Syntese og karakterisering af en Aspirin-fumarat prodrug, Hæmmer NFKB Aktivitet og brystkræft Stamceller

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Kastrati, I., Delgado-Rivera, L., Georgieva, G., Thatcher, G. R., Frasor, J. Synthesis and Characterization of an Aspirin-fumarate Prodrug that Inhibits NFκB Activity and Breast Cancer Stem Cells. J. Vis. Exp. (119), e54798, doi:10.3791/54798 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Inflammation er en kræft adelsmærke, der ligger til grund for forekomsten af ​​kræft og forfremmelse, og til sidst progression til metastaser. Derfor tilføjer en anti-inflammatorisk lægemiddel til standard cancer regimenter kan forbedre patientens udfald. Et sådant lægemiddel, aspirin (acetylsalicylsyre, ASA), er blevet undersøgt for kræft chemoforebyggelse og antitumoraktivitet. Udover at hæmme cyclooxygenase 2-prostaglandin akse, har ASA anti-cancer aktiviteter også blevet tilskrevet nuklear faktor ĸB (NFĸB) hæmning. Fordi langvarig ASA brug kan forårsage gastrointestinal toksicitet, har en prodrug strategi blevet gennemført med succes. I denne prodrug design carboxylsyren med ASA er maskeret og yderligere farmakoforer er inkorporeret.

Denne protokol beskriver, hvordan vi syntetiseret en aspirin-fumarat prodrug, GTCpFE, og karakteriseret dets inhibering af NFĸB vejen i brystcancerceller og dæmpning af kræft stamceller-lignende korrektbånd, en vigtig NFĸB-afhængig fænotype. GTCpFE effektivt inhiberer NFĸB vejen i brystcancercellelinier henviser ASA mangler enhver inhiberende aktivitet, hvilket indikerer, at tilsætning fumarat til ASA struktur bidrager væsentligt til dets aktivitet. Desuden GTCpFE viser signifikant anti-cancer stamceller aktivitet ved at blokere mammosphere dannelse og formildende kræft stamceller associeret CD44 + CD24 - immunofænotype. Disse resultater etablere en levedygtig strategi at udvikle bedre anti-inflammatoriske lægemidler til chemoprevention og kræftbehandling.

Introduction

Inflammation er et adelsmærke, der ligger til grund for flere aspekter af tumorigenese, såsom forekomst, forfremmelse og i sidste ende progression til metastaser 1. I brystkræft, er dette yderligere understøttet af epidemiologiske observationer der viser, at regelmæssig brug af den klassiske ikke-steroide anti-inflammatorisk lægemiddel aspirin (acetylsalicylsyre, ASA) er forbundet med en reduktion af både brystkræft incidens, og risikoen for metastase og tilbagefald 2,3. ASA virker primært ved at hæmme cyclooxygenase-2-aktivitet, som ofte opreguleret i brystkræft 4,5. Imidlertid kan anti-cancer virkninger af ASA også være formidlet ved at undertrykke afvigende nuklear faktor KB (NFKB) signalering 6-8. Dette er vigtigt, fordi en dereguleret NFKB pathway fremmer tumorcelleoverlevelse, proliferation, migration, invasion, angiogenese, og resistens over for behandling 9-11. NFKB-aktivering er også kritisk til monteringet immunrespons. Derfor, for anti-cancer terapi, hvor langvarig NFKB inhibering er påkrævet, må man overveje de skadelige bivirkninger, der involverer langvarig immunsuppression. Derfor kan ASA tjene som et godt udgangspunkt for terapeutisk optimering.

Én begrænsning for ASA anvendelse i cancerterapi er de forhøjede doser, der kræves for cyclooxygenase 2 og NFKB inhibering, som er forbundet med gastrointestinal toksicitet, såsom mavesår og maveblødning 12,13. Men konvertering ASA i så esterprolægemiddel, kan reducere ASA gastrointestinal toksicitet. For yderligere at øge styrken og / eller tilføje funktionalitet, kan yderligere strukturelle elementer eller accessoriske farmakoforer også inkorporeres i esterprolægemiddel design. En sådan farmakofor tilsættes for at forøge ASA potensering over den NFKB-vejen er fumarat, som vi tidligere har vist sig at være vigtigt for NFKB pathway inhibering 14,15.

15, GTCpFE, og den hypotese, at en sådan hybridmolekyle ville være sikkert endnu potent mod NFKB-vejen. Vi testede sin anti-NFicB aktivitet i brystcancerceller og dens evne til at blokere brystcancer stamceller (CSCS) 15, der er afhængige af NFKB signalering for overlevelse og vækst 16-21. Vi finder, at styrken af GTCpFE mod NFKB vej forbedres betydeligt i ASA 15. Desuden GTCpFE blokerer mammosphere dannelse og dæmper CSC overflade markør CD44 + CD24 - immunofænotype, hvilket indikerer, at GTCpFE er i stand til at udrydde CSCS 15. Disse resultater fastslår aspirin-fumarat prodrug som et effektivt anti-inflammatorisk middel, som også kan målrette bryst CSCS. Med hensyn til behandling af brystkræft, kan GTCpFE har potentiale til at behandle aggressiv og dødelig sygdom.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Syntese af aspirin-fumarat Prodrug GTCpFE

  1. Ved hjælp af en plast stempel sprøjte, måle 0,81 ml (20 mmol) methanol og bland det i vand (10 ml) i en rundbundet kolbe. Afkøl den resulterende blanding til 0 ° C ved at anbringe kolben i et is-vand-bad. Tilsæt 4-hydroxybenzylalkohol (2,48 mg, 20 mmol) og omrør reaktionsblandingen, indtil opløsningen er klar.
  2. Der fremstilles en opløsning af O -acetylsalicyloyl chlorid (3,77 mg, 19 mmol) i vandfri toluen (10 ml) ved at veje den ønskede mængde af O -acetylsalicyloyl chlorid og opløse den i opløsningsmidlet i en separat kolbe. Ved hjælp af en plastik stempel sprøjte, tilføj denne løsning til blandingen forberedt i trin 1.1, og lade reaktionen omrøring ved 0 ° C.
  3. Overvåg reaktionen ved anvendelse af tyndtlagskromatografi (TLC). TLC-pladerne skal have silica som en stationær fase.
    1. Der fremstilles en mobil fase bestående af 20:80 ethylacetat (AcOEt) / hexan. I en TLC kammer(Eller lille beholder) tilsættes 5 ml mobil fase for at dække bunden af ​​kammeret.
      BEMÆRK: Mængden af ​​mobil fase afhænger af den valgte kammer. Altid tilføje nok til at dække bunden, men når TLC er placeret inde, bør opløsningsmidlet linje ikke overgå højde, hvor forbindelserne er plettet.
    2. Tag en prøve af reaktionen med en sprøjte (0,2 ml), som anbringes i en lille hætteglas, og fortynde det med ethylacetat (2-3 dråber). Med en TLC spotter, omhyggeligt tage en prøve af den fortyndede reaktionsblandingen og spotte det i TLC.
      BEMÆRK: Pletterne skal være 1-2 mm, og dette bør ske i den nedre 1/4 tomme af TLC-pladen.
    3. På samme TLC, placere en plet af en opløsning af O-acetylsalicyloylchlorid (0,2 mg i 0,5 ml ethylacetat) som en sammenligning. Når pletterne er tørre, placere den i kammeret, og lad den køre, indtil væskefronten har næsten nået toppen af ​​TLC.
    4. Tag TLC ud, lad det tørre og visualisere det under en UV-lampe. Den Reacer fuldført, når O -acetylsalicyloyl chlorid spot forsvinder fra reaktionsblandingen.
    5. Når reaktionen er afsluttet, fjernes isvandbad, og reaktionen at omrøre ved stuetemperatur i 20 timer.
  4. Filtrer bundfaldet under anvendelse af en Buchner-tragt med en frittet skive af medium porøsitet. Anbring det faste stof i et scintillationshætteglas, og lade forbindelsen i vakuum natten over i en ekssikkator ved stuetemperatur. Brug phosphorpentoxid (P 2 O 5) som tørremiddel.
  5. Tørre en rundbundet kolbe ved at placere det i en ovn ved 80 ° C i mindst to dage før opsætning denne reaktion. Alternativt kolben til med en skillevæg og gennembore den med en nål, der er forbundet til en vakuumpumpe system. Drej vakuumpumpen på og kolben tørt med en varmepistol. Lad den køle af, og gentage dette trin 2 gange mere.
  6. Pump en ballon med argon gas, og tilslut den til en plastik sprøjte (hvis stempel hsom er fjernet) med en nål. Sluk for vakuumpumpe og fjern nålen knyttet til det, der blev indsat i den nu rundbundet kolbe. Stik nålen forbundet til argon ballonen gennem skillevæggen tætne rundbundet kolbe.
    1. Tilsæt 4-hydroxymethylphenol ester af 2-acetyloxybenzoic syre (100 mg, 0,349 mmol), 4-dimethylaminopyridin (4 mg, 0,033 mmol) og triethylamin (53 mg, 0,523 mmol) til en separat kolbe, derefter opløst dem i vandfri tetrahydrofuran (5 ml). Med en plastsprøjte fastgjort til en nål, tilføje denne opløsning til den forseglede rundbundet kolbe. Afkøl blandingen til 0 ° C ved at anbringe kolben i et isvandbad.
  7. Til den foregående blanding, tilsæt en opløsning af ethyl fumaroyl chlorid (68 mg, 0,419 mmol) i vandfri tetrahydrofuran (5 ml), dråbevis over et tidsrum på 10 min. Omrør den resulterende opløsning ved 0-5 ° C i 2-4 timer.
  8. Ekstraher reaktionsblandingen med ethylacetat (100 ml) og saltvand (50 ml). <br /> BEMÆRK: Brine er en mættet opløsning af natriumchlorid (NaCl). For at forberede det, placere 200 ml vand i en ren glasbeholder derefter begynde at tilføje NaCl (under omrøring), indtil den ikke opløses længere.
    1. Efter ekstraktion fjernes den vandige fase og gentag sidstnævnte trin to gange mere.
    2. Tør blandingen ved tilsætning natriumsulfat til den organiske fase, indtil det faste stof ikke klumpe op, når glasvarer omrøres. Brug af en anden Buchner-tragt med en frittet disk, filtrere blandingen til en rundbundet kolbe til fjernelse af natriumsulfat, derefter inddampes til tørhed under anvendelse af en rotationsfordamper med temperaturen indstillet til 40 ° C.
  9. Ved hjælp af en TLC, fastlægge en ordentlig mobil fase til brug i søjlekromatografi.
    BEMÆRK: Til dette forsøg blev anvendt en gradient af 20:80 AcOEt / hexan.
  10. Forbered en kolonne med silicagel, og passende fase opløsningsmiddel. Når forbindelsen er blevet tilsat, tilsættes et lag af natriumsulfat (eller sand) med protect søjlen som opløsningsmidlet tilsættes.
    1. Som kolonne kører, overvåge eluatet ved TLC. Spot hver anden reagensglas som de opsamles fra søjlen. Når produktet af interesse elueres, bland alle prøver indeholdende rent produkt i et stort rundbundet kolbe, og tør dem på en rotationsfordamper med badtemperatur på 40 ° C.
      BEMÆRK: Produktet skal vises som et hvidt fast stof.
  11. For at bekræfte strukturen af GTCpFE, indsamle proton- og carbon (1 H og 13 C) kernemagnetisk resonans (NMR) spektre i henhold til producentens anvisninger.
    BEMÆRK: I dette studie en 400 MHz FT NMR-spektrometer blev anvendt til at opsamle 1H og 13C-spektre. Køre mindst 25 scanninger ved stuetemperatur for at opnå nok data opløsning. NMR-toppe observerede følgende, 1H NMR (CDCl3): δ 1,29 (t, 3H, 3J = 7,0 Hz, CH3); 2,31 (s, 3H, CH3); 4,26 (q, 2H, 3J = 7,0 Hz, COOCH2); 5,25 (s, 2 H, OCH2); 6,89 (s, 2H, HC = CH); 7,19 (m, 3 H, Ar); 7,42 (m, 3 H, Ar); 7,65 (m, 1H, Ar); 8,22 (dd, 1H, 3J = 7,8, 4J = 1,2 Hz, Ar). 13C NMR (CDCI3) o: 169,70, 164,86, 164,75, 162,89, 151,28, 150,69, 134,76, 134,32, 133,26, 133,16, 132,25, 129,81, 126,26, 124,11, 122,47, 122,04, 66,40, 61,43, 21,05, 14,15.
  12. Derudover indsamle en højopløsningsmassespektrum hjælp væskekromatografi-massespektrometri i kombination med ionfælde og tid-søgning teknologi (LCMS-IT-TOF) for præcise massemålinger ifølge producentens anvisninger.
    BEMÆRK: I dette studie (M + NH4 +) beregnet: 430,1496; observeret: 430,1477.

2. GTCPFE Hæmmer den NFĸB aktivitet i Breast Cancer Cells

  1. Celledyrkningsforhold
    1. Opretholde humane brystcancercellelinier, MCF-7 og MDA-MB-231 i henhold til standard celle cultidige teknikker og udbrede sig i en fugtig inkubator ved 37 ° C med 5% CO2.
      1. Forbered MCF-7-celle medium fra Roswell Park Memorial Institute (RPMI) 1640 medium med phenolrødt suppleret med 10% føtalt bovint serum (FBS), 1% ikke-essentielle aminosyrer, 2 mM L-glutamin, 1% antibiotika penicillin-streptomycin og 6 ng / ml insulin. Forbered MDA-MB-231-celle medium fra Forbedret Minimum Essential Medium (IMEM) suppleret med 5% FBS, 1% ikke-essentielle aminosyrer, 2 mM L-glutamin og 1% antibiotika penicillin-streptomycin.
  2. NFKB-RE Luciferase Reporter Assay
    1. Trypsinisér brystkræft MCF-7 celler under anvendelse af 0,25% trypsin i 5 minutter ved 37 ° C, manuelt tælle anvendelse af et hæmocytometer og frø i 24-brønds plader ved 90.000 celler per brønd tæthed.
    2. Den følgende dag cotransfektion celler med plasmid DNA af en NFKB responselement (NFKB-RE) luciferase-konstruktion, 1 ug / brønd, alOng med promotorløse Renilla luciferase-konstruktion, 0,2 ug / brønd. Udfør transfektioner for hver behandlingsgruppe i tre eksemplarer.
      1. Vask cellerne to gange med PBS, og inkuberes med blandinger af plasmid-DNA og 1 pi per brønd af transfektionsreagens (f.eks lipofectamin) i serumfrit medie. Efter 6 timer, ændre mediet til 1 ml almindelig medium (uden antibiotika penicillin og streptomycin).
    3. Efter 16 timer tilsættes 1 ml af vehikel eller forskellige stamopløsninger af GTCpFE eller ASA lægemidler til hver brønd. Opløs narkotika stamopløsninger (100, 50, 20, 10 og 1 mM) i dimethylsulfoxid ved 1.000 x koncentration. Efter tilføjelse af stoffer, inkuberes cellerne i 2 timer ved 37 ° C.
    4. For at aktivere NFKB pathway, tilsæt den pro-inflammatoriske cytokin TNFa (10 ug / ml stamopløsning) i hver brønd til en slutkoncentration på 10 ng / ml og inkuberes i 4 timer. Medtag en alene TNF-kontrol. Aspirer medium og gemme cellens ved -80 ° C.
    5. Mål luciferase under anvendelse af en luciferase reporter assay ifølge producentens anvisninger.
      BEMÆRK: Ved brug af luciferase assaysystem (f.eks Dual Luciferase assaysystem) for første gang, fremstilles en opløsning af luciferase-assay-reagens ved igen at suspendere det i 10 ml buffer og lagring ved -80 ° C i portioner på 1 ml.
      1. Forbered 1x lysepuffer ved at fortynde 5x stock buffer med vand. Lyserer cellerne i hver brønd under anvendelse af 100 pi 1x lysisbuffer. Inkubér pladerne på en orbitalryster i 15 min, ved middel hastighed.
      2. Afmærk et 1,5 ml rør per prøve. Tø luciferase assayreagens til stuetemperatur (vil være nødvendig 50 pi per prøve) og holde i folie. Forbered 1x quenching reagens i et hætteglas, 1:49 fortynding i puffer og vortex det (vil være nødvendig 50 pi per prøve).
      3. Tilsæt 10 pi cellelysat til en mærket mikrocentrifugeglas. Derefter tilsættes 50 pi luciferase assayreagens ogforsigtigt vortex. Umiddelbart efter, at placere røret i en holder og måle luminescens via den dobbelte luciferase program i luminometeret. Vælg og tryk følgende: Kør Promega Protokoller → Dual Glo → OK.
      4. Der tilsættes 50 ul af quenching reagens til reagensglasset og forsigtigt vortex. Mål luminescensen. Gentag disse trin for hver prøve.
      5. Analysere data ved hjælp af regneark ved at normalisere NFKB-RE til den interne kontrol Renilla (NFKB-RE / Renilla). Undersøg inhibitor data til TNF kun kontrol (TNF kun er sat til 100%).
  3. NFKB-målgen Transskription
    1. Seed MCF-7 celler i 6-brønds plader på 250.000 celler per brønd i 2 ml medium volumen fremstillet som beskrevet i afsnit 2.1.
    2. Den følgende dag tilsættes 2 pi forskellige GTCpFE 1.000 x bestande (100, 50, 20, 10 og 1 mM) i 2 timer før tilsætning TNFa 10 ng / ml i yderligere 2 timer. Kør hver behandlingi tre eksemplarer. Medtag køretøj og TNFa- alene kontroller.
    3. Isoler RNA under anvendelse af guanidiniumthiocyanat-phenol-chloroform ekstraktion Fremgangsmåde ifølge instruktionerne fra fabrikanten 22. Bestem RNA koncentration (i diethylpyrocarbonat (DEPC) -behandlet vand) og RNA renhed under anvendelse af et spektrofotometer. Hold RNA-prøver på is eller opbevares ved -80 ° C. Brug kun RNase-fri barriere tips ved håndtering RNA.
    4. Revers transkribere 0,5 ug totalt RNA ved anvendelse af et kommercielt tilgængeligt kit af Moloney leukæmivirus (M-MLV) revers transkriptase.
      BEMÆRK: Sættet indeholder 5x buffer og dithiothreitol (DTT), sammen med dNTP blanding, og tilfældige hexamerer blandingen.
      1. Tilsæt 0,5 ug RNA til 200 enheder M-MLV, 0,5 mM dNTP'er, 100 ng af tilfældige hexamerer, 10 mM DTT, 1 x buffer og DEPC vand til en endelig 10 ul reaktionsvolumen. Udføre revers transkriptase under anvendelse af en PCR variator i 50 min ved 37 ° C, og derefter 15 minutter ved 70 &# 176; C til varme inaktivering af enzymet.
    5. Fortynd den resulterende cDNA-produktet til 100 pi med dobbelt-destilleret vand og anvende 2 pi for hver efterfølgende kvantitativ polymerasekædereaktion (PCR) omsætning.
      1. Bland fremad og reverse primere for genet af interesse ved 1,25 uM koncentration hver. Forbered en master mix med 2 pi dobbelt destilleret vand, 1 pi 1,25 pM primer mix og 5 pi 2x af farvestoffet at muliggøre påvisning af det dobbeltstrenget DNA. Indlæse 2 pi cDNA og 8 pi mastermix i 96-brønds PCR-plader.
    6. Udføre kvantitativ PCR ved hjælp af en real time PCR-system (40 cykler, 95-60 ° C) i henhold til producentens anvisninger og manuelt analysere data.
      BEMÆRK: Alle PCR primere er blevet valideret og tidligere 23 rapporteret.
    7. Beregn genekspression gange ændring hjælp regneark via ΔΔCt metoden, med ribosomal protein 36B4 mRNA tjener som intern kontrol 23.

3. GTCpFE Hæmmer Breast Cancer Stamceller in vitro

  1. Mammosphere Formation Assay
    1. Forbered mammosphere (MS) medium ved supplering Dulbeccos Modified Eagle Medium: Nutrient Mixture F-12 (DMEM / F12) phenolrødt-frit medium med 1% methylcellulose. Tillad at opløse ved forsigtig rystning natten over ved 4 ° C. Filtersteriliser mediet og supplerer med B27 1x, 1% penicillin og streptomycin, 5 ug / ml insulin, 1 pg / ml hydrocortison og 20 ng / ml rekombinant human epidermal vækstfaktor.
    2. Forbered enkeltceller af MDA-MB-231-cellelinie ved trypsinfordøjelse (trypsin 0,25% i 5 minutter ved 37 ° C) af monolagskulturer og filtreres gennem mesh sigter. Manuelt tælle enkelt dissocierede celler og plade i 96-brønds fastgørelsesplader ultralave ved en densitet på 400 celler / brønd. Den næste dag tilsættes forskellige koncentrationer af GTCpFE (f.eks endelige GTCpFE koncentrationer: 1, 10, 20, 50 uM) til et slutvolumen på 100 pi. Gennemføre hver behandling i tredobbeltbestemmelse.
    3. Efter 7 dages dyrkning i inkubatoren erhverve billeder via en imaging software ved hjælp af et omvendt mikroskop. Manuelt tælle antallet MS> 75 um i diameter. Sammenlign lægemiddelbehandling til vehikelkontrol.
      BEMÆRK: Diameteren af ​​MS> 75 um bestemmes ved brug af imaging software.
  2. CD44 + CD24 - CSC immunofænotype
    1. Trypsinisér MDA-MB-231-celler med 0,25% trypsin i 5 minutter ved 37 ° C. Tæl bruge et hæmocytometer og frø i 10 cm skåle på 3 millioner celler pr fad i 10 ml medium som beskrevet i afsnit 2.1. Tilføj køretøj (10 pi dimethylsulfoxid) eller GTCpFE (10 pi 50 mM stamopløsning) til celler i 72 timer.
    2. For køretøjer eller GTCpFE behandlingsgrupper, Trypsinisér celler (som i trin 3.2.1) og distribuere 1 million celler i 'Test & #39; eller 'Control' 5 ml polystyrenrør indeholdende 2 ml 1x Hanks Balanced Salt Solution (HBSS) puffer suppleret med 2% FBS.
    3. For at plette for overflademarkører CD44 og CD24, spin-celler ned og tilsættes 20 ul af hver konjugeret antistof og HBSS + 2% FBS til Test rør til en afsluttende 100 pi samlede volumen (1: 5 fortynding). Tilsæt 100 pi HBSS + 2% FBS til kontrolglassene. Medtag CD44-APC konjugeret antistof og CD24-PE-antistof enkelt plet kontrol eller IgG immunoisotype kontrol.
    4. Cellerne inkuberes i mørke ved 4 ° C i 30 minutter. Spin ned celler i 5 minutter ved 400 xg og rekonstituere i 200 pi HBSS buffer med 2% FBS. Hold celler på is i mørke.
    5. Udfør Fluorescens-aktiveret cellesortering (FACS) af levende celler under anvendelse af en FACS-analysator instrument ifølge producentens anvisninger. Saml mindst 50.000 hændelser for hvert rør. Kør behandlinger i tre eksemplarer.
      BEMÆRK: gating er baseret på kontrol fra ingen farvning (Control rør), IgG immunoisotypes, og CD44-APC og CD24-PE single pletter.
    6. Analyser af data ved hjælp af en tilgængelig flowcytometri software.
      BEMÆRK: Procenten af GTCpFE-behandlede celle med CD44 + CD24 - immunofænotype anslås og sammenlignet med vehikelkontrol.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

I figur 1 er den kemiske struktur af aspirin-fumarat prodrug, GTCpFE, og dets inhiberende virkning på cytokin-induceret NFĸB pathway i brystcancerceller er vist. GTCpFE inhiberer begge NFĸB endepunkter, NFĸB-RE luciferaseaktivitet (figur 1b) og ekspression af NFĸB målgener, såsom intercellulært adhæsionsmolekyle 1 (ICAM1), Chemokine CC Motif Ligand 2 (CCL2), og tumornekrosefaktor (TNF) (figur 1C) i MCF-7 brystcancerceller. Beregnet inhiberende koncentration på 50% (IC50) værdi på begge endepunkter er ~ 20 uM. IC50-værdien beregnes ved anvendelse af en plotning software. Til sammenligning ASA selv selv ved 200 uM (10x IC50 på GTCpFE) viser ingen inhibitorisk aktivitet (figur 1B, blå linje) i brystcancerceller. Dette indikerer, at prodrugstrategien af ​​tilsætning fumarat farmakoforen til ASA significantly forbedrer sin anti-NFĸB aktivitet.

Til måling af anti-CSC aktivitet, anvendte vi to assays: den mammosphere (MS) dannelse assay og populationen af celler, der udtrykker CD44 + CD24 - immunofænotype en bona fide CSC overflade markør i brystcancer 24. GTCpFE inhiberer MS dannelsen af MDA-MB-231 brystcancerceller i en dosisafhængig måde vist i figur 2A. Svarende til NFĸB pathway inhibering i adhærente kulturer, IC50-værdien for mammosphere dannelse er ~ 20 uM. Forventes Denne sammenhæng, eftersom CSCS afhængige NFĸB signalering for overlevelse og formering 16-21. Desuden GTCpFE forbehandling resulterede i en signifikant udtynding af CD44 + CD24 - population (Figur 2B) i MDA-MB-231-celler. Tilsammen udgør disse resultater etablerer GTCpFE evne til effektivt at målrette bryst CSCS.

figur 1
Figur 1: GTCpFE hæmmer NFĸB vejen i brystcancerceller. (A) Den kemiske struktur af aspirin-fumarat prodrug, GTCpFE. (B - C) MCF-7-celler blev forbehandlet i 2 timer med forskellige koncentrationer af GTCpFE, ASA eller køretøj efterfulgt af behandling med TNFa (10 ng / ml) i 2-4 timer. (B) NFKB-RE aktivitet blev målt ved dobbelt luciferase reporter assay. (C) Ekspression af NFKB målgener, ICAM1, CCL2 og TNF blev målt ved RT-QPCR. Drug inhiberende aktivitet afbildes som% af TNFa alene. Data er præsenteret som gennemsnit ± SEM. Dette tal har været ændret siden henvisning 15. Klik her for at se en større version af denne Figure.

Figur 2
Figur 2: GTCpFE hæmmer mammosphere dannelse og CD44 + CD24 - immunofænotype i brystcancerceller. (A) Mammosphere (MS) dannelse af MDA-MB-231-celler blev målt efter behandling med forskellige koncentrationer af GTCpFE. Kvantificering af MS vækst (venstre) og repræsentative billeder af MS på 20X (højre) er vist. Effekten af ​​GTCpFE plottes som kontrol% køretøj. (B) CD44 + CD24 - population blev bestemt ved FACS-analyse af MDA-MB-231-celler behandlet med 50 pM GTCpFE i 72 timer. Kvantificering af hver population procent (venstre) og repræsentative scatter plots fra FACS (højre) er vist. Data er præsenteret som middelværdi ± SEM og statistisk analyse af 2-vejs ANOVA follskylder Tukey posttest. *** P <0,001. Dette tal har været ændret siden henvisning 15.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
RPMI 1640 Red Medium Life Technologies  11875-093 Warm up to 37 °C before use
IMEM Corning 10-024-CV Warm up to 37 °C before use
DMEM / F12 Medium ThermoFisher 21041-025 Warm up to 37 °C before use
MEM NEAA 10 mM 100x Life Technologies  11140
Penicillin Streptomycin Life Technologies  15140-122
L-Glutamine 100x Life Technologies  25030-081
Insulin Sigma-Aldrich I-1882
Fetal Bovine Serum  Atlanta Biologicals S11150
Trypsin 2.5% 10x Invitrogen 15090046
Methyl Cellulose Sigma  M0262
B27 Supplement 50x Gibco 17504-044
EGF Gibco PHG0311L
NFκB-RE Luciferase Construct  Clontech  pGL4.32
Renilla Luciferase Construct  Promega pGL4.70
Lipofectamine 2000 ThermoFisher 11668-019
Dual-Luciferase Reporter Assay  Promega 120000032
NanoDrop Spectrophotometer ThermoFisher
Eppendorf Mastercycler  Eppendorf
StepOne Real Time PCR System Thermo Scientific
Eclipse Microscope Nikon
CyAn ADP Analyzer  Beckman Coulter
QCapture Software QImaging
Summit Software Beckman Coulter
GraphPad Software Prism
TRIzol ThermoFisher 15596-018
M-MLV Reverse Transcriptase Invitrogen 28025-013
100 mM dNTP Set Invitrogen 10297-018
Random Hexamers  Invitrogen 48190-011
Fast SYBR Green Master Mix ThermoFisher 4385612
Costar 96W, ultra low attachment  Corning 3474
HBSS, 1x ThermoFisher 14025134
CD44-APC conjugated antibody  BD Pharmingen 560990 Store at 4 °C, protect from light
CD24-PE antibody BD Pharmingen 560991 Store at 4 °C, protect from light
Recombinant Human TNFα Fisher 210TA100 
CCL2 Primer Forward Sequence AGAATCACCAGCAGCAAGTGTCC
CCL2 Primer Reverse Sequence TCCTGAACCCACTTCTGCTTGG
ICAM1 Primer Reverse Sequence TGACGAAGCCAGAGGTCTCAG
ICAM1 Primer Forward Sequence AGCGTCACCTTGGCTCTAGG
TNF Primer Forward Sequence AAGGGTGACCGACTCAGCG
TNF Primer Reverse Sequence ATCCCAAAGTAGACCTGCCCA
36B4 Primer Forward Sequence GTGTTCGACAATGGCAGCAT
36B4 Primer Reverse Sequence GACACCCTCCAGGAAGCGA
Sodium Hydroxide Sigma-Aldrich S5881-500G
4-Hydroxybenzyl Alcohol Sigma-Aldrich 20806-10G
O-Acetylsalicyloyl Chloride Sigma-Aldrich 165190-5G
Phosphorous Pentoxide Sigma-Aldrich 79610-100G
Ethyl Fumaroyl Chloride Sigma-Aldrich 669695-1G
Sodium Sulfate Sigma-Aldrich 246980-500G
4-Dimethylaminopyridine Sigma-Aldrich 714844-100ML 0.5 M in tetrahydrofuran
Triethylamine Sigma-Aldrich T0886-100ML
Toluene Sigma-Aldrich 244511-100ML
Ethyl Acetate Sigma-Aldrich 270989-100ML
Tetrahydrofuran Sigma-Aldrich 401757-2L
400 MHz FT NMR spectrometer  See Bruker’s Avance User’s Manual, version 000822 for details

DOWNLOAD MATERIALS LIST

References

  1. Hanahan, D., Weinberg, R. A. Hallmarks of cancer: the next generation. Cell. 144, 646-674 (2011).
  2. Cuzick, J., et al. Aspirin and non-steroidal anti-inflammatory drugs for cancer prevention: an international consensus statement. Lancet Oncol. 10, 501-507 (2009).
  3. Terry, M. B., et al. Association of frequency and duration of aspirin use and hormone receptor status with breast cancer risk. JAMA. 291, 2433-2440 (2004).
  4. Wang, D., Dubois, R. N. Cyclooxygenase-2: a potential target in breast cancer. Semin Oncol. 31, 64-73 (2004).
  5. Howe, L. R. Inflammation and breast cancer. Cyclooxygenase/prostaglandin signaling and breast cancer. Breast Cancer Res. 9. 9, 210 (2007).
  6. Kopp, E., Ghosh, S. Inhibition of NF-kappa B by sodium salicylate and aspirin. Science. 265, 956-959 (1994).
  7. Yin, M. J., Yamamoto, Y., Gaynor, R. B. The anti-inflammatory agents aspirin and salicylate inhibit the activity of I(kappa)B kinase-beta. Nature. 396, 77-80 (1998).
  8. Pierce, J. W., Read, M. A., Ding, H., Luscinskas, F. W., Collins, T. Salicylates inhibit I kappa B-alpha phosphorylation, endothelial-leukocyte adhesion molecule expression, and neutrophil transmigration. J Immunol. 156, 3961-3969 (1996).
  9. Frasor, J., El-Shennawy, L., Stender, J. D., Kastrati, I. NFkappaB affects estrogen receptor expression and activity in breast cancer through multiple mechanisms. Mol Cell Endocrinol. 418, 235-239 (2014).
  10. Perkins, N. D. The diverse and complex roles of NF-kappaB subunits in cancer. Nat Rev Cancer. 12, 121-132 (2012).
  11. DiDonato, J. A., Mercurio, F., Karin, M. NF-kappaB and the link between inflammation and cancer. Immunol Rev. 246, 379-400 (2012).
  12. Scarpignato, C., Hunt, R. H. Nonsteroidal antiinflammatory drug-related injury to the gastrointestinal tract: clinical picture, pathogenesis, and prevention. Gastroenterol Clin North Am. 39, 433-464 (2010).
  13. Sostres, C., Gargallo, C. J. Gastrointestinal lesions and complications of low-dose aspirin in the gastrointestinal tract. Best Pract Res Clin Gastroenterol. 26, 141-151 (2012).
  14. Kastrati, I., et al. Dimethyl Fumarate Inhibits the Nuclear Factor kappaB Pathway in Breast Cancer Cells by Covalent Modification of p65 Protein. J Biol Chem. 291, 3639-3647 (2016).
  15. Kastrati, I., et al. A novel aspirin prodrug inhibits NFkappaB activity and breast cancer stem cell properties. BMC Cancer. 15, 845 (2015).
  16. Cao, Y., Luo, J. L., Karin, M. IkappaB kinase alpha kinase activity is required for self-renewal of ErbB2/Her2-transformed mammary tumor-initiating cells. Proc Natl Acad Sci U S A. 104, 15852-15857 (2007).
  17. Liu, M., et al. The canonical NF-kappaB pathway governs mammary tumorigenesis in transgenic mice and tumor stem cell expansion. Cancer Res. 70, 10464-10473 (2010).
  18. Korkaya, H., Liu, S., Wicha, M. S. Regulation of cancer stem cells by cytokine networks: attacking cancer's inflammatory roots. Clin Cancer Res. 17, 6125-6129 (2011).
  19. Hinohara, K., et al. ErbB receptor tyrosine kinase/NF-kappaB signaling controls mammosphere formation in human breast cancer. Proc Natl Acad Sci U S A. 109, 6584-6589 (2012).
  20. Kendellen, M. F., Bradford, J. W., Lawrence, C. L., Clark, K. S., Baldwin, A. S. Canonical and non-canonical NF-kappaB signaling promotes breast cancer tumor-initiating cells. Oncogene. 33, 1297-1305 (2014).
  21. Yamamoto, M., et al. NF-kappaB non-cell-autonomously regulates cancer stem cell populations in the basal-like breast cancer subtype. Nat Commun. 4, 2299 (2013).
  22. Rio, D. C., Ares, M., Hannon, G. J., Nilsen, T. W. Purification of RNA using TRIzol (TRI reagent). Cold Spring Harb Protoc. (2010).
  23. Frasor, J., et al. Positive cross-talk between estrogen receptor and NF-kappaB in breast cancer. Cancer Res. 69, 8918-8925 (2009).
  24. Al-Hajj, M., Wicha, M. S., Benito-Hernandez, A., Morrison, S. J., Clarke, M. F. Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci U S A. 100, 3983-3988 (2003).
  25. Vandermeeren, M., et al. Dimethylfumarate is an inhibitor of cytokine-induced nuclear translocation of NF-kappa B1, but not RelA in normal human dermal fibroblast cells. J Invest Dermatol. 116, 124-130 (2001).
  26. Loewe, R., et al. Dimethylfumarate inhibits TNF-induced nuclear entry of NF-kappa B/p65 in human endothelial cells. J Immunol. 168, 4781-4787 (2002).
  27. Seidel, P., et al. Dimethylfumarate inhibits NF-{kappa}B function at multiple levels to limit airway smooth muscle cell cytokine secretion. Am J Physiol Lung Cell Mol Physiol. 297, L326-L339 (2009).
  28. Wilms, H., et al. Dimethylfumarate inhibits microglial and astrocytic inflammation by suppressing the synthesis of nitric oxide, IL-1beta, TNF-alpha and IL-6 in an in-vitro model of brain inflammation. J Neuroinflammation. 7, 30 (2010).
  29. Peng, H., et al. Dimethyl fumarate inhibits dendritic cell maturation via nuclear factor kappaB (NF-kappaB) and extracellular signal-regulated kinase 1 and 2 (ERK1/2) and mitogen stress-activated kinase 1 (MSK1) signaling. J Biol Chem. 287, 28017-28026 (2012).
  30. Li, H. J., Reinhardt, F., Herschman, H. R., Weinberg, R. A. Cancer-stimulated mesenchymal stem cells create a carcinoma stem cell niche via prostaglandin E2 signaling. Cancer Discov. 2, 840-855 (2012).
  31. Li, X., et al. Intrinsic resistance of tumorigenic breast cancer cells to chemotherapy. J Natl Cancer Inst. 100, 672-679 (2008).
  32. Diehn, M., et al. Association of reactive oxygen species levels and radioresistance in cancer stem cells. Nature. 458, 780-783 (2009).
  33. Hollier, B. G., Evans, K., Mani, S. A. The epithelial-to-mesenchymal transition and cancer stem cells: a coalition against cancer therapies. J Mammary Gland Biol Neoplasia. 14, 29-43 (2009).
  34. Velasco-Velazquez, M. A., Popov, V. M., Lisanti, M. P., Pestell, R. G. The role of breast cancer stem cells in metastasis and therapeutic implications. Am J Pathol. 179, 2-11 (2011).
  35. Dontu, G., et al. In vitro propagation and transcriptional profiling of human mammary stem/progenitor cells. Genes Dev. 17, 1253-1270 (2003).
  36. Charafe-Jauffret, E., et al. Cancer stem cells in breast: current opinion and future challenges. Pathobiology. 75, 75-84 (2008).
  37. Clayton, H., Titley, I., Vivanco, M. Growth and differentiation of progenitor/stem cells derived from the human mammary gland. Exp Cell Res. 297, 444-460 (2004).
  38. Ginestier, C., et al. ALDH1 is a marker of normal and malignant human mammary stem cells and a predictor of poor clinical outcome. Cell Stem Cell. 1, 555-567 (2007).
  39. Rosen, J. M., Jordan, C. T. The increasing complexity of the cancer stem cell paradigm. Science. 324, 1670-1673 (2009).
  40. Visvader, J. E., Lindeman, G. J. Cancer stem cells in solid tumours: accumulating evidence and unresolved questions. Nat Rev Cancer. 8, 755-768 (2008).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics