접합에 참여 전송 단백질의 서열 별 분석을위한 공역 결합 분석 실험

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Erdogan, F., Lento, C., Yaseen, A., Nowroozi-Dayeni, R., Kheyson, S., Audette, G. F. Conjugative Mating Assays for Sequence-specific Analysis of Transfer Proteins Involved in Bacterial Conjugation. J. Vis. Exp. (119), e54854, doi:10.3791/54854 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

미세 유기체의 수준에서의 유전자 및 단백질의 전사는 박테리아의 생존과 발전뿐만 아니라 감염 과정에서 중요한 역할을한다. 박테리아 사이 또는 박테리아 및 세포 간 DNA의 교환은 변형, 결합, 벡터 전달을 통해 달성 될 수있다. 1,2- 활용은 대장균 등의 그람 음성균 간의 접합시 점에서 변환 및 전달에 비해 독특 DNA의 전사는 복합 고분자 시스템 공여자와 전지를 연결함으로써 도너 - 제어 방식으로 발생한다. 활용은 박테리아 세포는 호스트 시스템에서 유전자, 단백질 또는 화학 물질을 주입하는 숙주 세포와 상호 작용하는 가장 직접적인 방법입니다. 3 종종, 이러한 에이전트의 전송은 진화와 적응을 호스팅하는 기전과 발암에 이르기까지 호스트에 놀라운 효과를 가지고있다. 그것은 그 공역 recombinatio을 보였다n은 환경 스트레스 조건에서 높은 돌연변이 속도와 박테리아에 적응 3 배의 속도를 증가시킨다. (4) 또한, 접합은 균주의 항생제 내성 유전자가 확산되는을 통해 지금까지 가장 일반적인 경로입니다. 5,6

미생물 세포막 전체 거대 분자의 전달을 지원하기 위해 특수 분비 시스템 진화; 설명 된 그람 음성 세균에서 분비 시스템 (TSSs)의 9 종류의 현재 위치 : T1SS, T2SS, T3SS, T4SS, T5SS, T6SS, T7SS뿐만 아니라 초 (분비)과 문신이 (두 아르기닌 전위) 경로. 분비 시스템의 7,8 각 유형은 또한 다른 균주에 의한 단백질의 다양성과 관련된 경로의 특수성에, 다른 하위 유형으로 필요성을 분할된다. 예를 들어, 타입 IV 분비 시스템 (T4SS)에있어서, Ti 및 CAG 시스템은 F-플라스미드 반면 이펙터 전송을 용이 R27 A를차 pKM101 T4SSs는 공역 플라스미드의 이동을 용이하게한다. 생물받는 사람이나 자신의 주변 환경과 휴대 내용을 자신의 구성 요소 단백질에서 각각 분비 시스템을 조립하고 공유하는 메커니즘의 7,9,10 자세한 이해는 병원성 미생물의 프로세스에 대처하기 위해 대상 전략의 개발에 중요한 요소이다 세포 감염.

Lederberg 및 테이텀 (11)에 의한 대장균의 초기 식별 접합 다음 모바일 공역 플라스미드 다수 확인되고 특성화되었다. (12) 이러한 모바일 플라스미드 그러나 모든 모바일 플라스미드 전송 (기술 Orit)하여 플라스미드의 전송을 가능하게하는 근원을 인식하는 relaxase를 포함, 상당한 범위 (1에서 200 킬로베이스 (킬로바이트)로) 크기가 표시됩니다. 공역 기능 T4SS 조립 용 플라스미드를 더 인코딩 유전자뿐만 아니라, 형IV 결합 단백질. 도 12는 예를 들어 대장균 100킬로바이트 F 플라스미드 33.3 kB의 전송 (TRA) 영역 내의 모든 공역 유전자를 암호화한다. 13 쌍의 형성 (MPF), DNA 전송 및 제외 기능을 짝짓기 pilus 형성을 촉진 모든 단백질 공역 플라스미드 전송시 F 플라스미드 인코딩의 TRA 지역에서 유전자. 10,14,15 지식의 중요한 몸은 공역 T4SSs 사용할 수 있습니다, 그러나 단지 최근에 사용 가능한되고있다 공역 단백질 복합체의 구조 연구를 설명. 16-28

공역 처리의 광범위한 관점을 조립하기 위해, 전사 공역 단백질의 돌연변이를 분석하는 상세한 구조 연구의 결합이 필요하다. 이 공역 정합 분석을 통해 달성 될 수있다. 은 F 플라스미드를 들어, TRA 영역 내에 인코딩 각 단백질은 F-CO 매개하는 역할njugation; 따라서, 전달 유전자의 녹아웃 / 삭제 셀 (도 1)의 공역 용량을 폐지 할 것이다. 작은 이동 플라스미드는 F와 같은 큰 공역 플라스미드위한 표준 삭제 절차에 더 도움이되는 동안 표적 유전자는 하나의 별개의 항생제 내성 유전자를 전달로 치환되는 경우, 유전자 녹아웃보다 쉽게 ​​상동 재조합을 통해 달성된다. 현재의 프로토콜에서, 우리는 55킬로바이트 F 플라스미드 유도체 pOX38-TC의 클로람페니콜 아세틸 트랜스퍼 라제 (CAT)와 관심 전사 유전자를 대체하는 상동 재조합을 사용; 29,30 얻어진 녹아웃 플라스미드 pOX38-TC Δgene :: 형상은 성장 배지에 클로람페니콜의 존재 (CM)로 저항을 용이하게한다. pOX38-TC Δgene :: CM 은닉 공여 세포는 결합 분석을 사용하여 관찰 공역 DNA 전달 / 결합에 영향을 줄 수 없다; pOX38-TC Δgene :: 형상 도너 셀의 결합 효율과 정상 RECIPient 더 자주, 폐지, 감소 또는 것입니다. pOX38-TC Δgene : CM 플라스미드의 공역 전송이 대상 전송 유전자를 품고 작은 복구 플라스미드를 통해 복원 할 수 있습니다. 이 복구 플라스미드는 플라스미드 pK184 (pK184 유전자), 31 또는 너무 오래 그 플라스미드가 제대로 셀 (세포질이나 주변 세포질) 내에서 올바른 위치에 유전자를 표적으로 유도 식을 제공 하나, 구성 적 발현을 제공 하나가 될 수 있습니다. 따라서,이 새로운 기증자 사이의 결합 분석에서 (pOX38-TC Δgene : CM + pK184 유전자 플라스미드를 은닉) 과받는 사람의 세포가 결합 효율은 거의 그 정상 기증자받는 사람 짝짓기 분석의 복원 것으로 예상된다. 이 시스템은 pK184 유전자 작 제물 (결실 또는 점 돌연변이)의 일련의 생성을 통해 기절 유전자의 기능을 검사하고 pOX38-TC Δgene :: 형상 은닉의 결합 용량을 복원하는 각 구조체의 능력을 테스트 한있게 기증자 세포에스.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

DNA를 구축 1. 생성

  1. 대상 유전자의 상동 재조합을위한 올리고머 설계
    1. 다음 단일 55-72 bp의 순방향 올리고머 디자인 : (a) 클로람페니콜 아세틸 트랜스퍼 라제 유전자의 5 '시작 위치의 상류 영역 10-100 염기쌍의 DNA 서열과 상동 인 19-32 bp의 긴 뉴클레오티드 서열을 선택할 상업적 pBAD33 플라스미드에서 32 (b)는 영역에 표적 유전자의 5 '시작 위치의 하류 10-150 혈압 36-54 bp의 길이 염기 서열의 상 동성을 선택 관심.
      1. 순서는 (a)에 따라서 하나의 55-72 긴 앞으로 올리고머을주는 고른 염기의 끝 3 '(b)는 5 고른 염기 서열의 끝'에 가입하세요.
    2. 다음 단일 55-72 bp의 역방향 올리고머 디자인 : (a) 영역에서 10 내지 100 bp의 DNA 서열과 상동 인 19-32 bp의 긴 뉴클레오티드 서열을 선택 하류3의 관심 대상 유전자의 단부 사이트의 상업적 pBAD33 플라스미드의 클로람페니콜 유전자의 단부, 및 (b) 상기 (3)의 상류에 10-150 BP 내의 영역에 36-54 bp의 길이 염기 서열의 상 동성을 선택 ' .
      1. 시퀀스에서 고른 염기의 끝 3 '는 5의 (b)에서 고른 염기 서열의 끝'을 (가) 하나의 올리고머하려면 가입하세요.
      2. 사용 가능한 생물 정보학 소프트웨어에이 올리고머를 복사하고 역 보완으로 순서를 변환합니다. 이는 단일 55-72 bp의 긴 역 올리고머를 제공합니다.
    3. 가능한 올리고 분석기 프로그램을 사용하여 재조합 올리고머가 40 % -60 % 사이 GC 함량이 낮은 머리 핀의 자형 용융 온도 (T 분), 낮은 자기와 이종 이합체 화 T의 m의이 있는지 확인합니다. 어떤 선호하는 생명 공학 회사로부터 합성 및 배송을위한 프라이머를 주문하십시오.
  2. pBAD33에서 CAT 카세트 테이프 (CM R의 증폭
  3. 200 rpm으로 37 ℃에서 진탕 20 μg의 / ML의 클로람페니콜 (CM)와 멸균 원성 국물 (LB)에 pBAD33 플라스미드를 품고 DH5α 세포의 하룻밤 (O / N, 16 ~ 18 시간) 문화를 성장.
  4. 실온에서 O / N 배양 원심 6-8 ㎖, 3 분 동안 5000 XG. 뜨는을 가만히 따르다 및 플라스미드 미니 준비 키트 (재료 표)와 제조 업체의 프로토콜을 사용하여 펠렛에서 pBAD33 플라스미드를 추출합니다.
  5. 지정된 순서로 멸균 튜브에 다음을 추가하여 pBAD33 플라스미드 DNA의 다이제스트를 수행 증류수 적절한 부피 (DDH 2 O)을 50 μL, pBAD33 플라스미드 1 μg의 부피 5 μL 배의 최종 부피 AvaI 제한 효소의 효소 반응 완충액, 0.5 μL (RE). 부드럽게 피펫 팅하여 혼합하고, 반응을 37 ℃에서 1 시간 동안 진행하자. 열은 80시 20 분 (분)에 대한 반응을 비활성화기음. 24 시간보다 더 이상에 대한 -20 ° C에서 보관 샘플 스티커 엔드 저하를 최소화합니다.
  6. 250 mL의 삼각 플라스크에 버퍼 1X TAE 100 ㎖ (; 20 mM의 아세트산 1 mM의 EDTA 40 mM 트리스, 산도 8.5)와 아가로 오스의 1.2 g을 혼합하여 겔을 분리하는 1.2 % 아가로 오스를 준비합니다. 열 및 소용돌이는 완전히 전자 레인지에 용해합니다. 액체가 비등하고 플라스크를 소용돌이하기 시작하면 즉시 가열 중지합니다.
    1. 선회하면서 실온에서 3 분 동안 액체 아가 쿨 섞어 10 ㎎ / ㎖의에 티듐 브로마이드 소용돌이 2 μL를 추가한다. 웰 빗 겔 트레이 아가 붓고 실온에서 1 시간 동안 응고 할 수있다. 1X TAE 버퍼에 최대 2 일 동안 4 ° C에서 보관 젤.
  7. 각각 1.2.3에서 피펫으로 DNA 로딩 염료 (50 μL의 반응에 따라 염료의 10 μL) 0.2 볼륨 소화 RE 섞는다. 물론 A의 또 다른에 500 μg의 / ML의 DNA의 제 1 웰에 사다리와 RE 다이제스트 - 염료 혼합물의 모든로드 5 μLgarose 젤. 겔에 반응 볼륨을 모두로드 2-3 우물을 사용합니다.
    1. 버퍼 및 겔 전기 영동 장치에서 65 분 동안 45 ~ 50 V (4.5-5 V / cm)에서 작동 거의 1 배 TAE에 잠긴 젤을 실행합니다.
  8. 자외선 살균 캐비닛 면도기를 이용하여 신속하게 DNA의 UV 노출을 최소화하는 것이 겔 밖으로 CAT 서열에 해당하는 2.8 kb의 밴드를 잘라. 제조사의 프로토콜에 따라, 겔 추출 키트 (재료 표)를 사용하여 잘라낸 겔 슬라이스로부터 DNA를 추출한다.
    참고 : 직접 UV 아래에 피부를 노출 및 관리와 면도기를 처리하지 않도록주의하십시오.
  9. 상동 재조합을 허용하기 위해 유전자 서열 상동 오버행을 포함 1.1 설계된 프라이머를 사용하여 중합 효소 연쇄 반응 (PCR)에 의해 1.2.6에서 추출 된 CAT 카세트를 증폭한다. PCR 반응은 다음과 같은 순서로 제조 지침 (재료 표)를 사용하여 얼음에 설정되어 있습니다 :
    1. (A) 내로멸균 PCR 튜브는 O PCR 완충액 10 μL, 10 mM의 dNTPs를 10 μM 정방향 프라이머 2.5 μL, 10 μM 역방향 프라이머, 2.5 μL의 1 μL 다음에 50 μL의 최종 부피로 DDH이 적절한 볼륨을 추가 , 1.2.6에서 주형 DNA의 1-25 ng의 100 단위 / μL DNA 중합 효소 0.5 μL.
    2. 1.2.7.1로하지만, 주형 DNA를 제외하고 동일한 성분을지지 대조군을 설정한다. 적절한 DDH 2 O의 볼륨 대신 주형 DNA를 사용합니다. 주형 DNA 및 제조 업체에 의해 양성 대조군으로 제공되는 것 같은, PCR 반응에서 작동하도록 입증 된 프라이머를 사용하여 양성 대조군을 설정합니다.
    3. 피펫으로 부드럽게 모든 반응 내용을 섞는다.
    4. 다음 설정을 사용하여 PCR을 통해 증폭 : 초기 변성을 30 초 동안 98 ° C에서, 변성의 30주기를 10 초 동안 98 ° C, 20 초, 앰플 리콘의 킬로 당 20 초 동안 확장을위한 프라이머 어닐링에서 72 ° C와에 지느러미72 ℃에서 10 분 동안 알 확장. -20 ºC에서 보관 샘플.
  10. 각 반응의 5 μL를 사용하여 아가로 오스 겔 전기 영동을 통해 증폭의 정확한 크기를 (1.2.4-1.2.5 참조)를 확인합니다. PCR 정제 키트 및 제조자의 프로토콜을 사용하여 PCR 증폭 물을 정제 하였다. 스토어는 -20 ºC에서 DNA를 정제 하였다.
  • pK184 유전자 복구 플라스미드
    1. 그 5부터 시작 '말단과 3 향해'다음 순서 단부 순방향 프라이머를 디자인 : (a)에 부착 된 4 랜덤 뉴클레오타이드 분해 효율 (아데닌, 티민, 구아닌과 시토신의 조합)을 선택 (b) (c)의 시작 코돈을 포함하여 관심의 유전자의 5 '말단에 상동 인 21 내지 25 bp의 길이 염기 서열에 따르는 효소 EcoRI 제한 효소 (RE) 절단 부위 서열 (GAATTC). 표적 유전자가를 EcoRI 사이트를 포함하는 경우, pK184 여러 복제 사이트에서 다른 적절한 RE를 선택합니다.
    2. 세포질 단백질을 코딩하는 유전자의 경우, RE 사이트 및 정방향 프라이머의 개시 코돈 사이에 추가의 리더 서열을 포함한다.
    3. 가능한 올리고 분석기를 사용하여, 프라이머는 40 % -60 % 사이 GC 함량이 낮은 머리 핀의 자형 T의 m, 낮은 자기와 이종 이합체 화 T의 m의이 있는지 확인합니다. 합성 용 프라이머를 주문하십시오.
    4. 멸균 LB 32 ºC 200 rpm으로 진탕 10 μg의 / mL의 테트라 사이클린 (TC)를 포함에 DY330R pOX38-TC 세포의 O / N 문화를 성장. 실온에서 O / N 배양 원심 6-8 ㎖, 3 분 동안 5000 XG. 가만히 따르다상층 액과 플라스미드 미니 준비 키트 (재료 표)와 제조 업체의 프로토콜을 사용하여 펠렛의 플라스미드 DNA를 추출합니다.
    5. (1.2.7.1-1.2.7.3 참조) 템플릿으로 pOX38-TC를 사용 1.3.1-1.3.5에서 프라이머와 관심의 전체 유전자를 증폭.
    6. 각 반응의 5 μL를 사용하여 아가로 오스 겔 전기 영동을 통해 증폭의 정확한 크기를 (1.2.4-1.2.5 참조)를 확인합니다. PCR 정제 키트 및 제조자의 프로토콜을 사용하여 증폭 된 DNA를 정제 하였다. 스토어는 -20 ° C에서 DNA를 정제 하였다.
    7. (. 1.3.7)에서 시판 pK184 플라스미드 DNA 증폭 된 유전자 모두의 이중 다이제스트, 지정된 순서로 멸균 튜브에 다음을 첨가하여 수행 DDH 2 O의 적절한 양을 50 μL의 최종 부피로 , pK184 플라스미드 1 μg의 부피 5 μL 배 효소 반응 완충액, 각각의 제한 효소 EcoRI 및 HindIII으로 1 μL.
      1. 부드럽게 피펫 팅하여 혼합하고, 반응을 1 시간 동안 진행하도록37 ºC에서. 열 80 ºC에서 20 분 동안 반응을 비활성화한다. 24 시간보다 더 이상에 대한 -20 ° C에서 보관 샘플 스티커 엔드 저하를 최소화합니다.
        참고 : 여기에 사용 제한 뉴 클레아의 유형은 단계 1.3.1과 1.3.2에서 프라이머로 설계되었다 제한 클레아 제 사이트에 따라 달라집니다.
      2. 반응 관으로 입술 하나만 추가를 제외하고 양성 대조군으로, 1.3.8에서와 같은 반응으로 제조 pK184 플라스미드 번의 다이제스트를 설정. 두 개의 RE 별도로이 작업을 수행합니다.
    8. 이중 pK184 및 유전자 단편 모두 다이제스트 DNA를 추출 1.2.4-1.2.5 프로토콜을 사용하여 1.2 % 아가 로스 겔에서 소화를 실행할 관심 1.2.6 단계 방법.
    9. 3 벡터 : 배 T4 DNA 리가 제 완충액 1로 이루어지는 100 ng의 DNA 총 2 μL 다음 순서로 멸균 튜브에 구성 요소를 추가하여 pK184 벡터 내로의 유전자 삽입을 결찰 삽입 (pK184 : 유전자) 비, DDH 2 O 최대로20 μL 1 μL T4 DNA 리가 아제의 총 부피. 음성 대조군으로 삽입 유전자없이 벡터의 100 NG를 사용하여 유사한 반응을 설정합니다.
      1. 부드럽게 마이크로 피펫을 사용하여 모든 반응 내용물을 혼합하고 25 ° C에서 30 분 동안 배양한다. 65 ° C에서 10 분 동안 연결 반응을 열 - 불 활성화 한 후 얼음에 놓는다.
    10. 얼음 동안, pK184 유전자의 15 μL를 추가 단계로부터 연결 반응 멸균 된 1.5 ㎖의 튜브에 화학적 능력 DH5α 세포 1.3.10 100 μL. 부드럽게 피펫 팅하여 혼합하고 10 분 동안 얼음 위에서 배양한다. 음성 대조군 샘플에 대해 동일한 마십시오. 양성 대조군의 경우, pBAD33 같은 플라스미드 20-100 NG를 사용하여 50 μL DHα 세포로 변환.
    11. 직접 42 ° C의 물을 욕조에 얼음에서 샘플을 전송하고 90 초 동안 품어. 이것은 세포를 열 쇼크를 제공하고,이를 플라스미드 DNA의 흡수를 할 수있다.
    12. 다시 다른 얼음에 장소 세포5 분 후 멸균 (LB)의 900 μL를 추가 125 rpm에서 진탕하면서 1 시간 동안 37 ℃에서 인큐베이션.
    13. 를 50㎍ / ㎖의 카나마이신 (km)를 함유하는 한천 판에 1.3.13 각 연결 반응의 샘플을 100 μL 부피 나누어지는 및 멸균 확산기를 사용하여 세포를 분산. 양성 대조군 판은 적절한 항생제를 가져야한다. 멸균 영역을 유지하고 불꽃 근처에서 작동합니다. 거꾸로 37 ℃로 하룻밤에 접시를 품어.
    14. 멸균 피펫 또는 루프를 사용하여, 세포의 단일 별개의 식민지를 수확하고 50 μg의 / mL의 킬로미터와 20 mL의 멸균 LB 접종. 멸균 영역을 유지하고 불꽃 근처에서 작동합니다. 200 rpm으로 진탕 37 ° C에서 세포 O / N를 성장.
    15. 살균 극저온 튜브에 멸균 100 % 글리세롤 (최종 50 % v / v)의 500 μL와 O / N 문화의 500 μL를 혼합하여 형질 전환 된 DH5α 세포의 3-5 글리세롤 주식을합니다. -80 ° C에서 보관하십시오.
    16. 실온에서 O의 또한 원심 분리기 6-8 ㎖ / N 문화, 5,003 분 0 XG. 뜨는을 가만히 따르다 및 플라스미드 미니 준비 키트 (재료 표)와 제조 업체의 프로토콜을 사용하여 펠렛에서 pK184 유전자 복구 플라스미드를 추출합니다.
  • pK184 - 유전자 돌연변이
    주 : 결실, 삽입 및 / 또는 점 돌연변이를위한 프라이머 디자인은 쉽게 제조 온라인으로 가능한 도구를 사용하여 생성 될 수있다.
    1. 개시 코돈을 포함하여 관심의 유전자의 5 '말단에 상동 인 18-32 bp의 긴 염기 서열을 선택하여 각각의 정방향 프라이머를 설계한다. 각각의 정방향 프라이머는 적절한 길이의 N 말단 펩티드 단편이 결여 결실 돌연변이의 결과로, 선행 한 30-180 염기쌍 하류 어닐링하도록 디자인 된 프라이머.
    2. 종결 코돈을 포함하여 관심 유전자의 3 '말단에 상동 인 18-32 bp의 긴 염기 서열을 선택하여 역방향 프라이머를 설계한다. (A) 내로이 프라이머를 복사뉴욕 사용할 수 생물 정보학 프로그램과 역 보완으로 순서를 변환합니다. 이것은 역방향 프라이머이다.
      1. 세포질 단백질을 코딩하는 유전자의 경우,이 유전자의 단부와 페리 플라 즘에서 단백질 제품의 적절한 위치 파악에 필요한 3 '5 옆구리 리더 서열의 끝에'를 역순 보완 역방향 프라이머를 설계한다.
    3. 가능한 올리고 분석기 프로그램을 사용하여 삭제 프라이머는 40 % -60 % 사이 GC 함량이 낮은 머리 핀의 자형 용융 온도 (T 분), 낮은 자기와 이종 이합체 화 T의 m의이 있는지 확인합니다. 가능한 생명 공학 회사로부터 합성 및 배송을위한 프라이머를 주문하십시오.
    4. 템플릿으로 프로토콜 1.3에서 얻어진 pK184 유전자 구조와 1.2.7-1.2.8의 지침을 사용하여, PCR은 pK184 유전자 ΔX의 증폭을 생성하는 단계 1.4.1-1.4.3에서 디자인 된 프라이머를 삭제 구조를 증폭 . 스토어 DNA 증폭 A를t -20 ° C.
    5. 가능한 돌연변이 유발 키트 (재료 표)를 사용하여 증폭 구조체를 결찰.
    6. 표준 열 쇼크 프로토콜 (1.3.11-1.3.13 참조)를 사용하여 화학적으로 관할 DH5α 세포에 개별적 pK184 유전자 ΔX의 ligates 각각 변환.
    7. 를 50㎍ / ㎖ km를 함유하는 한천 판에 1.4.12 각 연결 반응의 샘플을 100 μL 부피 나누어지는 및 멸균 확산기를 사용하여 세포를 분산. 멸균 영역을 유지하고 불꽃 근처에서 작동합니다. 거꾸로 37 ℃로 하룻밤에 접시를 품어.
    8. 멸균 피펫 또는 루프를 사용하여, 셀의 단일 콜로니를 구별 수확를 50㎍ / ㎖ 킬로미터에 20 mL의 멸균 LB 배지에 접종. 멸균 영역을 유지하고 불꽃 근처에서 작동합니다. 200 rpm으로 진탕 37 ° C에서 세포 O / N를 성장.
    9. (바 멸균 100 % 글리세롤의 500 μL와 O / N 문화의 500 μL를 혼합하여 형질 전환 된 DH5α 세포의 3-5 글리세롤 주식을원고 판 50 % v / v)의 살균 극저온 튜브한다. -80 ° C에서 보관하십시오.
    10. 실온에서 O / N 배양 원심 6-8 ㎖, 3 분 동안 5000 XG. 뜨는을 가만히 따르다하고 pK184 유전자 ΔX 플라스미드는 플라스미드 미니 준비 키트 (재료 표)와 제조 업체의 프로토콜을 사용하여 펠렛에서 구성의 압축을 풉니 다. -20 ° C에서 저장 DNA.
  • pOX38-TC Δgene의 2 세대 : CM 균주

    1. DY330R pOX38-TC Δgene : CM 녹아웃
      1. 10 μg의 / mL의 Tc를을 포함하는 10 mL의 멸균 LB에서 DY330R pOX38-TC 세포의 O / N 문화를 준비합니다. 32 ° C, 200 rpm에서 문화 O / N를 성장.
      2. 신선한 멸균 (LB)의 20 ㎖로 O / N 문화의 1:70 희석합니다 중반 로그 단계 (OD600nm에서 0.4-0.6) 증가 할 때까지 32 ℃에서 세포를 성장.
      3. 진탕 물 바에서 멸균 플라스크에 문화의 양도 10 mL를 150 rpm에서 15 분 동안 42 ° C에서 부화일. 이것은 특정 DY330R에서 재조합 단백질의 발현을 유도한다.
      4. 10 분간 얼음 - 수조에서 배양을 냉각. 다음과 같이 electrocompetent 세포를 준비합니다.
        1. 4 ºC에서 7 분 동안 4,000 XG에 미리 냉장 원뿔 튜브와 원심 분리기에 냉장 세포를 전송합니다. 다가오는 단계에서 사용되는 모든 튜브 및 피펫은 4 ° C에 배치해야 또는 얼음에 냉각.
        2. 얼음 추위의 DDH 2 O.의 또 다른 30 mL를 넣고 상층 액을 제거하고 부드럽게 얼음처럼 차가운 DDH 2 O. 1 mL에 세포를 재현 탁
        3. 원심 분리기는 세포 (4,000 XG, 7 분, 4 °에 C), 상층 액을 버리고 부드럽게 얼음처럼 차가운 DDH 2 O. 1 mL에 세포를 재현 탁
        4. 4 ºC에서 1 분 동안 15,000 XG에 미리 냉장 1.5 ML의 미세 원심 분리 튜브와 원심 분리기에 재현 탁 세포를 전송합니다.
        5. 조심스럽게 50 μL 볼륨에 얼음처럼 차가운 DDH 2 O와 나누어지는 200 μL에 펠렛을 재현 탁. ElectrocompeteNT 세포는 -80 ℃에서 저장 될 수있다
      5. 로 pipetting 아래로 부드럽게, 얼음에 혼합하면서 electrocompetent DY330R pOX38-TC 세포의 50 μL에 1.2에서 증폭 된 CAT 카세트의 300 NG를 추가합니다. 양성 대조군으로 수정되지 않은 pBAD33 플라스미드를 사용하여이 단계를 반복합니다.
      6. 사전 냉각 (-20 ° C) 1mm의 전기 큐벳에 세포를 전송합니다. electroporator를 사용하여 5.5 밀리 시정 1.8 kV로의 세포 Electroporate. 즉시 펄스를인가 한 후, 1 mL의 SOC의 미디어 세포를 희석하고 신선한의 microfuge 튜브에 전송할 수 있습니다. 2 시간 동안 32 ℃에서 세포를 인큐베이션.
      7. 10 μg의 / ㎖ Tc를 20 μg의 / ㎖ CM을 함유 멸균 확산기를 사용하여 확산 아가 플레이트 상에 각각의 샘플의 100 μL 분취. 멸균 영역을 유지하고 불꽃 근처에서 작동합니다. 성공적인 재조합을위한 선택 거꾸로 32 ℃로 하룻밤에 접시를 품어. 셀에 도입 된 CAT 카세트는 상동 재를 받아야합니다관심의 유전자 조합은 DY330R pOX38-TC Δgene :: CM (하기 Rif R, Tc를 R, CM R) 클론을 만들 수 있습니다.
        주 : 고온에서 장기간의 성장으로, 종래 electrocompetent 세포를 생성하는 단계 2.1.3 42 ° C에서 15 분 유도 제외하고 32 ° C에서 DY330R 세포 성장 중요 인해 생산 세포 사망 위험 DY330R에서 재조합 기능을 담당하는 P는 L 오페론에서의 독성 제품. 33, 34
      8. 오 준비 / DY330R pOX38-TC Δgene의 N :: 멸균 피펫 또는 루프와 세포의 단일 별개의 식민지를 수확, 10 μg의 / mL의 Tc를, 20 μg의 / mL로 20 mL의 멸균 LB 미디어를 접종하여 CM 세포 센티미터. 멸균 영역을 유지하고 불꽃 근처에서 작동합니다. 200 rpm으로 진탕 32 ° C에서 세포 O / N를 성장.
      9. 멸균 100 % (GL)의 500 μL와 O / N 문화의 500 μL를 혼합하여 O / N 3-5 글리세롤 주식을살균 극저온 튜브 ycerol (최종 50 % v / v)로. -80 ° C에서 보관하십시오.
      10. 실온에서 O / N 배양 원심 6-8 ㎖, 3 분 동안 5000 XG. 뜨는을 가만히 따르다하고 pOX38-TC Δgene : CM 추출 플라스미드 미니 프렙 키트 (재료 표) 및 제조자의 프로토콜을 이용하여 펠릿으로부터 구성; -20 ° C에서 정제 된 DNA를 저장합니다.
      11. 프로토콜 3.1에 따라 유전자 녹아웃에 의해 접합의 중단을 확인하기 위해 수신자로 XK1200 세포를 사용하여 공역 결합 분석을 수행합니다.
    2. DY330R pOX38-TC Δgene : CM + pK184 유전자
      1. 2.1.4-2.1.7 단계에 따라 전기를 통해 pK184 유전자 구조 300 NG와 electrocompetent DY330R pOX38-TC Δgene : CM 세포를 변형. 모든 선택 배지는 20 μg의 / mL의 CM 및 50 μg의 / mL의 킬로미터를 포함해야합니다. 32 ° C에서 품어. 일렉트릭 세포의 복구 플라스미드는 이제 D에 기절 유전자의 기능을 복원합니다Y330R pOX38-TC Δgene : CM 세포.
      2. 오 준비 / DY330R pOX38-TC Δgene의 N :: 멸균 피펫 또는 루프와 세포의 단일 별개의 식민지를 수확, 20 μg의 / mL의 CM에 20 mL의 멸균 LB 미디어를 접종하여 CM + pK184 유전자 재조합 세포 50 μg의 / mL의 km. 멸균 영역을 유지하고 불꽃 근처에서 작동합니다. 200 rpm으로 진탕 32 ° C에서 세포 O / N를 성장.
      3. 살균 극저온 튜브에 멸균 100 % 글리세롤 (최종 50 % v / v)의 500 μL와 O / N 문화의 500 μL를 혼합하여 O / N 3-5 글리세롤 주식을합니다. -80 ° C에서 보관하십시오.
      4. 또한 XK1200 pOX38-TC Δgene : CM에게 재조합 세포를 생성하는 프로토콜 3.1을 수행합니다.
    3. XK1200 pOX38-TC Δgene : CM + pK184 유전자와 돌연변이
      1. (단계 2.2.4에서) electrocompetent XK1200 pOX38-TC Δgene : CM 세포를 준비합니다.
      2. 별도로 전자 업계의 50 μL에 pK184 유전자 또는 pK184 유전자 돌연변이 플라스미드 300 NG를 electroporatectrocompetent XK1200 pOX38-TC Δgene 단계에 따라 :: CM 세포 2.1.4-2.1.7. 모든 선택 배지는 10 μg의 / mL의 리딕 산 (NAL), 20 μg의 / mL의 CM, 50 μg의 / mL의 킬로미터를 포함해야하고 37 ℃에서 배양 될 수있다.
      3. 오 준비 / XK1200 pOX38-TC Δgene의 N :: 멸균 피펫 또는 루프와 세포의 단일 별개의 식민지를 수확하고, NAL, 20 μg의 / mL를 20 mL의 멸균 LB 미디어를 접종하여 CM + pK184 유전자 재조합 세포 CM 및 50 μg의 / mL의 km. 멸균 영역을 유지하고 불꽃 근처에서 작동합니다. 200 rpm으로 진탕 37 ° C에서 세포 O / N를 성장.
      4. 살균 극저온 튜브에 멸균 100 % 글리세롤 (최종 50 % v / v)의 500 μL와 O / N 문화의 500 μL를 혼합하여 O / N 3-5 글리세롤 주식을합니다. -80 ° C에서 보관하십시오.

    3. 공역 결합 분석 실험

    1. 공역 결합은 XK1200 pOX38-TC Δgene : CM 세포를 생성합니다
      1. 20 mL의 멸균 LB O / N의 막 다른 준비DY330R pOX38-TC Δgene의 진짜야는 :: 멸균 피펫 또는 루프를 사용하여 CM + pK184 유전자 세포는 20 mL의 멸균 LB가에 글리세롤 주식 또는 단일 콜로니 20 μg의 / mL의 CM 및 50 μg의 / mL의 킬로미터를 포함 접종하기 한천 플레이트. 200 rpm으로 진탕 32 ° C에서 성장. 37 ° C에서 성장, 10 μg의 / mL의 최종 20 mL의 멸균 LB에서 XK1200 셀에 대해 동일한을 준비합니다.
      2. 별도로 같은 항생제 내용 멸균 LB의 2 mL에 각 문화의 1:70 희석합니다; 모든 공여 세포는 100 mM의 최종 농도 글루코스를 추가한다. 200 rpm으로 진탕 37 ° C에서 중반 로그 단계 (OD 600 0.5-0.7)에 세포를 성장.
      3. 원심 분리기 2 mL의 차가운 멸균 (LB)에 항생제와에 resuspend 세포를 제거하는 차가운 멸균 LB로 한번 씻어, 상층 액을 버리고, 세포 펠렛 (4,000 XG에 5 분 4 ° C에서)
      4. 나누어지는 무균 LB 미디어 800 μL으로 각 문화의 100 μL하고 흔들림없이 1 시간 동안 32 ° C에서 짝짓기를 할 수 있습니다.
      5. <리> 소용돌이를 결합 쌍을 중단하고 상기 결합을 방지하기 위해 10 분 동안 얼음에 배치하는 30 초 동안 세포.
      6. XK1200 pOX38-TC Δgene : CM 세포에 대한 선택 10 μg의 / mL의 최종 20 μg의 / mL의 CM을 포함하는 한천 접시에 세포 혼합물의 나누어지는 100 μL. 멸균 확산기를 사용하여 세포를 확산. 멸균 영역을 유지하고 불꽃 근처에서 작동합니다. 37 ° C의 거꾸로에서 판 O / N을 배양 하였다.
      7. 새로운 XK1200 pOX38-TC Δ 유전자의 단일 식민지를 수확 :: CM을 멸균 피펫 또는 루프와 20 μg의 / mL의 CM, O / N과 멸균 LB에서 성장에를 사용하여 녹아웃 변형 200 rpm으로 진탕 37 ° C를. 살균 극저온 튜브에 멸균 100 % 글리세롤 (최종 50 % v / v)의 500 μL와 O / N 문화의 500 μL를 혼합하여 O / N 3-5 글리세롤 주식을합니다. -80 ° C에서 보관하십시오.
        참고 : 생성 된 세포가 지금 할 수있는 엉덩이의 pK184 유전자 구조 (프로토콜 1.3 및 1.4)로 변환하기위한 능력 만들 수능력에 유전자와 돌연변이 싱은 프로토콜 3.2 공역 전송을 복구 할 수 있습니다.
    2. 공역 결합 분석 XK1200 기증자로부터 MC4100받는 사람에
      1. XK1200 pOX38-TC Δgene의 O / N 문화를 준비 :: CM + pK184 유전자 한천 플레이트 및 멸균에 글리세롤 주식 또는 단일 콜로니에서 20 μg의 / mL의 CM, 50 μg의 / mL의 km 및 MC4100 50 μg의 / ML의 스트렙토 마이신 5 ㎖의 LB의 셀 (SM)를 사용하여 세포 멸균 LB 20 ㎖의 세포 피펫 또는 루프. 에서 문화를 성장 200 rpm으로 흔들면서 37 ℃로.
      2. 별도로 같은 항생제와 멸균 LB의 2 mL에 각 O / N 문화에서 1:70 희석합니다. 모든 공여 세포는 100 mM의 최종 농도 글루코스를 추가한다. 200 rpm으로 진탕 37 ° C에서 중반 로그 단계 (OD 600 0.5-0.7)에 세포를 성장.
      3. 원심 분리기, 상층 액을 버리고, 세포 펠렛 antibio을 제거하는 차가운 멸균 LB로 한번 씻어 (4,000 XG에 5 분 4 ° C에서)2 mL의 저온 살균 (LB)에서 틱, 그리고에 resuspend 세포
      4. 중복, 멸균 LB 미디어 800 μL으로 각 문화의 나누어지는 100 μL와 그들을 흔들어없이 1 시간 동안 37 ° C에서 짝짓기를 할 수 있습니다.
      5. 와동 (30)들에 대한 세포 결합 쌍을 중단하고 상기 결합을 방지하기 위해 10 분 동안 얼음에 배치한다.
      6. 단계 3.2.2과 신선한 멸균 LB에서 중반 로그 문화를 사용, 10-7로 10-2에서 기증자와받는 사람 세포의 6 연속 희석을 준비합니다.
      7. 10 μg의 / ㎖ 최종 20 μg의 / ㎖ cm이고를 50㎍ / ㎖ km를 함유하는 한천 판의 두 반쪽 XK1200 도너 셀의 각 희석액 10 μL 분취를 스폿의 각각도 2에 도시 된 바와 같이. 50 μg의 / mL의 SM을 포함하는 한천 플레이트에받는 사람 MC4100 세포의 희석에 대해 반복합니다. 37 ° C에서 접시 O / N을 품어.
      8. 단계 3.2.5과 신선한 멸균 LB에서 텍싱 혼합물을 사용하여, 10-2 10-7 6 희석 (준비 그림 2에서와 같이 50 μg의 / mL의 SM 20 μg의 / mL의 CM을 포함하는 한천 플레이트의 각각의 절반에 희석 각각 10 μL 씩 얼룩을지게하여 접합체에 대한 MC4100 pOX38-TC Δgene : CM 셀을 선택합니다. 모두 중복 된 혼합물에 대해 반복합니다. 멸균 영역을 유지하고 불꽃 근처에서 작동합니다. 37 ° C에서 접시 O / N을 품어.
      9. 프로토콜 3.3에 설명 된대로 각 구조의 결합 효율을 결정합니다.
      10. 모든 복구 플라스미드 접합 효율의 특정 돌연변이의 영향을 평가하기 위해,이 프로토콜을 반복한다.
    3. 상대 효율의 계산
      1. 각각의 접시에 각 기증자,받는 사람 및 접합체 셀에 대해 동일한 희석 안보에서 콜로니의 수를 계산합니다.
      2. 그 주어진 희석받는 사람보다 transconjugants의 많은 수를 가진 결과하는 어떤 편견을 테스트받는 식민지를 계산합니다.
      3. 기음도너 콜로니로 나눈 접합체 콜로니의 수 결합 효율 alculate. 100 공여 세포 당 효율 값을 획득한다 (100)에 의해 곱.

    Subscription Required. Please recommend JoVE to your librarian.

    Representative Results

    F 플라스미드 구동 접합 과정은 pilus 합성과 공역 DNA 전달을 용이하게하기 T4SS을 어셈블 F-플라스미드 TRA 영역 내에 전달 단백질을 포함하는 조정 방법이다. 단백질 트래픽 (GenBank 액 # BAA97961, UniProt ID P14497)을 공역 F-pilus 형성을 위해 필요합니다. 10,14,35 -이 촉매 CXXC 모티브가 없습니다 불구하고 37 단백질은 C 말단 티 오레 독신과 같은 도메인이 포함되어 있습니다. 그것은 그것의 N 말단 영역을 통해 TraH 단백질과 상호 작용하는 것으로 예상되었지만, 35,38, 39의 영역 밖의 많지 않음 37 단백질의 구조적 특징에 대해 알려져 있으며, 그 C 말단 도메인보다 동적 인 것으로 나타났다. 구조적인 연구와 관련하여 TRAF 단백질의 기능적 양상을 평가하기 위해, 먼저 동종 통해 pOX38-TC의 트래픽 유전자 기절재조합 대장균 DY330R 셀 내의 pOX38-TC ΔtraF :: CM 플라스미드 (표 1)을 발생시킨다. 또한 생성 된 33, 34은 접합의 복구를 제공하고 단백질의 서열을 프로빙 수 있도록 트래픽 특이 프라이머 (표 2)에서 pK184-트래픽 플라스미드이었다. pK184 - 트래픽이 트랜스에 제공 한 XK1200 세포 DY330R 세포에서 40로 pOX38-TC ΔtraF : CM 플라스미드의 전송을 나타냅니다 (transconjugants 10 μg의 / mL의 Tc를 20 μg의 / mL의 CM은 10 μg의 / mL의 최종 성장) pOx38-TC ΔtraF : CM에서 그 (a)는 트래픽 녹아웃은에서 프레임 CAT 카세트를 제공하고, (b)는 그 pK184-트래픽은 공역 기능을 복원 할 수 있습니다.

    트래픽 돌연변이 일련 XK1200 pOX38-TC ΔtraF : CM + pK184-트래픽 ΔX를 사용하여 공역 정합 분석 (37)를 이용 분석 생성 된세포 각각 기증자와받는 사람 등 41 MC4100 세포. 하나의 대표적인 돌연변이는 트래픽 55-247 (표 1), 단백질의 영역과 상호 작용 TraH 예측 제거하는 N 말단 결실 돌연변이 체이다. 전장 TRAF 단백질 도너 셀에 제공 될 때 빈 pK184 플라스미드를 제공하는 단계 (표 3)은하지 않지만, 공역 전사 (도 2)를 복원한다. 플라스미드 pK184-트래픽 55-247 (표 3)와 함께 제공하는 경우 마찬가지로, XK1200 공여 세포의 공역 기능이 복원되지 않습니다. 이 단백질의 절단 부위는 예상 TraH과의 상호 작용을 통해 공역 장치 내의 트래픽의 기능에 중요하다는 것을 나타내고, 상기 돌연변이 분석 대상 단백질의 영역을 제공한다.

    그림 1
    트랜스에서 제공하지 않는 접합을 용이하게 할 수 없습니다 플라스미드 pOX38-TC Δgene :: CM을 항구. 얻어진 pOX38-TC Δgene :: CM 플라스미드는 MC4100받는 (단계 3)와 결합 분석법을 이용하여 유전자의 추가적인 평가를위한 XK1200 균주 (단계 2)로 전송된다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

    그림 2
    그림 2 : 매트분석을 보내고하면 접합에서 표적 유전자의 기능을 평가한다. 기증자와받는 사람 세포는 대장균 XK1200 pOX38-TC ΔtraF :: CM은 각각 pK184 - 트래픽 및 MC4100로 형질 전환 하였다. 그 결과 transconjugants (MC4100 pOX38-TC ΔtraF : CM)의 공역 기능을 성공적으로 복구를 나타내는, SM과 CM을 포함하는 판에 성장합니다. 실험 한 한천 플레이트 상에 중복으로 수행하고, 연속 희석 순서 레스토 유전자 돌연변이 (표 2)의 결합 효율을 계산에 사용된다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

    균주 / 플라스미드 관련 특성 선택적 마커 (들) 참고
    세균 균주
    DY330R W3110 ΔlacU169 gal490 λc1857 Δ (CRO-bioA)하기 Rif R RIF 33, 34
    XK1200 F - lacΔU124 Δ (바이오 gyrA attλ 나다 aroG의 여자) 최종 (40)
    MC4100 araD139 Δ (된 argF-락) U169 rpsL150 relA1 flbB3501 deoC1 ptsF25 rbsR SM (41)
    벡터와를 구축
    pBAD33 P의 araBAD에서 아래의 발현을위한 플라스미드 센티미터 (32)
    pK184 벡터, p15a의 플리 복제 2.4 킬로바이트 km (31)
    pK184-트래픽 </ TD> pK184에서 pOX38에서 F 트래픽 km (35)
    pK184-트래픽 56-247 pK184 - 트래픽에서 F 트래픽 AA 56-247 km
    공역 플라스미드
    pOX38-TC IncFI, 트라 +, RepFIA +, F, 미니 테네시의 F1을 HindIII 단편 TC 29, 30
    pOX38-TC ΔtraF : CM CAT와 pOX38-TC는 트래픽에 삽입 TC CM (35)
    † CM, 클로람페니콜; km, 카나마이신; NAL, 날리 딕스 산; RIF, 리팜피신, SM, 스트렙토 마이신; TC, 테트라 사이클린
    ‡ 모든 트래픽 구조는 주변 세포질 공간 현지화을 보장하기 위해 19 잔류 리더 서열을 포함합니다.

    1 번 테이블: 균주 및 플라스미드는이 연구에 사용 하였다.

    구축 뇌관*
    트래픽-CM-들어 5' GATCGAGGCTGGCAGTGGTATAACGAGAAAATAAATCCGAAGGA - CTGTGACG GAAGATCACTTC -3 '
    트래픽-CM-계 5' TCTTCAGAAACGTTCAGGAACTGTTTTGCCAGGTCGTCCT - CTTATTCAGGCGT AGCACCAG -3 '
    pK184 - 트래픽 - 들어 5' TTTTTT GAATTC TATGAATAAAGCATTACTGCCAC -3 '
    pK184 - 트래픽 - 레브 5' TTTTTT AAGCTT TAAAAATTGGGTTTAAAATCTTCAGAAA -3 '
    pK184-트래픽 55-247 용 - 5' TACG CATATG ATGGCCGCACTGCAGACGG -3 '
    pK184-트래픽 55-247 5' TACG CATATG TCCTGACGCCGGAAAAATAAAGCAGCAGAGTAA -3 '
    † Lento 등에서 적응 표. 권한을 가진 2016 35
    * 트래픽 돌출 영역은 이탤릭체로되어있다. (: AAGCTT,를 EcoRI : GAATTC,있는 NdeⅠ : CATATG HindIII로)를 제한 효소 사이트는 밑줄

    표 2 : 본 연구에 사용 된 프라이머의 목록입니다.

    기증자 플라스미드 † 복구 플라스미드 Transconjugants ‡ § (셀 ML -1) 상대 Efficiency§ ||
    pOX38-TC ΔtraF : CM 없음 0 0
    pOX38-TC ΔtraF : CM pK184 0 0
    pOX38-TC ΔtraF : CM pK184 - 트래픽 5 × 10 (3) 0.0167
    pOX38-TC ΔtraF : CM pK184-트래픽 55-247 0 0
    * Lento 등에서 적응 표. 권한을 가진 2016 35
    † 공여 세포는 E. 콜라이 XK1200 3 X 107 셀 ML의 평균 농도였다 -1
    ‡받는 사람 세포는 대장균 MC4100이었다. 포지티브 컨트롤 transconjugants의 수는 (10-5)로 희석한다. 0은 10-2 희석로부터 transconjugants을 나타냅니다.
    2-4 결합 실험 §An 평균은 각 구조에 대해 수행 하였다.
    || 짝짓기 효율 defin입니다100 공여 세포 당 transconjugants로 에드. 0 결합 효율은 10-2 희석로부터 transconjugants을 나타냅니다

    표 3 : 트래픽 삭제 구조에 의해 폐지 결합 효율.

    Subscription Required. Please recommend JoVE to your librarian.

    Discussion

    접합 공정은 박테리아와 같은 항생제 내성 마커의 확산 등의 어려운 환경에서 성장을 위해 진화하는 장점을 제공하는 유전자를 확산 할 수있는 수단을 제공한다. 공역 플라스미드 많은 너무 크기 때문에, 공역 플라스미드 자체의 표적 유전자의 돌연변이를 통해 전송 장치의 조립에 관여하는 단백질의 기능 연구 12 다루기이다. 본원에 설명 된 프로토콜을 하나 더 쉽게 더 작고 관리 발현 플라스미드 (도 1)를 사용하여 관심 대상 유전자를 평가할 수있는 수단을 제공한다. 우리는 F 플라스미드 매개 활용을 연구하는 F 플라스미드 유도체 pOX38-TC (표 1) 사용; 다른 공역 플라스미드는 여기에 설명 된 프로토콜과 해당 파생 플라스미드를 사용하여 공부하실 수 있습니다. 설명 된 상대 분석은 일부 modificati와 프로스트와 동료, (42)에서 채택 된기능. 이전 연구에서, pOX38-TC Δgene :: 형상 구조체의 8,33,42 생성 적절한 제한 효소로 목적 유전자를 절단하고 pOX38-TC로 증폭 CAT 카세트를 삽입하여 달성 하였다. 현재의 방법 (42), 우리는 표적 유전자 녹아웃 및 CAT 카세트로 교체하는 recombineering 대장균 DY330R 33,34에서 상동 재조합을 사용한다. F-T4SS가 pK184 유전자 회수 한 플라스미드를 사용하는 전송의 복구를 통해 공역 전송 매개 아웃이 pOX38-TC Δgene :: CM에서 유전자 특이 적 녹아웃을위한 제어 역할을 구성 형질 얻어진 DY330R 변형을 허용하는 이점이있다 . 그것은 선명-Cas9 방법, (43)를 사용하여 녹아웃을 발생시킬 수 있지만, 우리는 이러한 가능성을 탐색 이때되지있다.

    프로세스합니다 (F 유도체 플라스미드 pOX38-TC의 유전자 녹아웃의 발생으로 시작 FigurE 1). 이 DY330R 세포에서 상 동성 재조합 (표 1)를 통해 실현되며, 그러한 DY329, DY331 DY378와 유사한 기능을 갖는 다른 균주도 사용될 수있다. 프라이머 초기 pBAD33 플라스미드 32에서 CAT 카세트를 증폭 표적 유전자 (표 2)에 대한 특정 염기 돌출 PCR 포함하도록 설계된다; PCR 산물은 pOX38-TC를 형질 DY330R 세포에 전기 천공한다. 상동 재조합는 CAT 카세트 CM 저항을 제공하면서 효과적으로 T4SS 어셈블리와 결합을 방해, 표적 유전자 내에서 프레임 삽입 노크 아웃 플라스미드 pOX38-TC Δgene :: CM을 생성합니다. 동시에, 목적 유전자가 pOX38-TC로부터 PCR 증폭하고, 작은 발현 플라스미드에 삽입; 이 프로토콜에서는 원하는 경우 하나는 표적 유전자의 유도 식으로 플라스미드를 선택할 수있는, 구성 적 발현 pK184를 사용한다. pK184 유전자 플라스미드를 형질 전환 한 다음DY330R pOX38-TC Δgene : CM 세포로,이 세포는 다음 pOX38-TC Δgene : CM이 결합 분석을위한 XK1200 세포에 결합을 통해 구성 전송하는 기증자로 사용됩니다. 상대 분석에서, 기증자와받는 사람 세포는 각각 XK1200 pOX38-TC Δgene :: CM 및 MC4100이다. pK184 유전자 복구 플라스미드뿐만 아니라 표적 유전자 (결실 또는 점 돌연변이)의 일련의 돌연변이가 MC4100받는 세포 (도 2와 결합을 복원 및 그 효율을 결정하는 능력을 평가하기 위해 도너 셀에 제공되고 표 3).

    절차 긴급 적합한 공여자와 균주 (표 1)에 사용되는 프라이머의 디자인을 사용하는 것이다. 설계 각각의 프라이머를 들어, 따라야한다 일반적인 지침이 있습니다. 우리는 엄격하게 40~60%의 GC 함량을 준수하려고하지만, 이것은 항상 가능하지 않을 수 있습니다. 이러한 경우에, 승 프라이머를 테스트 실험자의 판단이며약간 아래 또는이 범위 위의 i 번째 GC 내용. 순방향 및 역방향 프라이머의 용융 온도 (T의 m)은 유사하며, 어닐링 온도 (T A) 값은 항상 PCR 2-5 ℃로하여 T의 m 이하이어야한다. 호모와 헤테로 이합체 화 T의 m가의 매우 낮은해야합니다 동안 T (A)보다 훨씬 낮아야한다 개발 헤어핀을 허용 사용할 수있는 자유 에너지 (이하 -10 킬로, 30 ° C). 프라이머는 원하는대로 결실, 삽입 또는 점 돌연변이를 조사하기 위해 설계 될 수있다. 또한 얻어진 유전자 구조가 증폭 제대로 발현되도록 프레임에서 회수 한 플라스미드에 라이 게이션 될 수 있음은 물론 중요하다. 적격 세포 형질 전환은 각각 electrocompetent 또는 화학적 적격 세포를 이용하여 전기 충격 또는 열을 통해 수행 될 수있다. 우리는 전기는 pOX38-TC와 상동 재조합 oligonucle으로 더 큰 구조에 대한보다 효율적인 것을 발견otide 같은 pK184-트래픽과 같은 더 작은 발현 플라스미드 용이 열 쇼크 방법을 사용하여 세포에 형질 전환 될 수있다. 마지막으로, 모두 기증자와받는 사람 균주는 공역 및 복구 플라스미드에 사용 된 것과 다른 다른 저항을 필요로 프로토콜 전반에 걸쳐 사용되는 여러 항생제가있을 것입니다 것을 기억하는 것이 중요하다.

    여기서 설명한 이외에도 결합 분석 기술에서 그들의 접근법에서 약간 변화 접합을 연구하기 위해 사용되는 다른 방법이있다. 수평 적 유전자 이동은 박테리아 종간받는 포함받는 셀로 플라스미드를 전달하는 과정이다. 44 종간 수평 유전자 전달의 범위를 결정하기 위해 접합을 사용 달 버그 및 예를 들어 동료 (44)에 의해 연구. 그들은 KT 2442 세포로 복제 된 플라스미드에 녹색 형광 단백질 (GFP)의 결합을 활용; 염색체 리터KT 2442 세포에서 교류 I q를 유전자는 GFP 발현을 억제. 플라스미드 반송 GFP가 lac Iq 유전자가없는 종이에 전사되는 경우, 형광이 관찰된다. 다양한 종에서 특정 단백질의 기능을 제공하는 것을 제한에도 불구하고 44은 종간 접합 실험은 아마도 상이한 종간의 단백질 - 단백질 상호 작용을위한 진화 예측을 위해 여기에 제시된 프로토콜에 결합 될 수있다.

    Subscription Required. Please recommend JoVE to your librarian.

    Disclosures

    저자는 더 경쟁 재정적 이해 관계가 없음을 선언합니다.

    Acknowledgments

    이 연구는 캐나다의 자연 과학 및 공학위원회에서 발견 그랜트 (NSERC)에 의해 지원되었다.

    Materials

    Name Company Catalog Number Comments
    GeneJet Plasmid Mini-Prep Kit Fisher Scientific K0503
    GeneJet Gel Extraction Kit Fisher Scientific K0692
    GeneJet PCR Purification Kit Fisher Scientific K0702
    Q5 Site-Directed Mutagenesis Kit New England Biolabs E0554S
    Broad Range DNA Ladder New England Biolabs N0303A
    Petri Dishes Fisher Scientific FB0875713
    Electroporator Eppendorf 4309000027
    Electroporation cuvettes Fisher Scientific FB101 Cuvettes have a 1 mm gap.
    Enzymes
    AvaI New England Biolabs R0152S
    EcoRI New England Biolabs R0101S
    HindIII New England Biolabs R0104L
    NdeI New England Biolabs R0111S
    Phusion DNA Polymerase New England Biolabs M0530L
    T4 DNA Ligase New England Biolabs M0202S
    DpnI New England Biolabs R0176S
    Antibiotics Final Concentrations
    Chloramphenicol (Cm) Fisher Scientific BP904-100 20 µg/mL
    Kanamycin (Km) BioBasic Inc. DB0286 50 µg/mL
    Nalidixic acid (Nal) Sigma-Aldrich N8878-25G 10 µg/mL
    Rifampicin (Rif) Calbiochem 557303 20 µg/mL
    Tetracycline (Tc) Fisher Scientific BP912-100 10 µg/mL
    Streptomycin (Sm) Fisher Scientific BP910-50 50 µg/mL

    DOWNLOAD MATERIALS LIST

    References

    1. Dobrindt, U., Hochhut, B., Hentschel, U., Hacker, J. Genomic islands in pathogenic and environmental microorganisms. Nat Rev Microbiol. 2, (5), 414-424 (2004).
    2. Furuya, E. Y., Lowy, F. D. Antimicrobial-resistant bacteria in the community setting. Nat Rev Microbiol. 4, (1), 36-45 (2006).
    3. Griffiths, A., Miller, J., Suzuki, D., Lewontin, R., Gelbart, W. An Introduction to Genetic Analysis, 7th Edition. W.H. Freeman. San Fransisco. (2000).
    4. Cooper, T. F. Recombination Speeds Adaptation by Reducing Competition between Beneficial Mutations in Populations of Escherichia coli. PLoS Biol. Barton, N. H. 5, (9), 225 (2007).
    5. Lujan, S. A., Guogas, L. M., Ragonese, H., Matson, S. W., Redinbo, M. R. Disrupting antibiotic resistance propagation by inhibiting the conjugative DNA relaxase. Proc Natl Acad Sci. 104, (30), 12282-12287 (2007).
    6. Carattoli, A. Plasmids and the spread of resistance. Int J Med Microbiol. 303, (6-7), 298-304 (2013).
    7. Shala, A., Ferraro, M., Audette, G. F. Bacterial Secretion Systems: Nanomachines for Infection and Genetic Diversity. Handbook of Clinical Nanomedicine: Nanoparticles, Imaging, Therapy and Clinical Applications. Bawa, R., Audette, G. F., Rubenstein, I. Pan Sanford Publishing. Singapore. 657-686 (2016).
    8. Tseng, T. T., Tyler, B. M., Setubal, J. C. Protein secretion systems in bacterial-host associations, and their description in the Gene Ontology. BMC Microbiol. 9, (1), Suppl 1 2 (2009).
    9. Alvarez-Martinez, C. E., Christie, P. J. Biological diversity of prokaryotic type IV secretion systems. Microbiol Mol Biol Rev. 73, (4), 775-808 (2009).
    10. Lawley, T. D., Klimke, W. A., Gubbins, M. J., Frost, L. S. F factor conjugation is a true type IV secretion system. FEMS Microbiol Lett. 224, (1), 1-15 (2003).
    11. Lederberg, J., Tatum, E. L. Gene Recombination in Escherichia Coli. Nature. 158, (4016), 558-558 (1946).
    12. Smillie, C., Garcillan-Barcia, M. P., Francia, M. V., Rocha, E. P. C., de la Cruz, F. Mobility of Plasmids. Microbiol Mol Biol Rev. 74, (3), 434-452 (2010).
    13. Willetts, N., Skurray, R. The Conjugation System of F-Like Plasmids. Annu Rev Genet. 14, (1), 41-76 (1980).
    14. Frost, L. S., Ippen-Ihler, K., Skurray, R. A. Analysis of the sequence and gene products of the transfer region of the F sex factor. Microbiol Rev. 58, (2), 162-210 (1994).
    15. Audette, G. F., Manchak, J., Beatty, P., Klimke, W. A., Frost, L. S. Entry exclusion in F-like plasmids requires intact TraG in the donor that recognizes its cognate TraS in the recipient. Microbiology. 153, Pt 2 442-451 (2007).
    16. Christie, P. J., Atmakuri, K., Krishnamoorthy, V., Jakubowski, S., Cascales, E. Biogenesis, Architecture, and Function of Bacterial Type Iv Secretion Systems. Annu Rev Microbiol. 59, (1), 451-485 (2005).
    17. Christie, P. J. Type IV secretion: the Agrobacterium VirB/D4 and related conjugation systems. Biochim Biophys Acta - Mol Cell Res. 1694, (1-3), 219-234 (2004).
    18. Bhatty, M., Laverde Gomez, J. a, Christie, P. J. The expanding bacterial type IV secretion lexicon. Res Microbiol. 164, (6), 620-639 (2013).
    19. Christie, P. J., Cascales, E. Structural and dynamic properties of bacterial Type IV secretion systems (Review). Mol Membr Biol. 22, (1-2), 51-61 (2005).
    20. Christie, P. J. Type IV secretion: Intercellular transfer of macromolecules by systems ancestrally related to conjugation machines. Mol Microbiol. 40, (2), 294-305 (2001).
    21. Christie, P. J., Whitaker, N., González-Rivera, C. Mechanism and structure of the bacterial type IV secretion systems. Biochim Biophys Acta. 1843, (8), 1578-1591 (2014).
    22. Cascales, E. The type VI secretion toolkit. EMBO Rep. 9, 735 (2008).
    23. Silverman, J. M., Brunet, Y. R., Cascales, E., Mougous, J. D. Structure and Regulation of the Type VI Secretion System. Annu Rev Microbiol. 66, (1), 453-472 (2012).
    24. Chandran, V., et al. Structure of the outer membrane complex of a type IV secretion system. Nature. 462, (7276), 1011-1015 (2009).
    25. Rivera-Calzada, A., et al. Structure of a bacterial type IV secretion core complex at subnanometre resolution. EMBO J. 32, (8), 1195-1204 (2013).
    26. Waksman, G., Fronzes, R. Molecular architecture of bacterial type IV secretion systems. Trends Biochem Sci. 35, 691 (2010).
    27. Fronzes, R., Christie, P. J., Waksman, G. The structural biology of type IV secretion systems. Nat Rev Microbiol. 7, (10), 703-714 (2009).
    28. Kaplan, M., et al. Probing a cell-embedded megadalton protein complex by DNP-supported solid-state NMR. Nat Methods. 12, (7), 5-9 (2015).
    29. Guyer, M. S., Reed, R. R., Steitz, J. A., Low, K. B. Identification of a sex-factor-affinity site in E. coli as gamma delta. Cold Spring Harb Symp Quant Biol. 45, Pt 1 135-140 (1981).
    30. Anthony, K. G., Sherburne, C., Sherburne, R., Frost, L. S. The role of the pilus in recipient cell recognition during bacterial conjugation mediated by F-like plasmids. Mol Microbiol. 13, (6), 939-953 (1994).
    31. Jobling, M. G., Holmes, R. K. Construction of vectors with the pl5a replicon, kanamycin resistance, inducible lacZα and pUC18 or pUC19 multiple cloning sites. Nucleic Acids Res. 18, (17), 5315 (1990).
    32. Guzman, L. M., Belin, D., Carson, M. J., Beckwith, J. Tight regulation, modulation, and high-level expression by vectors containing the arabinose P(BAD) promoter. J Bacteriol. 177, (14), 4121-4130 (1995).
    33. Yu, D., et al. An efficient recombination system for chromosome engineering in Escherichia coli. Proc Natl Acad Sci U S A. 97, (11), 5978-5983 (2009).
    34. Lawley, T. D., Gilmour, M. W., Gunton, J. E., Standeven, L. J., Taylor, D. E. Functional and Mutational Analysis of Conjugative Transfer Region 1 (Tra1) from the IncHI1 Plasmid R27. J Bacteriol. 184, (8), 2173-2180 (2002).
    35. Elton, T. C., Holland, S. J., Frost, L. S., Hazes, B. F-Like Type IV Secretion Systems Encode Proteins with Thioredoxin Folds That Are Putative DsbC Homologues. J Bacteriol. 187, (24), 8267-8277 (2005).
    36. Hazes, B., Frost, L. Towards a systems biology approach to study type II/IV secretion systems. Biochim Biophys Acta. 1778, 1839-1850 (2008).
    37. Lento, C., Ferraro, M., Wilson, D., Audette, G. F. HDX-MS and deletion analysis of the type 4 secretion system protein TraF from the Escherichia coli F plasmid. FEBS Lett. Tsolis, R. 590, (3), 376-386 (2016).
    38. Audette, G. F., Van Schaik, E. J., Hazes, B., Irvin, R. T. DNA-binding protein nanotubes: Learning from nature's nanotech examples. Nano Lett. 4, 1897-1902 (2004).
    39. Harris, R. L., Silverman, P. A. Tra proteins characteristic of F-like type IV secretion systems constitute an interaction group by yeast two-hybrid analysis. J Bacteriol. 186, (16), 5480-5485 (2004).
    40. Moore, D., et al. Characterization of the F-Plasmid Conjugative Transfer Gene traU. J Bacteriol. 172, (8), 4263-4270 (1990).
    41. Anthony, K. G., Sherburne, C., Sherburne, R., Frost, L. S. The role of the pilus in recipient cell recognition during bacterial conjugation mediated by F-like plasmids. Mol Microbiol. 13, (6), 939-953 (1994).
    42. Klimke, W. A., Frost, L. S. Genetic analysis of the role of the transfer gene, traN, of the F and R100-1 plasmids in mating pair stabilization during conjugation. J Bacteriol. 180, (16), 4036-4043 (1998).
    43. Jiang, W., Marraffini, L. A. CRISPR-Cas: New Tools for Genetic Manipulations from Bacterial Immunity Systems. Annu Rev Microbiol. 69, (1), 209-228 (2015).
    44. Dahlberg, C., Bergstrom, M., Andreasen, M., Christensen, B. B., Molin, S., Hermansson, M. Interspecies bacterial conjugation by plasmids from marine environments visualized by gfp expression. Mol Biol Evol. 15, (4), 385-390 (1998).

    Comments

    0 Comments


      Post a Question / Comment / Request

      You must be signed in to post a comment. Please or create an account.

      Usage Statistics