Syntese og karakterisering av en Aspirin-fumarat Prodrog at Hemmer NFkB Aktivitet og brystkreft stamceller

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Kastrati, I., Delgado-Rivera, L., Georgieva, G., Thatcher, G. R., Frasor, J. Synthesis and Characterization of an Aspirin-fumarate Prodrug that Inhibits NFκB Activity and Breast Cancer Stem Cells. J. Vis. Exp. (119), e54798, doi:10.3791/54798 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Betennelse er en kreft kjennetegn som ligger til grunn for kreftforekomst og markedsføring, og til slutt progresjon til metastasering. Derfor legger en anti-inflammatorisk narkotika til standard kreft regimenter kan forbedre pasientens utfall. Et slikt medikament, aspirin (acetylsalisylsyre, ASA), er blitt undersøkt for kreft chemoprevention og anti-tumor-aktivitet. Foruten å hemme cyklooksygenase 2-prostaglandin aksen, har ASAs anti-kreft aktiviteter også blitt tilskrevet nukleær faktor ĸB (NFĸB) hemming. Fordi langvarig ASA bruk kan forårsake gastrointestinal toksisitet, har en prodrug strategi er gjennomført med suksess. I dette prodrug utforme karboksylsyren av ASA er maskert og ytterligere pharmacophores er innarbeidet.

Denne protokollen beskriver hvordan vi syntetisert en aspirin-fumarat prodrug, GTCpFE, og preget dens hemming av NFĸB sti i brystkreftceller og demping av kreft stammen lignende riktigbånd, en viktig NFĸB avhengig fenotype. GTCpFE hemmer effektivt NFĸB sti i brystkreftcellelinjer mens ASA mangler noen hemmende aktivitet, noe som indikerer at å legge fumarate til ASA struktur bidrar vesentlig til sin aktivitet. I tillegg viser GTCpFE signifikant anti-cancer stamcelle-aktivitet ved å blokkere mammosphere dannelse og demping kreftstamcelle forbundet CD44 + CD24 - immunfenotype. Disse resultatene etablere en levedyktig strategi for å utvikle bedre anti-inflammatoriske medisiner for chemoprevention og kreftbehandling.

Introduction

Betennelse er et kjennetegn som ligger til grunn flere aspekter av tumordannelse, slik som forekomst og markedsføring, og til slutt progresjon til metastase en. Brystkreft, er dette videre støttet av epidemiologiske observasjoner som viser at regelmessig anvendelse av den klassiske ikke-steroide anti-inflammatorisk legemiddel aspirin (acetylsalisylsyre, ASA) er assosiert med en reduksjon i både bryst- kreftforekomst, og risikoen for metastaser og tilbakefall 2,3. ASA virker hovedsakelig ved å inhibere syklooksygenase-2-aktivitet, som ofte er oppregulert i brystkreft 4,5. Imidlertid kan den anti-kreft effekt av ASA også være mediert ved å undertrykke avvik nukleær faktor KB (NFKB) signal 6-8. Dette er viktig fordi en deregulert NFkB sti fremmer tumorcelleoverlevelse, proliferasjon, migrering, invasjon, angiogenese, og resistens overfor terapi 9-11. NFKB aktivering bane er også kritisk for monteringen immunrespons. Derfor, for anti-kreft terapi hvor langvarig NFkB hemming er nødvendig, må man vurdere de skadelige bivirkninger som innebærer langvarig immunsuppresjon. Derfor kan ASA tjene som et godt utgangspunkt for terapeutisk optimalisering.

En begrensning for ASA anvendelse i cancerterapi er de forhøyede doser som er nødvendige for cyklooksygenase 2 og NFkB inhibering, som er forbundet med gastrointestinal toksisitet, så som sår og mage blødning 12,13. Men konvertere ASA inn som prodrug kan redusere ASAs gastrointestinal toksisitet. For ytterligere å forbedre styrken og / eller legge til funksjonalitet, kan ytterligere strukturelle elementer eller tilknyttede pharmacophores også inkorporeres i esterprodrug utforming. En slik pharmacophore tilsatt for å forbedre ASA potens mot NFkB reaksjonsveien er fumarat, som vi tidligere har vist seg å være viktig for NFkB svei inhibering 14,15.

15, GTCpFE, og en hypotese om at slike hybrid-molekyl ville være trygt ennå potent mot NFkB veien. Vi testet sin anti-NFkB-aktivitet i brystkreftceller og dens evne til å blokkere brystkreft stamceller (cscs) 15, som er avhengige av NFkB-signalering for overlevelse og vekst 16-21. Vi finner at styrken av GTCpFE mot NFkB veien er betydelig forbedret i løpet ASA 15. I tillegg GTCpFE blokker mammosphere formasjon og demper CSC overflate markør CD44 + CD24 - immunfenotypen, noe som indikerer at GTCpFE er i stand til å utrydde cscs 15. Disse resultatene etablere aspirin-fumarat prodrug som en effektiv anti-inflammatorisk agent som også kan målrette bryst cscs. Når det gjelder brystkreft behandling kan GTCpFE har potensial til å behandle aggressiv og dødelig sykdom.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Syntese av Aspirin-fumarat Prodrog GTCpFE

  1. Ved hjelp av en plastsprøyte plunger, måle 0,81 ml (20 mmol) metanol og blande den i vann (10 ml) i en rundbunnet kolbe. Avkjøl den resulterende blanding til 0 ° C ved å plassere kolben i et is-vann-bad. Tilsett 4-hydroksybenzylalkohol (2,48 mg, 20 mmol) og omrør reaksjonsblandingen inntil løsningen er klar.
  2. Fremstille en oppløsning av O -acetylsalicyloyl klorid (3,77 mg, 19 mmol) i vannfri toluen (10 ml) ved å veie den ønskede mengde av O -acetylsalicyloyl klorid og oppløsning i oppløsningsmidlet i en separat kolbe. Ved hjelp av en plastsprøyte plunger, legge til denne oppløsning til blandingen fremstilt i trinn 1.1, og lar reaksjonsblandingen under omrøring ved 0 ° C.
  3. Overvåk reaksjonen ved hjelp av tynnsjiktskromatografi (TLC). TLC-platene skal ha silisiumdioksyd som en stasjonær fase.
    1. Fremstille en mobil fase som består av 20:80 etylacetat (AcOEt) / heksan. I en TLC kammer(Eller liten beholder) tilsett 5 ml mobil fase for å dekke bunnen av kammeret.
      MERK: Mengden av mobil fase avhenger av den valgte kammeret. legg alltid nok til å dekke bunnen, men når den er plassert inne TLC, bør oppløsningsmidlet linje ikke overgå høyden hvor forbindelsene er oppdaget.
    2. Ta en prøve av reaksjonen med en sprøyte (0,2 ml), legg den i en liten flaske, og spe den med etylacetat (2-3 dråper). Med TLC spotter, forsiktig ta en prøve av den fortynnede reaksjonsblandingen og øye på den i TLC.
      MERK: Flekkene bør være 1-2 mm, og dette bør gjøres på den nedre 1/4 tomme av TLC plate.
    3. På samme TLC, plassere en flekk av en oppløsning av O-acetylsalicyloyl-klorid (0,2 mg i 0,5 ml etylacetat) som en sammenligning. Når flekkene er tørr, legg den i kammeret og la den kjøre til væskefronten har nesten nådd toppen av TLC.
    4. Ta TLC ut, la det tørke og visualisere den under en UV-lampe. den Reacsjon er fullført når O -acetylsalicyloyl kloridet flekk forsvinner fra reaksjonsblandingen.
    5. Når reaksjonen er fullført, fjernes den is-vannbad, og lar reaksjonsblandingen omrørt ved romtemperatur i 20 timer.
  4. Filtrer bunnfallet ved hjelp av en Buchner-trakt med en frittet skive av middels porøsitet. Plasser det faste stoff i en scintillasjonsflaske, og la forbindelsen i vakuum over natten i en eksikator ved romtemperatur. Bruk fosforpentoksyd (P 2 O 5) som tørkemiddel.
  5. Tørk en rundbunnet kolbe ved å plassere den i en ovn ved 80 ° C i minst to dager før denne reaksjon. Alternativt kan forsegle kolbe med et septum og gjennemborer den med en nål som er koblet til et vakuumpumpesystem. Slå vakuumpumpen på og tørk kolben ved hjelp av en varmepistol. Avkjøl, og gjenta dette trinnet 2 flere ganger.
  6. Blåse en ballong ved hjelp av argon gass, og koble den til en plastsprøyte (hvis stempelet hsom er fjernet) med en nål. Slå av vakuumpumpen og fjerne nålen knyttet til det som ble satt inn i den nå tørket rundbundet kolbe. Sett nålen tilkoblet til argon ballongen gjennom septum forsegler rundbunnet kolbe.
    1. Tilsett 4-hydroksymetylfenol ester av 2-acetyloxybenzoic syre (100 mg, 0,349 mmol), 4-dimetylaminopyridin (4 mg, 0,033 mmol) og trietylamin (53 mg, 0,523 mmol) til en separat kolbe, deretter oppløst dem i vannfritt tetrahydrofuran (5 ml). Med en plastsprøyte festet til en nål, legge til denne løsning til den forseglede rundbunnet kolbe. Avkjøl blandingen til 0 ° C ved å plassere kolben i et is-vannbad.
  7. Til den foregående blanding, tilsett en løsning av etyl-fumaroyl klorid (68 mg, 0,419 mmol) i vannfritt tetrahydrofuran (5 ml), dråpevis over en periode på 10 min. Omrør den resulterende løsning ved 0-5 ° C i 2-4 timer.
  8. Ekstraher reaksjonsblandingen med etylacetat (100 ml) og saltløsning (50 ml). <br /> NB: Saltlake er en mettet løsning av natriumklorid (NaCl). For å forberede den, plassere 200 ml vann i en ren glassbeholder deretter begynne å legge NaCl (mens røring) inntil det ikke løses lenger.
    1. Etter ekstraksjon fjerner den vandige fase og gjenta sistnevnte trinn to ganger til.
    2. Tørk blandingen ved tilsetning av natriumsulfat til den organiske fase, inntil det faste stoff ikke klumper seg sammen når det glass omrøres. Ved hjelp av en annen Buchner-trakt med et frittet disk, filtrere blandingen til en rundbunnet kolbe for å fjerne natriumsulfat og fordamp deretter til tørrhet under anvendelse av en rotasjonsfordamper med temperaturen innstilt på 40 ° C.
  9. Ved hjelp av en TLC, bestemme en passende mobil fase som skal brukes i kolonnekromatografi.
    MERK: For dette eksperimentet ble brukt en gradient av 20:80 AcOEt / heksan.
  10. Fremstille en kolonne med silikagel, og det passende løsningsmiddelfasen. Når forbindelsen har blitt lagt til, legge et lag med natriumsulfat (eller sand) til protect kolonnen som løsningsmiddel tilsettes.
    1. Som kolonnen kjører, overvåke eluatet av TLC. Spot annenhver reagensrør som de er samlet fra kolonnen. Når produktet av interesse eluerer, blande alle prøver inneholdende rent produkt i en stor rundbunnet kolbe, og tørke dem ved hjelp av en rotasjonsfordamper med badtemperaturen innstilt på 40 ° C.
      Bemerk: Produkt skal vises som et hvitt, fast stoff.
  11. For å bekrefte strukturen av GTCpFE, samle proton og karbon (1H og 13C, henholdsvis) kjernemagnetisk resonans (NMR) spektra i henhold til produsentens instruksjoner.
    MERK: I denne studien et 400 MHz FT-NMR-spektrometer ble benyttet for å samle opp 1H og 13C spektra. Kjør minst 25 skanner ved romtemperatur for å få nok data oppløsning. NMR-topper ble observert, var de følgende, 1H NMR (CDCI3): δ 1,29 (t, 3H, 3J = 7,0 Hz, CH3); 2,31 (s, 3 H, CH3); 4,26 (q, 2 H, 3J = 7,0 Hz, Cooch 2); 5,25 (s, 2H, OCH2); 6,89 (s, 2 H, HC = CH); 7,19 (m, 3 H, Ar); 7,42 (m, 3 H, Ar); 7,65 (m, 1 H, Ar); 8,22 (dd, 1H, 3J = 7,8, 4J = 1,2 Hz, Ar). 13C NMR (CDCI3) S: 169,70, 164,86, 164,75, 162,89, 151,28, 150,69, 134,76, 134,32, 133,26, 133,16, 132,25, 129,81, 126,26, 124,11, 122,47, 122,04, 66,40, 61,43, 21,05, 14,15.
  12. I tillegg samler et høyoppløselig massespektrum ved hjelp av væskekromatografi massespektrometri i kombinasjon med ion trap og time-of flight teknologi (LCMS-IT-TOF) for nøyaktig masse målinger i henhold til produsentens anvisninger.
    MERK: I denne studien (M + NH 4 +) beregnet: 430,1496; observert: 430,1477.

2. GTCPFE Hemmer NFĸB Aktiviteten i brystkreftceller

  1. Cell Culture betingelser
    1. Oppretthold menneskebrystkreftcellelinjer, MCF-7 og MDA-MB-231 som per standard celle Culratur teknikker og forplanter seg i en fuktet inkubator ved 37 ° C med 5% CO2.
      1. Fremstille MCF-7 cellemedium fra Roswell Park Memorial Institute (RPMI) 1640-medium med fenol rød supplert med 10% føtalt bovint serum (FBS), 1% ikke-essensielle aminosyrer, 2 mM L-glutamin, 1% antibiotika penicillin-streptomycin og 6 ng / ml insulin. Forbered MDA-MB-231 cellemedium fra Forbedret Minimum Essential Medium (IMEM) supplert med 5% FBS, 1% ikke-essensielle aminosyrer, 2 mM L-glutamin, og 1% antibiotika penicillin-streptomycin.
  2. NFkB-RE luciferaserapportørplasmid Assay
    1. Trypsineres brystkreft MCF-7-celler ved bruk av 0,25% trypsin i 5 minutter ved 37 ° C, manuelt telle ved hjelp av et hemocytometer og frø i 24-brønners plater med 90.000 celler per brønn tetthet.
    2. Følgende dag, co-transfektere celler med plasmid DNA fra en NFkB respons element (NFkB-RE) luciferase konstruere, 1 ug / brønn, along med promoterless Renilla luciferase konstruere, 0,2 mikrogram / brønn. Utføre transfeksjoner for hver behandlingsgruppe i tre eksemplarer.
      1. Vask cellene to ganger med PBS og inkuberes med blandinger av plasmid-DNA og 1 ul per brønn av transfeksjon reagens (f.eks lipofektamin) i serumfritt medium. Etter 6 timer, endres mediet til 1 ml av vanlig medium (uten antibiotika penicillin og streptomycin).
    3. Etter 16 timer, tilsett 1 pl bærer eller forskjellige stamløsninger av GTCpFE eller ASA medikamenter til hver brønn. Oppløs medikamentstamløsninger (100, 50, 20, 10 og 1 mM) i dimetylsulfoksyd ved 1,000x konsentrasjon. Etter tilsetning av medikamenter, inkuberes cellene i 2 timer ved 37 ° C.
    4. For å aktivere NFkB vei, tilsett pro-inflammatorisk cytokin TNFa (10 ug / ml stamløsning) i hver brønn til en sluttkonsentrasjon på 10 ng / ml og inkuberes i 4 timer. Inkluder en TNFa alene kontroll. Aspirer medium og lagre cellens ved -80 ° C.
    5. Mål luciferase bruker en luciferase reporter analysen system i henhold til produsentens instruksjoner.
      MERK: Ved bruk av luciferase-analysesystemet (f.eks Dual Luciferase assay system) for første gang fremstille en oppløsning av luciferase assay reagens ved å re-suspendering i 10 ml buffer og lagring av det ved -80 ° C i 1 ml alikvoter.
      1. Forbered 1x lysis buffer ved å fortynne 5x lager buffer med vann. Lyse cellene i hver brønn med 100 mL 1x lysis buffer. Inkuber platene på en orbital-rystemaskin i 15 min, ved middels hastighet.
      2. Merk en 1,5 ml tube per prøve. Tine luciferase assayreagens til værelsestemperatur (50 ul per prøve vil være nødvendig) og holde i folie. Forbered 1x slukke reagens i hetteglass, 01:49 fortynning i buffer og virvle det (50 mL per prøve vil være nødvendig).
      3. Tilsett 10 ul cellelysat til en merket mikrosentrifugerør. Deretter legger 50 ul av luciferase assay reagens ogforsiktig vortex. Umiddelbart etter, å plassere røret i en holder, og måle luminescens via den doble luciferase-programmet i luminometeret. Velg og trykk på følgende: Kjør Promega protokoller → Dual Glo → OK.
      4. Tilsett 50 pl av bråkjøling reagensen i testrøret og forsiktig vortex. Mål luminescens. Gjenta disse trinnene for hver prøve.
      5. Analyser data ved hjelp av regneark ved å normal NFkB-RE til Renilla internkontroll (NFkB-RE / Renilla). Sammenlign inhibitor data til TNFa bare kontroll (TNFa bare er satt til 100%).
  3. NFkB-Target gentranskripsjon
    1. Seed MCF-7 celler i seks-brønns plater på 250.000 celler per brønn i 2 ml medium volum fremstilt som beskrevet i kapittel 2.1.
    2. Dagen etter, tilsett 2 mL av forskjellige GTCpFE 1,000x aksjer (100, 50, 20, 10 og 1 mm) i 2 timer før du legger TNFa 10 ng / ml for en annen 2 timer. Kjør hver behandlingi tre eksemplarer. Ta med bilen og TNFa alene kontroller.
    3. Isoler RNA bruker guanidiumtiocyanat-fenol-kloroform utvinning metoden i henhold til produsentens instruksjoner 22. Bestem RNA-konsentrasjonen (i dietylpyrokarbonat (DEPC) -behandlet vann) og RNA renhet ved hjelp av et spektrofotometer. Hold RNA prøver på is eller oppbevar ved -80 ° C. Bruk kun RNase-fritt barriere tips ved håndtering av RNA.
    4. Omvendt transkribere 0,5 mikrogram total RNA ved hjelp av et kommersielt tilgjengelig kit av Moloney murine leukemia virus (M-MLV) revers transkriptase.
      MERK: Settet inneholder 5x buffer og ditiotreitol (DTT), sammen med dNTP blanding, og tilfeldig heksamer blanding.
      1. Tilsett 0,5 ug av RNA til 200 enheter av M-MLV, 0,5 mM dNTPs, 100 ng av tilfeldige heksamerer, 10 mM DTT, 1 x buffer og DEPC vann til en endelig 10 ul reaksjonsvolum. Utføre revers transkriptase reaksjon ved anvendelse av en PCR cycler i 50 minutter ved 37 ° C, og deretter 15 minutter ved 70 &# 176, C til varme-inaktivere enzymet.
    5. Fortynne den resulterende cDNA produkt til 100 pl med dobbeltdestillert vann med 2 ul for hver påfølgende kvantitativ polymerasekjedereaksjon (PCR) reaksjon.
      1. Bland forover og revers primere for genet av interesse ved 1,25 uM konsentrasjon hver. Fremstille et konsentrat-blandingen med 2 ul dobbeltdestillert vann, 1 ul av 1,25 uM primer blanding, og 5 ul av 2x av fargestoffet for å muliggjøre deteksjon av dobbeltkjedet DNA. Laste 2 pl av cDNA og 8 ul masterblanding til 96-brønners PCR-plater.
    6. Gjennomføre kvantitativ PCR ved hjelp av en real time PCR system (40 sykluser, 95-60 ° C) i henhold til produsentens instruksjoner og manuelt analysere dataene.
      MERK: Alle PCR primere som brukes er validert og rapportert tidligere 23.
    7. Beregn genuttrykk ganger endring ved hjelp av regneark via ΔΔCt metoden med ribosomalt protein 36B4 mRNA fungerer som internkontroll 23.

3. GTCpFE Hemmer Breast Cancer Stem Cells in vitro

  1. Mammosphere Dannelse analyse
    1. Forbered mammosphere (MS) medium ved å supplere Dulbeccos modifiserte Eagle-medium: Nutrient Blanding F-12 (DMEM / F12) fenolrød-fritt medium med 1% metylcellulose. Tillat å oppløse ved forsiktig risting over natten ved 4 ° C. Filter sterilisere mediet og supplere med B27 1x, 1% penicillin og streptomycin, 5 ug / ml insulin, 1 ug / ml hydrokortison, og 20 ng / ml rekombinant, human epidermal vekstfaktor.
    2. Fremstille enkeltceller MDA-MB-231-cellelinjen med trypsin fordøyelse (trypsin 0,25% i 5 minutter ved 37 ° C) i monolagskulturer og filtrer gjennom nettingsikter. telle manuelt enkelt dissosierte celler og plate i 96-brønners ultralave festeplater ved en tetthet på 400 celler / brønn. Neste dag, legge til ulike konsentrasjoner av GTCpFE (for eksempel slutt GTCpFE konsentrasjoner: 1, 10, 20, 50 uM) til et endelig volum er 100 ul. Gjennomføre hver behandling i tre eksemplarer.
    3. Etter 7 dager med kultur i inkubatoren, hente bilder via et bildebehandlingsprogrammer ved hjelp av en invertert mikroskop. telle antall MS> 75 pm i diameter manuelt. Sammenlign medikamentell behandling for å kjøretøykontroll.
      MERK: Diameteren på MS> 75 mikrometer bestemmes ved hjelp av bildebehandlingsprogrammer.
  2. CD44 + CD24 - CSC Immunfenotype
    1. Trypsineres MDA-MB-231-celler med 0,25% trypsin i 5 minutter ved 37 ° C. Telle ved hjelp av en hemocytometer og frø i 10 cm retter på 3 millioner celler per fatet i 10 ml medium som beskrevet i kapittel 2.1. Legg til en bærer (10 ul dimetylsulfoksid) eller GTCpFE (10 pl av 50 mM stam) til cellene i 72 timer.
    2. For kjøretøy eller GTCpFE behandlingsgruppene, trypsineres celler (som i trinn 3.2.1) og distribuere 1 million celler i 'Test & #39; eller "kontroll" 5 ml polystyren rør som inneholder 2 ml 1x Hank balanserte saltoppløsning (HBSS) buffer supplert med 2% FBS.
    3. Å farge for overflatemarkører CD44 og CD24, spin celler ned og legge til 20 mL av hver antistoff og HBSS + 2% FBS å teste rør for en endelig 100 pl samlet volum (1: 5 fortynning). Tilsett 100 HBSS + 2% FBS å kontrollere rør. Inkluder CD44-APC konjugert antistoff og CD24-PE antistoff enkle beis kontroller eller IgG immunoisotype kontroller.
    4. Inkuber cellene i mørke ved 4 ° C i 30 minutter. Spinn ned celler i 5 min ved 400 xg og rekonstituere i 200 mL HBSS buffer med 2% FBS. Hold celler på isen i mørket.
    5. Utfør fluorescens-aktivert celle sortering (FACS) av levende celler ved hjelp av en FACS analysator instrument i henhold til produsentens instruksjoner. Samle minst 50.000 hendelser for hvert rør. Kjøre behandlinger i triplikat.
      MERK: gating er basert på kontroller fra ingen farging (Control tube), IgG immunoisotypes, og CD44-APC og CD24-PE enkle flekker.
    6. Analyser data ved hjelp av en tilgjengelig flowcytometri programvare.
      MERK: prosent av GTCpFE behandlet celle med CD44 + CD24 - immunfenotypen er estimert og i forhold til kjøretøykontroll.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

I figur 1 er den kjemiske struktur av aspirin-fumarat prodrug, GTCpFE, og dens hemmende aktivitet på cytokin indusert NFĸB banen i brystkreftceller, er angitt. GTCpFE hemmer både NFĸB endepunkter, NFĸB-RE luciferase aktivitet (figur 1B) og uttrykk av NFĸB målgener, for eksempel inter adhesjonsmolekyl 1 (ICAM1), chemokine CC Motif Ligand 2 (CCL2), og tumornekrosefaktor (TNF) (Figur 1C) i MCF-7 brystkreftceller. Beregnet inhibitorisk konsentrasjon på 50% (IC50) -verdien på begge endepunktene er ~ 20 uM. IC 50 verdi er beregnet ved hjelp av en grafisk programvare. Til sammenligning ASA seg selv på 200 um (10 x IC 50 av GTCpFE) viser ingen hemmende aktivitet (figur 1B, blå linje) på brystkreftceller. Dette indikerer at prodrug strategi med å legge fumarate pharmacophore til ASA significaforbedrer ntly sin anti-NFĸB aktivitet.

For å måle anti-CSC aktivitet, brukte vi to analyser: den mammosphere (MS) dannelse analyse og populasjon av celler som uttrykker CD44 + CD24 - immunfenotypen, en bona fide CSC overflatemarkør i brystkreft 24. GTCpFE hemmer MS dannelse av MDA-MB-231 brystkreft celler på en doseavhengig måte som vist i figur 2A. I likhet med NFĸB sti-inhibering i adherente kulturer, IC50 verdien for mammosphere formasjon er ~ 20 uM. Dette konsistens forventes, gitt at cscs stole på NFĸB system for overlevelse og formering 16-21. I tillegg GTCpFE forbehandlingen resulterte i en betydelig nedbryting av CD44 + CD24 - populasjonen (figur 2B) i MDA-MB-231-celler. Sammen utgjør disse resultatene etablere GTCpFE evne til effektivt å målrette bryst cscs.

Figur 1
Figur 1: GTCpFE hemmer NFĸB reaksjonsveien i brystkreftceller. (A) Den kjemiske struktur av aspirin-fumarat prodrug, GTCpFE. (B - C) MCF-7-celler ble forbehandlet i 2 timer med forskjellige konsentrasjoner av GTCpFE, ASA, eller bærer etterfulgt av behandling med TNFa (10 ng / ml) i 2-4 timer. (B) NFkB-RE-aktivitet ble målt ved dobbel luciferase reporter-analyse. (C) Uttrykk for NFkB målgener, ICAM1, CCL2 og TNF ble målt med RT-QPCR. Drug inhibitorisk aktivitet er plottet som% av TNFa alene. Data er presentert som gjennomsnitt ± SEM. Dette tallet har blitt modifisert fra referanse 15. Klikk her for å se en større versjon av denne Figure.

Figur 2
Figur 2: GTCpFE hemmer mammosphere formasjon og CD44 + CD24 - immunfenotypen i brystkreftceller. (A) Mammosphere (MS) dannelse av MDA-MB-231-celler ble målt etter behandling med varierende konsentrasjoner av GTCpFE. Kvantifisering av MS vekst (til venstre) og representative bilder av MS på 20X (til høyre) er vist. Effekten av GTCpFE er plottet som% bærerkontroll. (B) Den CD44 + CD24 - populasjonen ble bestemt ved FACS-analyse av MDA-MB-231-celler behandlet med 50 uM GTCpFE i 72 timer. Kvantifisering av hver populasjon prosent (til venstre) og representative spredningsplott fra FACS (til høyre) er vist. Data er presentert som gjennomsnitt ± SEM og statistisk analyse av 2-veis ANOVA follskylder Tukey posttest. *** P <0,001. Dette tallet har blitt modifisert fra referanse 15.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
RPMI 1640 Red Medium Life Technologies  11875-093 Warm up to 37 °C before use
IMEM Corning 10-024-CV Warm up to 37 °C before use
DMEM / F12 Medium ThermoFisher 21041-025 Warm up to 37 °C before use
MEM NEAA 10 mM 100x Life Technologies  11140
Penicillin Streptomycin Life Technologies  15140-122
L-Glutamine 100x Life Technologies  25030-081
Insulin Sigma-Aldrich I-1882
Fetal Bovine Serum  Atlanta Biologicals S11150
Trypsin 2.5% 10x Invitrogen 15090046
Methyl Cellulose Sigma  M0262
B27 Supplement 50x Gibco 17504-044
EGF Gibco PHG0311L
NFκB-RE Luciferase Construct  Clontech  pGL4.32
Renilla Luciferase Construct  Promega pGL4.70
Lipofectamine 2000 ThermoFisher 11668-019
Dual-Luciferase Reporter Assay  Promega 120000032
NanoDrop Spectrophotometer ThermoFisher
Eppendorf Mastercycler  Eppendorf
StepOne Real Time PCR System Thermo Scientific
Eclipse Microscope Nikon
CyAn ADP Analyzer  Beckman Coulter
QCapture Software QImaging
Summit Software Beckman Coulter
GraphPad Software Prism
TRIzol ThermoFisher 15596-018
M-MLV Reverse Transcriptase Invitrogen 28025-013
100 mM dNTP Set Invitrogen 10297-018
Random Hexamers  Invitrogen 48190-011
Fast SYBR Green Master Mix ThermoFisher 4385612
Costar 96W, ultra low attachment  Corning 3474
HBSS, 1x ThermoFisher 14025134
CD44-APC conjugated antibody  BD Pharmingen 560990 Store at 4 °C, protect from light
CD24-PE antibody BD Pharmingen 560991 Store at 4 °C, protect from light
Recombinant Human TNFα Fisher 210TA100 
CCL2 Primer Forward Sequence AGAATCACCAGCAGCAAGTGTCC
CCL2 Primer Reverse Sequence TCCTGAACCCACTTCTGCTTGG
ICAM1 Primer Reverse Sequence TGACGAAGCCAGAGGTCTCAG
ICAM1 Primer Forward Sequence AGCGTCACCTTGGCTCTAGG
TNF Primer Forward Sequence AAGGGTGACCGACTCAGCG
TNF Primer Reverse Sequence ATCCCAAAGTAGACCTGCCCA
36B4 Primer Forward Sequence GTGTTCGACAATGGCAGCAT
36B4 Primer Reverse Sequence GACACCCTCCAGGAAGCGA
Sodium Hydroxide Sigma-Aldrich S5881-500G
4-Hydroxybenzyl Alcohol Sigma-Aldrich 20806-10G
O-Acetylsalicyloyl Chloride Sigma-Aldrich 165190-5G
Phosphorous Pentoxide Sigma-Aldrich 79610-100G
Ethyl Fumaroyl Chloride Sigma-Aldrich 669695-1G
Sodium Sulfate Sigma-Aldrich 246980-500G
4-Dimethylaminopyridine Sigma-Aldrich 714844-100ML 0.5 M in tetrahydrofuran
Triethylamine Sigma-Aldrich T0886-100ML
Toluene Sigma-Aldrich 244511-100ML
Ethyl Acetate Sigma-Aldrich 270989-100ML
Tetrahydrofuran Sigma-Aldrich 401757-2L
400 MHz FT NMR spectrometer  See Bruker’s Avance User’s Manual, version 000822 for details

DOWNLOAD MATERIALS LIST

References

  1. Hanahan, D., Weinberg, R. A. Hallmarks of cancer: the next generation. Cell. 144, 646-674 (2011).
  2. Cuzick, J., et al. Aspirin and non-steroidal anti-inflammatory drugs for cancer prevention: an international consensus statement. Lancet Oncol. 10, 501-507 (2009).
  3. Terry, M. B., et al. Association of frequency and duration of aspirin use and hormone receptor status with breast cancer risk. JAMA. 291, 2433-2440 (2004).
  4. Wang, D., Dubois, R. N. Cyclooxygenase-2: a potential target in breast cancer. Semin Oncol. 31, 64-73 (2004).
  5. Howe, L. R. Inflammation and breast cancer. Cyclooxygenase/prostaglandin signaling and breast cancer. Breast Cancer Res. 9. 9, 210 (2007).
  6. Kopp, E., Ghosh, S. Inhibition of NF-kappa B by sodium salicylate and aspirin. Science. 265, 956-959 (1994).
  7. Yin, M. J., Yamamoto, Y., Gaynor, R. B. The anti-inflammatory agents aspirin and salicylate inhibit the activity of I(kappa)B kinase-beta. Nature. 396, 77-80 (1998).
  8. Pierce, J. W., Read, M. A., Ding, H., Luscinskas, F. W., Collins, T. Salicylates inhibit I kappa B-alpha phosphorylation, endothelial-leukocyte adhesion molecule expression, and neutrophil transmigration. J Immunol. 156, 3961-3969 (1996).
  9. Frasor, J., El-Shennawy, L., Stender, J. D., Kastrati, I. NFkappaB affects estrogen receptor expression and activity in breast cancer through multiple mechanisms. Mol Cell Endocrinol. 418, 235-239 (2014).
  10. Perkins, N. D. The diverse and complex roles of NF-kappaB subunits in cancer. Nat Rev Cancer. 12, 121-132 (2012).
  11. DiDonato, J. A., Mercurio, F., Karin, M. NF-kappaB and the link between inflammation and cancer. Immunol Rev. 246, 379-400 (2012).
  12. Scarpignato, C., Hunt, R. H. Nonsteroidal antiinflammatory drug-related injury to the gastrointestinal tract: clinical picture, pathogenesis, and prevention. Gastroenterol Clin North Am. 39, 433-464 (2010).
  13. Sostres, C., Gargallo, C. J. Gastrointestinal lesions and complications of low-dose aspirin in the gastrointestinal tract. Best Pract Res Clin Gastroenterol. 26, 141-151 (2012).
  14. Kastrati, I., et al. Dimethyl Fumarate Inhibits the Nuclear Factor kappaB Pathway in Breast Cancer Cells by Covalent Modification of p65 Protein. J Biol Chem. 291, 3639-3647 (2016).
  15. Kastrati, I., et al. A novel aspirin prodrug inhibits NFkappaB activity and breast cancer stem cell properties. BMC Cancer. 15, 845 (2015).
  16. Cao, Y., Luo, J. L., Karin, M. IkappaB kinase alpha kinase activity is required for self-renewal of ErbB2/Her2-transformed mammary tumor-initiating cells. Proc Natl Acad Sci U S A. 104, 15852-15857 (2007).
  17. Liu, M., et al. The canonical NF-kappaB pathway governs mammary tumorigenesis in transgenic mice and tumor stem cell expansion. Cancer Res. 70, 10464-10473 (2010).
  18. Korkaya, H., Liu, S., Wicha, M. S. Regulation of cancer stem cells by cytokine networks: attacking cancer's inflammatory roots. Clin Cancer Res. 17, 6125-6129 (2011).
  19. Hinohara, K., et al. ErbB receptor tyrosine kinase/NF-kappaB signaling controls mammosphere formation in human breast cancer. Proc Natl Acad Sci U S A. 109, 6584-6589 (2012).
  20. Kendellen, M. F., Bradford, J. W., Lawrence, C. L., Clark, K. S., Baldwin, A. S. Canonical and non-canonical NF-kappaB signaling promotes breast cancer tumor-initiating cells. Oncogene. 33, 1297-1305 (2014).
  21. Yamamoto, M., et al. NF-kappaB non-cell-autonomously regulates cancer stem cell populations in the basal-like breast cancer subtype. Nat Commun. 4, 2299 (2013).
  22. Rio, D. C., Ares, M., Hannon, G. J., Nilsen, T. W. Purification of RNA using TRIzol (TRI reagent). Cold Spring Harb Protoc. (2010).
  23. Frasor, J., et al. Positive cross-talk between estrogen receptor and NF-kappaB in breast cancer. Cancer Res. 69, 8918-8925 (2009).
  24. Al-Hajj, M., Wicha, M. S., Benito-Hernandez, A., Morrison, S. J., Clarke, M. F. Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci U S A. 100, 3983-3988 (2003).
  25. Vandermeeren, M., et al. Dimethylfumarate is an inhibitor of cytokine-induced nuclear translocation of NF-kappa B1, but not RelA in normal human dermal fibroblast cells. J Invest Dermatol. 116, 124-130 (2001).
  26. Loewe, R., et al. Dimethylfumarate inhibits TNF-induced nuclear entry of NF-kappa B/p65 in human endothelial cells. J Immunol. 168, 4781-4787 (2002).
  27. Seidel, P., et al. Dimethylfumarate inhibits NF-{kappa}B function at multiple levels to limit airway smooth muscle cell cytokine secretion. Am J Physiol Lung Cell Mol Physiol. 297, L326-L339 (2009).
  28. Wilms, H., et al. Dimethylfumarate inhibits microglial and astrocytic inflammation by suppressing the synthesis of nitric oxide, IL-1beta, TNF-alpha and IL-6 in an in-vitro model of brain inflammation. J Neuroinflammation. 7, 30 (2010).
  29. Peng, H., et al. Dimethyl fumarate inhibits dendritic cell maturation via nuclear factor kappaB (NF-kappaB) and extracellular signal-regulated kinase 1 and 2 (ERK1/2) and mitogen stress-activated kinase 1 (MSK1) signaling. J Biol Chem. 287, 28017-28026 (2012).
  30. Li, H. J., Reinhardt, F., Herschman, H. R., Weinberg, R. A. Cancer-stimulated mesenchymal stem cells create a carcinoma stem cell niche via prostaglandin E2 signaling. Cancer Discov. 2, 840-855 (2012).
  31. Li, X., et al. Intrinsic resistance of tumorigenic breast cancer cells to chemotherapy. J Natl Cancer Inst. 100, 672-679 (2008).
  32. Diehn, M., et al. Association of reactive oxygen species levels and radioresistance in cancer stem cells. Nature. 458, 780-783 (2009).
  33. Hollier, B. G., Evans, K., Mani, S. A. The epithelial-to-mesenchymal transition and cancer stem cells: a coalition against cancer therapies. J Mammary Gland Biol Neoplasia. 14, 29-43 (2009).
  34. Velasco-Velazquez, M. A., Popov, V. M., Lisanti, M. P., Pestell, R. G. The role of breast cancer stem cells in metastasis and therapeutic implications. Am J Pathol. 179, 2-11 (2011).
  35. Dontu, G., et al. In vitro propagation and transcriptional profiling of human mammary stem/progenitor cells. Genes Dev. 17, 1253-1270 (2003).
  36. Charafe-Jauffret, E., et al. Cancer stem cells in breast: current opinion and future challenges. Pathobiology. 75, 75-84 (2008).
  37. Clayton, H., Titley, I., Vivanco, M. Growth and differentiation of progenitor/stem cells derived from the human mammary gland. Exp Cell Res. 297, 444-460 (2004).
  38. Ginestier, C., et al. ALDH1 is a marker of normal and malignant human mammary stem cells and a predictor of poor clinical outcome. Cell Stem Cell. 1, 555-567 (2007).
  39. Rosen, J. M., Jordan, C. T. The increasing complexity of the cancer stem cell paradigm. Science. 324, 1670-1673 (2009).
  40. Visvader, J. E., Lindeman, G. J. Cancer stem cells in solid tumours: accumulating evidence and unresolved questions. Nat Rev Cancer. 8, 755-768 (2008).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics