J Mammary Gland Biol Neoplasia. 14, 29-43 (2009).
  34. Velasco-Velazquez, M. A., Popov, V. M., Lisanti, M. P., Pestell, R. G. The role of breast cancer stem cells in metastasis and therapeutic implications. Am J Pathol. 179, 2-11 (2011).
  35. Dontu, G., et al. In vitro propagation and transcriptional profiling of human mammary stem/progenitor cells. Genes Dev. 17, 1253-1270 (2003).
  36. Charafe-Jauffret, E., et al. Cancer stem cells in breast: current opinion and future challenges. Pathobiology. 75, 75-84 (2008).
  37. Clayton, H., Titley, I., Vivanco, M. Growth and differentiation of progenitor/stem cells derived from the human mammary gland. Exp Cell Res. 297, 444-460 (2004).
  38. Ginestier, C., et al. ALDH1 is a marker of normal and malignant human mammary stem cells and a predictor of poor clinical outcome. Cell Stem Cell. 1, 555-567 (2007).
  39. Rosen, J. M., Jordan, C. T. The increasing complexity of the cancer stem cell paradigm. Science. 324, 1670-1673 (2009).
  40. Visvader, J. E., Lindeman, G. J. Cancer stem cells in solid tumours: accumulating evidence and unresolved questions. Nat Rev Cancer. 8, 755-768 (2008).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics