מבחני מזווג Conjugative עבור ניתוח רצף ספציפי של חלבוני העברה מעורבים קוניוגציה

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Erdogan, F., Lento, C., Yaseen, A., Nowroozi-Dayeni, R., Kheyson, S., Audette, G. F. Conjugative Mating Assays for Sequence-specific Analysis of Transfer Proteins Involved in Bacterial Conjugation. J. Vis. Exp. (119), e54854, doi:10.3791/54854 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

העברת גנים והחלבונים ברמת המיקרו-האורגניזם משחקת תפקיד מרכזי הישרדות חיידקים ואבולוציה וכן תהליכי דלקת. חילופי DNA בין חיידקים או בין חיידק לתא יכולים להיות מושגים באמצעות תמרת טרנספורמציה, נטייה או וקטור. 1,2 הצמיד הוא ייחודי בהשוואה לטרנספורמציה התמרה ב שבמהלך הנטייה בין חיידקים גראם שלילית כגון Escherichia coli, העברת הד.נ.א מתרחשת באופן תורם שבשליטה לפיה מערכת מולקולארית מורכבת מתחברת תאים תורמים ומקבל. הצמיד הוא גם הדרך הישירה ביותר שבו תאי חיידקיים אינטראקציה עם תאים מארחים להזריק גנים, חלבונים או כימיקלים למערכות מארחות. 3 לעתים קרובות, העברת סוכנים כאלה יש השפעות מדהימות במארח, החלו בפתוגנזה ו סרטן לארח אבולוציה והתאמה. הוכח כי recombinatio conjugativen מגדיל את השיעור של פי 3 הסתגלות בחיידקים עם קצב מוטציות גבוה בתנאים של לחץ סביבתי. 4 יתר על כן, נטייה היא רחוק המסלול הנפוץ ביותר שדרכו גנים עמידים לאנטיביוטיקה ב זני חיידקים מפוזרים. 5,6

מיקרואורגניזמים התפתחו מערכות הפרשה מיוחדות כדי תומכים בטרנספר של מקרומולקולות על פני קרום תא; יש כיום 9 סוגים של מערכות הפרשת (TSSs) בחיידקים גרם שליליים כי תוארו: T1SS, T2SS, T3SS, T4SS, T5SS, T6SS, T7SS, כמו גם ה- SEC (הפרשת) ו טאט (שני-ארגינין טרנסלוקציה) מסלולים. סוג 7,8 כל אחד מערכת הפרשת מחולק נוסף לתוך תת שונים, הכרח בשל מגוון של חלבונים וייחודו של מסלולים הנוגעים בדבר, על זני חיידקים שונים. לדוגמה, במערכת הפרשת סוג IV (T4SS), מערכות Ti ו CAG להקל התחבורה מפעיל ואילו F-פלסמיד, R27nd pKM101 T4SSs להקל על העברת פלסמיד conjugative. 7,9,10 הבנה מפורטת של המנגנונים שבאמצעותם אורגניזמים להרכיב מערכות ההפרשה שלהם מחלבוני הרכיב שלהם ולשתף תכנים סלולריים עם נמען או בסביבתם הקרובה מהווה גורם חשוב בהתפתחות של אסטרטגיות ממוקדות כדי להילחם מיקרואורגניזמים פתוגניים תהליכים של זיהום הסלולר.

בעקבות קוניוגציה זיהוי הראשונית ב E. coli על ידי לדרברג & טאטום, 11 מספר גדול של פלסמידים ניידים conjugative זוהה ואופיין. 12 פלסמידים ניידים כזה להראות מגוון רב הוא גודל (מ -1 עד מעל 200 kilobases (KB)), אולם כל פלסמידים הניידים מכילים relaxase, המכיר את המקור של העברה (אורית) ובכך מאפשר העברת הפלסמיד. פלסמידים Conjugative גנים לקודד נוספים להרכבה של T4SS פונקציונלי כמו גם סוגIV חלבון צימוד. 12 לדוגמה פלסמיד F 100 kb של E. coli מקודד כל הגנים conjugative בתוך אזור 33.3 kB העברה (tra). 13 הגנים באזור tra של לקודד פלסמיד F כל החלבונים המאפשרים היווצרות pilus, הזדווגות זוג היווצרות (MPF), העברת דנ"א פונקציות הדרה במהלך העברת פלסמיד conjugative. 10,14,15 גוף ידע משמעותי זמין עבור T4SSs conjugative, אולם כמפורט מחקרים מבניים של חלבונים מתחמי conjugative נעשים זמינים רק ולאחרונה. 16 - 28

כדי להרכיב תמונה מקיפה של תהליך conjugative, צימוד של מחקרים מבניים מפורטים מוטציוני ניתוחים של חלבוני הובלת conjugative נדרש. זו יכולה להיות מושגת באמצעות מבחני הזדווגות conjugative. עבור פלסמיד F, כל חלבון המקודד בתוך האזור tra ממלא תפקיד שיתוף F בתיווךnjugation; ולכן, בנוקאאוט / מחיקה של גן ההעברה יהיה לבטל את קיבולת conjugative של התא (איור 1). בעוד פלסמידים ניידים קטנים יותר יעילים הליכי מחיקה סטנדרטיים עבור פלסמידים conjugative גדולים כגון F, נוקאאוט גנטי מושגות בקלות רבה יותר באמצעות רקומבינציה הומולוגי שבו גן המטרה הוחלף שינוע אחד גן עמידות לאנטיביוטיקה ברור. בפרוטוקול הנוכחי, אנו מעסיקים הומולוגיים להחליף גן העברת עניינים עם acetyltransferase chloramphenicol (CAT) פלסמיד F 55 kb נגזרת pOX38-Tc; 29,30 הפלסמיד בנוקאאוט כתוצאה, pOX38-Tc Δgene :: ס"מ, הופך לפשוט התנגדות לנוכחות של chloramphenicol (ס"מ) בתקשורת צמיחה. תאים תורמים מחסת pOX38-Tc Δgene :: סנטימטר אינם מסוגלים להשפיע העברת DNA conjugative / הזדווגות כפי שנצפה דרך השימוש של assay הזדווגות; את היעילות ההזדווגות של תא תורם pOX38-Tc Δgene :: ס"מ RECIP נורמליient יקטן או, לעתים קרובות יותר, יבוטל. העברת Conjugative של פלסמיד pOX38-Tc Δgene :: הסנטימטר ניתן לשחזר באמצעות פלסמיד התאוששות קטן מחסת גן ההעברה הממוקדת. פלסמיד התאוששות זו יכולה להיות אחת המספקת ביטוי המכונן, כגון pK184 פלסמיד (pK184-גן), 31 או אחד המספק ביטוי מושרה כל עוד פלסמיד כראוי מטרות הגן אל המיקום הנכון בתוך התא (הציטופלסמה או periplasm). כתוצאה מכך, מבחני ההזדווגות בין התורם החדש הזה (מחסה pOX38-Tc Δgene :: ס"מ + פלסמידים pK184-גן) תא לבין נמען, את יעילות ההזדווגות צפויה להחזיר כמעט לזה של assay הזדווגות תורם למקבל נורמלי. מערכת זו מאפשרת לחקור את הפונקציה של הגן בנוקאאוט דרך דור של סדרה של מבנים-גן pK184 (מחיקות או מוטציות נקודתיות) ובדיקה בכל היכולת לבנות כדי לשחזר את יכולת ההזדווגות של טיפוח pOX38-Tc Δgene :: ס"מ תא תורםים.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

דור 1. של בונת DNA

  1. עיצוב oligomers עבור הומולוגיים רקומבינציה של גן המטרה
    1. עיצוב oligomer 55-72 נ"ב קדימה יחיד כדלקמן: (א) לבחור רצף נוקליאוטידים ארוך 19-32 נ"ב כי הוא הומולוגיים לרצף DNA של BP באזור 10-100 במעלה הזרם של האתר התחלה '5 של הגן acetyltransferase chloramphenicol פלסמיד pBAD33 המסחרי, 32 ו (ב) לבחור הומולוגי רצף נוקליאוטידים ארוך 36-54 נ"ב לאזור 10-150 נ"ב במורד זרם של האתר התחלה '5 של גן המטרה של עניין.
      1. הצטרפו 'סוף רצף נוקליאוטידים הרים ב (ב) על 5' 3 סוף נוקלאוטיד רצף הרים ב (א), ובכך לתת oligomer קדימה יחיד 55-72 ארוך.
    2. עיצוב oligomer ההפוכה יחידה 55-72 נ"ב כדלקמן: (א) לבחור רצף נוקליאוטידים ארוך 19-32 נ"ב כי הוא הומולוגי לרצף DNA של BP באזור 10-100 במורד זרםשל 3 'סוף גן chloramphenicol פלסמיד pBAD33 המסחרי, ו- (ב) לבחור הומולוגי רצף נוקליאוטידים ארוך 36-54 נ"ב לאזור בתוך 10-150 נ"ב במעלה זרם של 3' באתר סוף גן היעד של עניין .
      1. הצטרפו 'סוף רצף נוקליאוטידים הרים ב (ב) על 5' 3 סוף נוקלאוטיד רצף הרים ב (א) כדי להפוך אותו oligomer יחיד.
      2. העתק oligomer זה לתוך זמינה כל תוכנה ביואינפורמטיקה להמיר רצף לתוך השלמה ההפוכה שלה. זה ייתן oligomer הפוכה ארוכה אחת 55-72 נ"ב.
    3. באמצעות כל תוכנית אוליגו-מנתח זמין, לבדוק כי oligomers רקומבינציה יש תוכן GC בין 40-60%, טמפרטורת ההתכה סיכת ראש נמוך (T מ '), עצמי נמוך מ T הטרו-dimerization של. להזמין פריימרים עבור סינתזת משלוח מכל חברת הביוטכנולוגיה מועדפת.
  2. הגברה של קלטת CAT מ pBAD33 (ס"מ R
  3. לגדול לילה (O / N, 16-18 שעות) התרבות של תאים DH5α מחסה פלסמיד pBAD33 במרק Lysogeny סטרילי (LB) עם 20 מיקרוגרם / מ"ל ​​chloramphenicol (ס"מ) עם רועד ב 200 סל"ד ו -37 מעלות צלזיוס.
  4. צנטריפוגה 6-8 מ"ל של התרבות O / N בטמפרטורת החדר, 5000 XG במשך 3 דקות. למזוג supernatant ולחלץ את הפלסמיד pBAD33 מן הגלולה באמצעות ערכת מיני-הכנה פלסמיד (לוח חומרים) ופרוטוקול של היצרן.
  5. האם תקציר של DNA פלסמיד pBAD33 ידי הוספת הכיתוב הבא לתוך צינור סטרילי לפי הסדר: נפח מתאים של מים מזוקקים כפול (DDH 2 O) לנפח סופי של 50 μL, 1 מיקרוגרם נפח פלסמיד pBAD33, 5 μL 10x מאגר התגובה אנזים, ו -0.5 μL של אנזים הגבלה avai (RE). לערבב בעדינות על ידי pipetting ולתת התגובה להמשיך במשך שעה 1 ב 37 מעלות צלזיוס. מחממים להשבית את התגובה במשך 20 דקות (דקות) 80מעלות צלזיוס. דגימות חנות ב -20 מעלות צלזיוס למשך לא יותר מ -24 שעות כדי למזער השפלה דביקה-סוף.
  6. הכן agarose 1.2% הפרדת הג'ל על ידי ערבוב 1.2 גרם של agarose עם 100 מ"ל של טה 1x (40 מ"מ טריס, pH 8.5; 20 מ"מ חומצה אצטית; 1 mM EDTA) חיץ בבקבוק 250 מ"ל Erlenmeyer. מחממים מערבולת לפזר לגמרי במיקרוגל. עצור חימום מיד כאשר הנוזל מתחיל לרתוח לערבל את הבקבוק.
    1. מצננים את agarose נוזלי במשך 3 דקות בטמפרטורת החדר בעוד מתערבל, להוסיף 2 μL של 10 מ"ג / מ"ל ​​ברומיד ethidium מערבולת לערבב. יוצקים את agarose לתוך מגש ג'ל במסרק היטב ולאפשר לשמן להתמצק עבור 1 שעות בטמפרטורת החדר. ג'לי חנות ב 4 ° C עד 2 ימי חיץ 1x טה.
  7. מערבבים כל RE לעכל מ 1.2.3 עם 0.2 נפח של צבע טעינת ה- DNA (10 μL של צבע לכל 50 תגובה μL) על ידי pipetting. טען 5 μL של 500 מיקרוגרם / מ"ל ​​סולם ה- DNA לתוך הבאר הראשונה וכל תערובת RE Digest-צבע לתוך אחר גם על אג'ל garose. השתמש 2-3 בארות לטעון כל עוצמת התגובה על הג'ל.
    1. הרץ את הג'ל בקושי שקוע 1x טה חיץ ההפעלה 45-50 V (4.5-5 V / ס"מ) עבור 65 דקות בתוך המכשיר ג'ל אלקטרופורזה.
  8. שימוש ארון UV ותער סטרילי, במהירות לחתוך את הלהקה 2.8 kb המתאים רצף המרצע מן ג'ל כדי למזער את החשיפה UV של DNA. חלץ את ה- DNA מן הפרוסה ג'ל לגזור באמצעות ערכת חילוץ ג'ל (לוח חומרים) על פי פרוטוקול של היצרן.
    הערה: יש להיזהר שלא לחשוף את העור ישירות תחת UV ולטפל גילוח בזהירות.
  9. הגבר את קלטת CAT מופקת 1.2.6 על ידי תגובת שרשרת פולימראז (PCR) באמצעות פריימרים המיועדים ב 1.1 המכילים מסוכך הומולוגי לרצף הגנטי כדי לאפשר הומולוגי. PCR תגובות מוגדרות על קרח באמצעות הנחיות יצרן (לוח חומרים) לפי הסדר הבא:
    1. לתוךצינור סטרילי PCR, להוסיף נפח מתאים של DDH 2 O לנפח סופי של 50 μL, ואחריו 10 μL של חיץ PCR, 1 μL של 10 מ"מ dNTPs, 2.5 μL של פריימר קדימה 10 מיקרומטר, 2.5 μL של 10 מיקרומטר פריימר הפוך , 1-25 ng של DNA תבנית מתוך 1.2.6 ו -0.5 μL של 100 יחידות / פולימראז μL DNA.
    2. הגדרת כביקורת שלילית הנושאת אותם מרכיבים כמו 1.2.7.1 אבל למעט תבנית ה- DNA. השתמש נפח מתאים של DDH 2 O במקום תבנית ה- DNA. הגדרה כביקורת חיובית באמצעות ה- DNA תבנית פריימרים כי הוכחו לעבוד תגובת PCR, כגון אלו המסופקים על כביקורת חיובית על ידי היצרן.
    3. מערבבים את כל תוכן התגובה בעדינות על ידי pipetting.
    4. להגביר באמצעות PCR באמצעות ההגדרות הבאות: denaturation ראשונית למשך 30 שניות על 98 מעלות צלזיוס, 30 מחזורים של denaturation במשך 10 שניות על 98 מעלות צלזיוס, חישול פריימר עבור 20 שניות, הארכה למשך 20 s לכל kilobase של amplicon ב 72 ° C ו סְנַפִּיררחבה אל במשך 10 דקות ב 72 מעלות. חנות דגימות ב -20 ºC.
  10. אשר את גודל ההגברה הנכון באמצעות ג'ל אלקטרופורזה agarose (ראה 1.2.4-1.2.5) באמצעות רק 5 μL של כל תגובה. לטהר את amplicon PCR באמצעות ערכת טיהור PCR ו פרוטוקול של היצרן. חנות מטוהרים DNA ב -20 ºC.
  • הפלסמיד Recovery-גן pK184
    1. עיצוב פריימר קדימה החל 5 שלה "הסוף והולך לכיוון 3 'בסוף לפי הסדר הבא: (א) לאסוף 4 נוקלאוטידים אקראיים (שילוב של אדנין, תימין, גואנין ציטוזין) עבור יעילות מחשוף, מצורפים (ב) אנזים הגבלה EcoRI רצף באתר חתך (RE) (GAATTC), ואחריו (ג) רצף נוקליאוטידים 21-25 נ"ב ארוך כי הוא הומולוגיים עד הסוף '5 של הגן של עניין, כולל קודון ההתחלה. אם גן היעד מכיל אתר EcoRI, לבחור אחר RE המתאים מתוך אתר השיבוט המרובה pK184.
    2. במקרה של הגנים המקודדים חלבונים periplasmic, כולל רצף מנהיג נוסף בין האתר RE ואת קודון ההתחלה על פריימר קדימה.
    3. באמצעות כל-מנתח אוליגו זמין, לבדוק כי יש פריימרים תוכן GC בין 40-60%, מ T סיכת ראש נמוך, עצמית נמוכה מ T הטרו-dimerization של. להזמין פריימרים עבור סינתזה.
    4. לגדול תרבות O / N של תאים DY330R pOX38-Tc ב LB סטרילי המכיל טטרציקלין 10 מיקרוגרם / מ"ל ​​(TC) עם רועד ב 32 ºC ו -200 סל"ד. צנטריפוגה 6-8 מ"ל של התרבות O / N בטמפרטורת החדר, 5000 XG במשך 3 דקות. למזוגsupernatant ו לחלץ את ה- DNA פלסמיד מן הגלולה באמצעות ערכת מיני-הכנה פלסמיד (לוח חומרים) ופרוטוקול של היצרן.
    5. להגביר את הגן מלא עניינים עם פריימרים מ 1.3.1-1.3.5 באמצעות pOX38-Tc כתבנית (ראה 1.2.7.1-1.2.7.3).
    6. אשר את גודל ההגברה הנכון באמצעות ג'ל אלקטרופורזה agarose (ראה 1.2.4-1.2.5) באמצעות רק 5 μL של כל תגובה. לטהר את הדנ"א המוגבר באמצעות ערכת טיהור PCR ו הפרוטוקול של היצרן. חנות מטוהרים DNA ב -20 ° C.
    7. האם תקציר אתגר כפול של ה- DNA פלסמיד pK184 הזמין המסחרי ואת הגן המוגבר (מ 1.3.7.), על ידי הוספת הבאים לתוך צינור סטרילי לפי הסדר: נפח מתאים של DDH 2 O לנפח סופי של 50 μL , נפח 1 מיקרוגרם של פלסמיד pK184, 5 חיץ התגובה μL 10x אנזים, ו 1 μL של כל EcoRI ו HindIII.
      1. לערבב בעדינות על ידי pipetting ולתת התגובה להמשיך במשך שעה 1ב 37 ºC. מחממים להשבית את התגובה במשך 20 דקות ב 80 ºC. דגימות חנות ב -20 מעלות צלזיוס למשך לא יותר מ -24 שעות כדי למזער השפלה דביקה-סוף.
        הערה: הסוג של nuclease ההגבלה משמש כאן תלוי באתר nuclease ההגבלה כי תוכנן לתוך פריימרים בצעדים 1.3.1 ו 1.3.2.
      2. כביקורת חיובית, להגדיר מעכל יחיד של פלסמיד pK184 ידי הכנת אותה התגובה כמו 1.3.8 למעט להוסיף רק אחד המיל לצינור תגובה. האם זה בנפרד עם שני מיל.
    8. הפעל את מעכל על ג'ל agarose 1.2% תוך שימוש בפרוטוקולים 1.2.4-1.2.5 חלץ את הדנ"א הכפול לעכל שברי שניהם pK184 ואת הגן של ריבית לפי לשלב 1.2.6.
    9. ולקשור את הכנס הגן לתוך וקטור pK184 ידי הוספת רכיבים לתוך צינור סטרילי לפי הסדר הבא: 2 μL של 10x הצפת האנזים T4 DNA, על סך של 100 DNA ng מורכב 1: וקטור 3: הכנס (pK184: הגן) יחס, DDH 2 O עדנפח כולל של 20 μL ו 1 אנזים μL T4 DNA. כביקורת שלילית, להקים תגובה דומה באמצעות 100 ננוגרם של וקטור ללא גן הכנס.
      1. בעדינות מערבבים את כל תוכן התגובה באמצעות micropipette דגירה במשך 30 דקות ב 25 מעלות צלזיוס. מחמם להשבית את תגובת הקשירה במשך 10 דקות ב 65 מעלות צלזיוס ולאחר מכן למקם על קרח.
    10. בעוד על הקרח, מוסיפים 15 μL של גנים pK184 תגובת קשירת משלב 1.3.10 100 μL של תאי DH5α מוסמך כימי בתוך שפופרת מיליליטר 1.5 סטרילית. לערבב בעדינות על ידי pipetting ו דגירה על קרח למשך 10 דקות. לעשות את אותו הדבר עבור מדגם הביקורת השלילית. לקבלת כביקורת חיובית, להשתמש 20-100 ng של פלסמיד כגון pBAD33 ולהפכו 50 μL של DHα תאים.
    11. ישירות להעביר את דגימות קרח לתוך אמבט מים C ° 42 ו דגירה במשך 90 שניות. זה מספק את התאים הלם חום ומאפשר להם ספיגת ה- DNA פלסמיד.
    12. המקום התאים בחזרה על קרח למשך עוד5 דקות ולאחר מכן להוסיף 900 ​​μL של LB. סטרילי לדגור על 37 מעלות צלזיוס במשך שעה 1 תוך רועד ב 125 סל"ד.
    13. Aliquot נפח 100 μL של מדגם מתוך כל תגובה קשירת ב 1.3.13 לצלחת אגר המכיל kanamycin 50 מיקרוגרם / מ"ל ​​(ק"מ) ולהפיץ את התאים באמצעות מפזר סטרילי. צלחת הבקרה החיובית צריכה טיפול אנטיביוטי מתאים. שמור על שטח סטרילי ולעבוד ליד להבה. דגירה את הצלחת במהופך לילה 37 ° C.
    14. בעזרת פיפטה או לולאה סטרילי, לקצור מושבה ברורה יחידה של תאים לחסן 20 מיליליטר LB סטרילי עם 50 מיקרוגרם / מיליליטר קילומטר. שמור על שטח סטרילי ולעבוד ליד להבה. לגדל את התאים O / N ב 37 ° C עם רועד ב 200 סל"ד.
    15. הפוך 3-5 מניות גליצרול של תאים DH5α השתנה על-ידי ערבוב 500 μL של התרבות O / N עם 500 μL של גליצרול 100% סטרילי (נ 50% הסופי / v) ושפופרות קריו סטרילי. חנות ב -80 מעלות צלזיוס.
    16. כמו כן צנטריפוגות 6-8 מ"ל של O / תרבות N בטמפרטורת החדר, 5,000 XG במשך 3 דקות. למזוג supernatant ולחלץ את הפלסמיד ההתאוששות-גן pK184 מן הגלולה באמצעות ערכת מיני-הכנה פלסמיד (לוח חומרים) ופרוטוקול של היצרן.
  • pK184 - מוטאנטים גן
    הערה: פריימרים המיועדים מחיקות, הוספות ו / או מוטציות נקודתיות ניתן להפיק בקלות באמצעות הכלים הזמינים באינטרנט היצרנים.
    1. כל עיצוב פריימר קדימה באמצעות בחירת רצף נוקליאוטידים ארוך 18-32 נ"ב כי הוא הומולוגי עד סוף '5 של הגן של עניין, כולל קודון ההתחלה. פריימרים עיצוב כך שכל פריימר קדימה anneals 30-180 נ"ב במורד זרם של אחד הקודם, וכתוצאה מכך מוטנטים מחיקה חסר שברי פפטיד N- מסוף באורכים מתאימים.
    2. עיצוב פריימר הפוך באמצעות בחירת רצף נוקליאוטידים ארוך 18-32 נ"ב כי הוא הומולוגי עד סוף '3 של הגן של עניין כולל קודון העצירה. העתק פריימר זה לתוךהתכנית ביואינפורמטיקה NY הזמינה ולהמיר את הרצף לתוך השלמה ההפוכה שלה. זהו פריימר ההפוכה.
      1. במקרה של הגנים המקודדים חלבונים periplasmic, לעצב את פריימר הפוכה כי הוא המשלים השני של 'סוף רצף מנהיג חביות 5' 3 סוף הגן, והוא נחוץ לצורך לוקליזציה הנכון של המוצר החלבון periplasm.
    3. באמצעות כל תוכנית אוליגו-מנתח זמין, לבדוק כי פריימרים המחיקה יש תוכן GC בין 40-60%, טמפרטורת ההתכה סיכת ראש נמוך (T מ '), עצמי נמוך מ T הטרו-dimerization של. להזמין פריימרים עבור סינתזה המשלוח מ חברת הביוטכנולוגיה כל זמין.
    4. באמצעות מבנה הגן-pK184 שהושגו פרוטוקול 1.3 כתבנית ואת ההנחיות 1.2.7-1.2.8, PCR להגביר את בונה המחיקה עם פריימרים המיועדים בצעדים 1.4.1-1.4.3 ליצור amplicons pK184-גן ΔX . דנ"א מוגבר חנותt -20 ° C.
    5. ולקשור את המבנה המוגבר באמצעות ערכת mutagenesis כל זמין (לוח חומרים).
    6. Transform כל אחד ligates ΔX pK184-הגן בנפרד לתאי DH5α מוסמך כימי באמצעות פרוטוקול הלם חום סטנדרטי (ראה 1.3.11-1.3.13).
    7. Aliquot נפח 100 μL של מדגם מתוך כל תגובת קשירה ב 1.4.12 לצלחת אגרה המכילה 50 מיקרוגרם / מיליליטר קילומטר ולהפיץ את התאים באמצעות מפזר סטרילי. שמור על שטח סטרילי ולעבוד ליד להבה. דגירה את הצלחת במהופך לילה 37 ° C.
    8. בעזרת פיפטה או לולאה סטרילי, לקצור מושבה ברורה יחידה של תאים לחסן 20 מיליליטר תקשורת סטרילי LB עם 50 מיקרוגרם / מיליליטר קילומטר. שמור על שטח סטרילי ולעבוד ליד להבה. לגדל את התאים O / N ב 37 ° C עם רועד ב 200 סל"ד.
    9. הפוך 3-5 מניות גליצרול של תאים DH5α השתנה על-ידי ערבוב 500 μL של התרבות O / N עם 500 μL של גליצרול 100% סטרילי (f50% Inal v / v) ב קריו-צינורות סטרילית. חנות ב -80 מעלות צלזיוס.
    10. צנטריפוגה 6-8 מ"ל של התרבות O / N בטמפרטורת החדר, 5000 XG במשך 3 דקות. למזוג supernatant ולחלץ את הפלסמיד ΔX גן pK184 לבנות מן הגלולה באמצעות ערכת מיני-הכנה פלסמיד (לוח חומרים) ופרוטוקול של היצרן. דנ"א חנות ב -20 מעלות צלזיוס.
  • הדור 2. pOX38-Tc Δgene :: ס"מ זנים

    1. DY330R pOX38-Tc Δgene :: knockouts ס"מ
      1. הכן תרבות O / N של תאים DY330R pOX38-Tc ב 10 מ"ל סטרילי LB המכיל 10 מיקרוגרם / מ"ל ​​Tc. לגדול בתרבות O / N ב 32 מעלות צלזיוס, 200 סל"ד.
      2. בצע 1:70 דילול של התרבות O / N לתוך 20 מ"ל של LB. סטרילי טרי לגדל את התאים ב 32 מעלות צלזיוס עד אמצע יומן שלב (OD 600nm 0.4-0.6) צמיחה.
      3. העברת 10 מ"ל של התרבות בבקבוק סטרילי לדגור על 42 מעלות צלזיוס במשך 15 דקות ב 150 סל"ד בתוך ba מים רועדה. זה יניע את הביטוי של חלבונים ספציפיים רקומבינציה DY330R.
      4. צ'יל התרבות באמבט מי קרח למשך 10 דקות. כן תאי electrocompetent כדלקמן.
        1. העברת התאים הצוננים לתוך צינורות חרוטים מראש צוננים צנטריפוגות ב 4000 XG במשך 7 דקות ב 4 ºC. כל הצינורות טפטפות כדי לשמש השלבים הבאים צריכים להיות ממוקמים על 4 מעלות צלזיוס או על קרח כדי לקרר.
        2. הסר את supernatant בעדינות resuspended התאים 1 מ"ל של DDH קר כקרח 2 O. הוסף עוד 30 מ"ל של DDH קרים כקרח 2 O.
        3. צנטריפוגה התאים (4,000 XG, 7 דקות, 4 ° C), לבטל את supernatant בעדינות resuspended התאים 1 מ"ל של DDH קר כקרח 2 O.
        4. העברת התאים resuspended לתוך 1.5 מראש צונן צינורות מ"ל microfuge צנטריפוגות ב 15,000 XG דקות 1 ב 4 ºC.
        5. בעדינות resuspended גלולה ב 200 μL של DDH קר כקרח 2 O ו aliquot ב -50 כרכים μL. Electrocompeteניתן לאחסן תאי NT ב -80 ° C
      5. להוסיף 300 ננוגרם של קלטת CAT המוגברת של 1.2 לתוך 50 μL של תאי electrocompetent DY330R pOX38-Tc תוך ערבוב על קרח, בעדינות על ידי pipetting למעלה ולמטה. חזור על שלב זה באמצעות פלסמיד ללא שינוי pBAD33 כביקורת חיובית.
      6. העברת התאים קובט electroporation מראש מקורר (-20 ° C) 1 מ"מ. Electroporate התאים ב 1.8 קילו וולט עם זמן קבוע של 5.5 מילי-שניות, באמצעות electroporator. מיד לאחר החלת הדופק, לדלל את התאים עם 1 מ"ל של SOC התקשורת ולהעביר לצינור microfuge טריים. דגירת התאים ב 32 מעלות צלזיוס למשך 2 שעות.
      7. Aliquot 100 μL של כל דגימה על צלחות אגר המכיל 10 מיקרוגרם / מ"ל ​​Tc ו -20 מיקרוגרם / מ"ל ​​ס"מ להפיץ באמצעות מפזר סטרילי. שמור על שטח סטרילי ולעבוד ליד להבה. דגירה את הצלחת במהופך לילה C 32 ° לבחור עבור recombinants המוצלח. קלטת CAT מוחדרת התא חייב לעבור מחדש הומולוגייםבשילוב עם הגן של עניין וליצור ס"מ DY330R pOX38-Tc Δgene :: (הרי"ף R, Tc R, Cm R) שיבוט.
        הערה: חשוב לגדל תאי DY330R על 32 מעלות צלזיוס, למעט אינדוקצית 15 דקות ב 42 ° C של שלב 2.1.3 לפני יוצרות תאי electrocompetent, כמו צמיחה ממושכת בטמפרטורות גבוהות סיכוני מוות של תאים עקב הייצור מוצרים רעילים של מן אופרון p L אחראי על פונקציות רקומבינציה DY330R. 33,34
      8. הכן O / N של DY330R pOX38-Tc Δgene :: תאים ס"מ על קצירת מושבה מובחנת תאים אחת עם טפטפת או לולאה סטרילי, וכך גם יחסנו מדיה 20 מ"ל סטרילי LB עם 10 מיקרוגרם / מ"ל ​​Tc, ו -20 מיקרוגרם / מ"ל ס"מ. שמור על שטח סטרילי ולעבוד ליד להבה. לגדל את התאים O / N ב 32 ° C עם רועד ב 200 סל"ד.
      9. הפוך 3-5 מניות גליצרול מן O / N ידי ערבוב 500 μL של התרבות O / N עם 500 μL של GL סטרילי 100%ycerol (נ 50% הסופי / v) צינורות-קריו סטרילי. חנות ב -80 מעלות צלזיוס.
      10. צנטריפוגה 6-8 מ"ל של התרבות O / N בטמפרטורת החדר, 5000 XG במשך 3 דקות. למזוג supernatant ולחלץ ס"מ pOX38-Tc Δgene :: לבנות מן הגלולה באמצעות ערכת מיני-הכנה פלסמיד (לוח חומרים) ופרוטוקול של היצרן; לאחסן DNA מטוהרים ב -20 ° C.
      11. בצע assay ההזדווגות conjugative באמצעות XK1200 תאים כמקבל לאשר שיבוש נטיה ידי נוקאאוט גנטי לפי פרוטוקול 3.1.
    2. DY330R pOX38-Tc Δgene :: ס"מ + pK184-גן
      1. משנים תאים DY330R pOX38-Tc Δgene :: ס"מ electrocompetent עם 300 ננוגרם של לבנות pK184-גן דרך electroporation לפי שלבים 2.1.4-2.1.7. כל התקשורת סלקטיבית חייב לכלול 20 מיקרוגרם / מ"ל ​​ס"מ ו 50 מיקרוגרם / מ"ל ​​ק"מ. לדגור על C ° 32. הפלסמיד התאוששות תאי electroporated כעת ישחזר את הפונקציה של הגן בנוקאאוט DY330R pOX38-Tc Δgene :: תאים ס"מ.
      2. כן O / N של DY330R pOX38-Tc Δgene :: תאי רקומביננטי הסנטימטר + pK184-גן על ידי קצירת מושבה ברורה יחידה של התאים עם טפטף או לולאה סטרילי, וכך גם ייחסת מדיה 20 המ"ל סטרילי LB עם 20 מיקרוגרם / מיליליטר סנטימטר ו -50 מיקרוגרם / מ"ל ​​ק"מ. שמור על שטח סטרילי ולעבוד ליד להבה. לגדל את התאים O / N ב 32 ° C עם רועד ב 200 סל"ד.
      3. הפוך 3-5 מניות גליצרול מן O / N ידי ערבוב 500 μL של התרבות O / N עם 500 μL של גליצרול 100% סטרילי (נ 50% הסופי / v) ושפופרות קריו סטרילי. חנות ב -80 מעלות צלזיוס.
      4. כמו כן לבצע פרוטוקול 3.1 כדי ליצור XK1200 pOX38-Tc Δgene :: ס"מ תאים רקומביננטי.
    3. XK1200 pOX38-Tc Δgene :: ס"מ + pK184-גנים מוטאנטים
      1. כן תאי XK1200 pOX38-Tc Δgene :: סנטימטר electrocompetent (משלב 2.2.4).
      2. בנפרד electroporate 300 ננוגרם של פלסמידים מוטציה pK184-גן או pK184-גן לתוך 50 μL של electrocompetent XK1200 pOX38-Tc Δgene :: תאים ס"מ לפי שלבים 2.1.4-2.1.7. כל התקשורת סלקטיבית צריכה להכיל חומצת nalidixic 10 מיקרוגרם / מיליליטר (סופית), 20 מיקרוגרם / מיליליטר סנטימטר, ו -50 מיקרוגרם / מיליליטר קילומטר ולהיות וטופחה על 37 מעלות צלזיוס.
      3. כן O / N של XK1200 pOX38-Tc Δgene :: תאי רקומביננטי הסנטימטר + pK184-גן על ידי קצירת מושבה ברורה יחידה של התאים עם טפטף או לולאה סטרילי, וכך גם ייחסת מדיה 20 המ"ל סטרילי LB עם מאיץ לאומי, 20 מיקרוגרם / מיליליטר ס"מ ו -50 מיקרוגרם / מ"ל ​​ק"מ. שמור על שטח סטרילי ולעבוד ליד להבה. לגדל את התאים O / N ב 37 ° C עם רועד ב 200 סל"ד.
      4. הפוך 3-5 מניות גליצרול מן O / N ידי ערבוב 500 μL של התרבות O / N עם 500 μL של גליצרול 100% סטרילי (נ 50% הסופי / v) ושפופרות קריו סטרילי. חנות ב -80 מעלות צלזיוס.

    3. מבחני מזווג Conjugative

    1. Conjugative הזדווגות כדי ליצור XK1200 pOX38-Tc Δgene :: ס"מ תאים
      1. הכן 20 מ"ל סטרילי LB O / מבוי סתום Nture של DY330R pOX38-Tc Δgene :: תאים ס"מ + pK184-גן באמצעות פיפטה או לולאה סטרילי כדי לחסן 20 מ"ל סטרילי LB המכיל 20 מיקרוגרם / מ"ל ​​ס"מ ו 50 מיקרוגרם / מ"ל ​​ק"מ עם מלאי גליצרול או מושבה אחת על צלחת אגרה. לגדול ב 32 ° C עם רועד ב 200 סל"ד. הכן את אותו הדבר עבור XK1200 תאים 20 המ"ל סטרילי LB עם 10 מיקרוגרם / מיליליטר סופי, גדל ב 37 מעלות צלזיוס.
      2. הפוך 1:70 דילולים של כל תרבות בנפרד 2 מ"ל של LB סטרילי עם אותו תוכן אנטיביוטיקה; להוסיף גלוקוז לריכוז סופי של 100 מ"מ לכל תאי התורם. לגדל תאים לשלב יומן אמצע (OD 600 0.5-0.7) על 37 מעלות צלזיוס עם רועד ב 200 סל"ד.
      3. צנטריפוגה (4,000 XG במשך 5 דקות ב 4 ° C) עד גלולה התאים, להשליך supernatant, ולשטוף פעם עם LB סטרילי קר להסיר אנטיביוטיקה, ותאי resuspend ב 2 מ"ל LB. סטרילי קר
      4. Aliquot 100 μL של כל תרבות לתוך 800 μL של התקשורת LB סטרילי ולאפשר להם להזדווג על 32 מעלות צלזיוס במשך שעה 1 בלי לרעוד.
      5. <li> וורטקס התאים למשך 30 שניות כדי לשבש את זוגות ההזדווגות ומניחים אותם על קרח למשך 10 דקות כדי למנוע הזדווגות נוספת.
      6. Aliquot 100 μL של תערובת התאים על צלחת אגרה המכילה 10 מיקרוגרם / מיליליטר סופי ו -20 מיקרוגרם / מיליליטר סנטימטר כדי לבחור עבור XK1200 pOX38-Tc Δgene :: תאי סנטימטר. מורחים את התאים באמצעות מפזר סטרילי. שמור על שטח סטרילי ולעבוד ליד להבה. וטופח הצלחת O / N ב 37 ° C-במהופך.
      7. קציר מושבה אחת של הגן XK1200 pOX38-Tc Δ חדש :: ס"מ זן בנוקאאוט בעזרת פיפטה או לולאה סטרילי ולגדול LB סטרילי עם 20 מיקרוגרם / מ"ל ​​ס"מ, O / N ב 37 ° C עם רועד ב 200 סל"ד. הפוך 3-5 מניות גליצרול מן O / N ידי ערבוב 500 μL של התרבות O / N עם 500 μL של גליצרול 100% סטרילי (נ 50% הסופי / v) ושפופרות קריו סטרילי. חנות ב -80 מעלות צלזיוס.
        הערה: התאים כתוצאה מסוגלים עכשיו להתבצע מוסמכות לטרנספורמציה עם הבונה-גן pK184 (פרוטוקולי 1.3 ו -1.4) עבור תחתessing הגן מוטנטים שלו על היכולת לשחזר העברת conjugative בפרוטוקול 3.2.
    2. Conjugative Assay הזדווגות מ XK1200 תורמים לנמענים MC4100
      1. הכן O / תרבות N של XK1200 pOX38-Tc Δgene :: ס"מ + pK184-גן התאים 20 מ"ל של LB סטרילי עם 20 מיקרוגרם / מ"ל ​​ס"מ, 50 מיקרוגרם / מ"ל ​​ק"מ ותאי MC4100 ב 5 מ"ל LB עם 50 מיקרוגרם / מ"ל ​​סטרפטומיצין (SM) התאים באמצעות ממלאי גליצרול או מושבה אחת על צלחת אגר וסטרילי פיפטה או לולאה. לגדול תרבויות ב 37 ° C עם 200 סל"ד רועד.
      2. הפוך 1:70 דילולים מכל תרבות O / N בנפרד 2 מ"ל של LB סטרילי עם אותה אנטיביוטיקה. להוסיף גלוקוז לריכוז סופי של 100 מ"מ לכל תאי התורם. לגדל תאים לשלב יומן אמצע (OD 600 0.5-0.7) על 37 מעלות צלזיוס עם רועד ב 200 סל"ד.
      3. צנטריפוגה (4,000 XG במשך 5 דקות ב 4 ° C) עד גלולת תאים, להשליך supernatant, ולשטוף פעם עם LB סטרילי קר להסיר antibioטיקים, ותאי resuspend ב 2 LB. סטרילי קר מ"ל
      4. בשני עותקים, aliquot 100 μL של כל תרבות לתוך 800 μL של התקשורת LB סטרילי ולאפשר להם להזדווג על 37 מעלות צלזיוס במשך שעה 1 בלי לרעוד.
      5. וורטקס התאים למשך 30 שניות כדי לשבש את זוגות ההזדווגות ומניחים אותם על קרח למשך 10 דקות כדי למנוע הזדווגות נוספת.
      6. שימוש תרבויות יומן אמצע משלב 3.2.2 ו LB סטרילי טרי, להכין 6 דילולים סדרתי של תאים התורם והמקבל מ 10 -2 עד 10 -7.
      7. על כל אחד משני חצי צלחת אגרה המכילה 10 מיקרוגרם / מיליליטר סופי, 20 מיקרוגרם / מיליליטר סנטימטר ו 50 מיקרוגרם / מיליליטר קילומטר, במקום 10 aliquots μL של כל דילול XK1200 תאים תורמים, כפי שמוצג באיור 2. חזור על דילולים של תאים MC4100 הנמען על צלחות אגר המכיל 50 מיקרוגרם / מ"ל ​​Sm. דגירה צלחות O / N ב 37 מעלות צלזיוס.
      8. באמצעות תערובת vortexed משלב 3.2.5 LB סטרילי טרי, להכין 6 דילולים (10 -2 עד 10 -7 באיור 2. חזור על פעולה עבור שני תערובות כפולות. שמור על שטח סטרילי ולעבוד ליד להבה. דגירה צלחות O / N ב 37 מעלות צלזיוס.
      9. לקבוע את יעילות ההזדווגות של כל מבנה כמתואר בפרוטוקול 3.3.
      10. חזור על פרוטוקול זה עבור כל פלסמידים ההתאוששות כדי להעריך את ההשפעה של מוטציה מסוימת על היעילות של נטייה.
    3. חישוב יעיל הזדווגות
      1. ספירת מושבות מאותה תצפית דילול לכל תאי תורם, נמען transconjugant על הצלחות שלהם.
      2. רוזן מושבות נמען לבדוק הטיות, שהיה נובעות שיש מספר גדול יותר של transconjugants מ נמענים כי הדילול נתון.
      3. Calculate את יעילות ההזדווגות כמספר מושבות transconjugant חלקות מספר מושבות תורמות. כפל על ידי 100 כדי לקבל את הערך יעיל ל -100 תאים תורמים.

    Subscription Required. Please recommend JoVE to your librarian.

    Representative Results

    תהליך קוניוגציה מונחה פלסמיד F הוא תהליך מתואם המערבת חלבוני הובלה בתוך אזור tra של ה- F-פלסמיד כי מרכיב T4SS כדי להקל סינתזת pilus והעברת DNA conjugative. החלבון traf (ההצטרפות GenBank # BAA97961; UniProt מזהה P14497) דרושה להיווצרות F-pilus conjugative. 10,14,35 - 37 החלבון מכיל תחום בטרמינל C- כמו-thioredoxin, אם כי אין לו מוטיב CXXC קטליטי. 35,38 למרות כבר חזה את זה כדי אינטראקציה עם חלבון TraH דרך תחום N- מסוף שלה, 39 אזור מוצג להיות דינמי יותר המושלם C- מסוף שלה, 37 לא הרבה יותר מזה ידוע על התכונות המבניות של החלבון. כדי להעריך את ההיבטים הפונקציונליים של החלבון traf בשיתוף עם מחקרים מבניים, אנחנו הראשונים כדי לסלק את הגן traf על pOX38-Tc באמצעות הומולוגייםרקומבינציה, יצירת פלסמיד ס"מ pOX38-Tc ΔtraF :: (טבלה 1) בתאים DY330R E. coli. 33,34 כן שנוצר היה פלסמיד pK184-traf מ פריימרים -specific traf (טבלה 2) כדי לספק התאוששות של נטיה ולאפשר חיטוט רצף של החלבון. העברת הפלסמיד pOX38-Tc ΔtraF :: ס"מ לתוך XK1200 תאים 40 מתאי DY330R כאשר pK184-traf סופק טרנס (transconjugants גדל על 10 מיקרוגרם / מ"ל הסופית, 10 מיקרוגרם / מ"ל Tc ו -20 מיקרוגרם / מ"ל ס"מ) עולה כי (א) בנוקאאוט traf ב pOx38-Tc ΔtraF :: ס"מ מספק קלטת CAT בתוך מסגרת, ו (ב) כי pK184-traf יכול לשקם את תפקוד conjugative.

    סדרה של מוטציות traf נוצרו לניתוח באמצעות assay ההזדווגות conjugative 37 באמצעות XK1200 pOX38-Tc ΔtraF :: ס"מ + pK184-traf ΔXתאים ותאי MC4100 41 כתורמים ומקבלים, בהתאמה. מוטציה נציג אחד הוא traf 55-247 (טבלה 1), גידול מוטציה המחיקה N-terminal שמסירה את האזור של חלבון צפוי אינטראקציה עם TraH. כאשר החלבון באורך מלא traf מסופק על התאים התורמים, העברת conjugative משוחזרת (איור 2), תוך מתן pK184 פלסמיד ריק לא (לוח 3). בדומה לכך, פונקצית conjugative בתאים התורמים XK1200 אינה מתחדשת כאשר מסופקות עם פלסמיד pK184-traf 55-247 (לוח 3). זה מצביע על כך שהאזור הקטוע של החלבון חשוב לתפקוד של traf בתוך המנגנון conjugative, סביר באמצעות אינטראקציה עם TraH, ומספק באזור של החלבון למקד עבור ניתוח מוטאציות נוסף.

    איור 1
    מסופק טרנס באמצעות פלסמיד התאוששות (pK184-גן). הפלסמיד pOX38-Tc Δgene :: ס"מ כתוצאה מועבר זן XK1200 (שלב 2) להערכה נוספת של הגן באמצעות מבחני ההזדווגות עם נמען MC4100 (שלב 3). אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

    איור 2
    איור 2: מחצלתing assay כדי להעריך את תפקידו של גן המטרה בהטיה. תאים התורם והמקבל היו E. coli XK1200 pOX38-Tc ΔtraF :: ס"מ הפך עם pK184-traf ו MC4100, בהתאמה. Transconjugants שיעורר (MC4100 pOX38-Tc ΔtraF :: ס"מ) גדלים על צלחות המכילות Sm ו ס"מ, המציין לשחזור מוצלח של פונקציה conjugative. הניסוי מתבצע בשני עותקים על צלחת אגרה יחיד, דילולי סדרה משמשים כדי לחשב את יעילות ההזדווגות של מוטציות גן משקמות (טבלה 2). אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

    זן חיידקים / פלסמיד למאפיינים רלוונטיים דה מרקר סלקטיבי (ים) התייחסות
    זני חיידקים
    DY330R W3110 ΔlacU169 gal490 λc1857 Δ (CRO-bioA) הרי"ף R Rif 33,34
    XK1200 F - lacΔU124 Δ (גל נדא aroG attλ ביו gyrA) מאיץ לאומי 40
    MC4100 araD139 Δ (argF-לאק) U169 rpsL150 relA1 flbB3501 deoC1 ptsF25 rbsR Sm 41
    וקטורים ובונים
    pBAD33 פלסמיד ביטוי תחת מ P araBAD ס"מ 32
    pK184 2.4 kb שיבוט וקטור, replicon p15a ק"מ 31
    pK184-traf </ Td> F traf מ pOX38 ב pK184 ק"מ 35
    pK184-traf 56-247 F traf aa 56-247 מ pK184-traf ק"מ
    פלסמידים Conjugative
    pOX38-Tc IncFI, Tra +, RepFIA +, שבר HindIII F1 של F, מיני-TN Tc 29,30
    pOX38-Tc ΔtraF :: ס"מ pOX38-Tc עם CAT הוכנס traf Tc ס"מ 35
    † ס"מ, chloramphenicol; ק"מ, kanamycin; מאיץ לאומי, חומצת nalidixic; הרי"ף, ריפמפיצין; SM, סטרפטומיצין; Tc, טטרציקלין
    ‡ כל המבנים traf להכיל את רצף מנהיג 19 השרפה כדי להבטיח לוקליזציה למרחב periplasmic.

    שולחן 1: זנים פלסמידים coli השתמשו במחקר זה.

    לִבנוֹת תֶחֶל*
    Traf ס"מ עבור 5'- GATCGAGGCTGGCAGTGGTATAACGAGAAAATAAATCCGAAGGA - CTGTGACG GAAGATCACTTC -3 '
    Traf-CM-Rev 5'- TCTTCAGAAACGTTCAGGAACTGTTTTGCCAGGTCGTCCT - CTTATTCAGGCGT AGCACCAG -3 '
    pK184-traf תמורת 5'- TTTTTT GAATTC TATGAATAAAGCATTACTGCCAC -3 '
    pK184-traf-Rev 5'- TTTTTT AAGCTT TAAAAATTGGGTTTAAAATCTTCAGAAA -3 '
    pK184-traf 55-247 -עבור 5'- TACG CATATG ATGGCCGCACTGCAGACGG -3 '
    pK184-traf 55-247 5'- TACG CATATG TCCTGACGCCGGAAAAATAAAGCAGCAGAGTAA -3 '
    † טבלה מותאמת Lento et al. 2016 35 עם רשות
    * האזורים תלויים traf הם באות נטויות. אתרי אנזים הגבלה הם קו תחתי (HindIII: AAGCTT, EcoRI: GAATTC, NdeI: CATATG)

    טבלה 2: רשימת פריימרים המשמשים במחקר זה.

    התורם פלסמיד † שחזור פלסמיד § ‡ Transconjugants (תאים מ"ל -1) זיווג Efficiency§ ||
    pOX38-Tc ΔtraF :: ס"מ אף לא אחד 0 0
    pOX38-Tג ΔtraF :: ס"מ pK184 0 0
    pOX38-Tc ΔtraF :: ס"מ pK184-traf 5 x 10 3 .0167
    pOX38-Tc ΔtraF :: ס"מ pK184-traf 55-247 0 0
    * טבלה מותאמת Lento et al. 2016 35 עם רשות
    † תאים התורם היו E. coli XK1200, עם ריכוז ממוצע של 3 x 10 7 תאים מ"ל -1
    ‡ תאים הנמען היו E. coli MC4100. מספר transconjugants עבור השליטה החיובית הוא מ- דילול 10-5. 0 מציין שאין transconjugants מ דילול 10-2.
    ממוצע §An של שניים עד ארבעה ניסויי הזדווגות בוצע עבור כל מבנה.
    || יעיל הזדווגות היא definאד כמו transconjugants ל -100 תאים תורמים. יעילות ההזדווגות 0 מציין שאין transconjugants מ דילול 10-2

    טבלה 3: יעילות ההזדווגות בוטל על ידי בונה המחיקה traf.

    Subscription Required. Please recommend JoVE to your librarian.

    Discussion

    תהליך קוניוגציה מספק שבאמצעותו החיידק עלול להתפשט גנים מתן יתרון אבולוציוני לצמיחה בסביבות מאתגרות, כגון התפשטות סמנים עמידות לאנטיביוטיקה. מכיוון שרבי פלסמידים conjugative כל כך גדולים, 12 מחקרים תפקודיים על חלבוני המעורבים הרכבה של מנגנון ההעברה באמצעות מוטציות של גני היעד על פלסמיד conjugative עצמה הם מסורבלים. הפרוטוקולים המפורטים כאן לספק אמצעי שבאמצעותו ניתן בקלות רבה יותר להעריך את גן המטרה של עניין באמצעות השימוש קטן, פלסמידים ביטוי יותר לניהול (איור 1). אנו מעסיקים את פלסמיד F נגזרת pOX38-Tc (טבלה 1) ללמוד נטיה בתיווך פלסמיד F; פלסמידים conjugative אחרים ניתן ללמוד באמצעות הפרוטוקולים המפורטים כאן פלסמידים נגזרים מתאימים. מבחני ההזדווגות התווה הותאמו של Frost ועמיתיו, 42 עם כמה modificatiלפיירפוקס. במחקרים קודמים, 8,33,42 יצירת המבנה pOX38-Tc Δgene :: ס"מ הושגה על ידי ביקוע את הגן של עניין עם אנזימי הגבלה המתאים והחדרת הקלטת CAT מוגבר לתוך pOX38-Tc. 42 השיטה הנוכחית, אנו מעסיקים רקומבינציה הומולוגי זן coli recombineering א DY330R 33,34 כדי מפסיד יוצא גן היעד ולהחליף אותו עם קלטת CAT. יש לכך יתרון לאפשר את המתח שנוצר DY330R מחסה pOX38-Tc Δgene :: ס"מ לבנות לפעול כביקורת על נוקאאוט גנטי ספציפי מתוך F-T4SS בתיווך העברת conjugative דרך ההתאוששות של העברת באמצעות פלסמיד התאוששות-גן pK184 . למרות שזה עשוי להיות אפשרי כדי ליצור knockouts באמצעות מתודולוגיה במצנן-Cas9, 43 יש לנו לא בשלב זה בחן את האפשרות הזאת.

    התהליך מתחיל עם הדור של נוקאאוט גנטי פלסמיד נגזרת F pOX38-Tc (Figure 1). זו מושגת באמצעות רקומבינציה הומולוגית בתאי DY330R (טבלה 1), זנים אחרים עם תכונות דומות כגון DY329, DY331 ו DY378 יכול לשמש גם. Primers בתחילה נועד PCR להגביר את קלטת CAT מן הפלסמיד pBAD33 32 ומכיל התלויים בסיסים ומתאימים עבור גן היעד (לוח 2); מוצר ה- PCR לאחר מכן electroporated לתאים DY330R מחסה pOX38-Tc. רקומבינציה הומולוגיים מייצר ס"מ :: Δgene pOX38-Tc פלסמיד-אאוט דפיקה שבו קלטת CAT מוכנס בתוך מסגרת בתוך הגן היעד, שיבוש הרכבה T4SS ביעילות והזדווגות תוך מתן התנגדות ס"מ. במקביל, גן המטרה היא PCR מוגבר של pOX38-Tc ונוסף פלסמיד ביטוי קטן; בפרוטוקול זה אנו משתמשים pK184 עבור ביטוי מכונן, אולם אפשר בחרתי פלסמיד עם ביטוי מושרה של גן המטרה אם תרצה בכך. הפלסמיד-גן pK184 עובר טרנספורמציה אזלתוך התאים DY330R pOX38-Tc Δgene :: ס"מ, ותאים אלה משמשים ואז כתורמי להעביר את pOX38-Tc Δgene :: ס"מ לבנות באמצעות נטיה לתוך XK1200 תאים עבור מבחני ההזדווגות. ב מבחני ההזדווגות, התאים התורם והמקבל הם XK1200 pOX38-Tc Δgene :: ס"מ MC4100, בהתאמה. הפלסמיד התאוששות pK184-גן, כמו גם מוטנטים סדרה של גן המטרה (מחיקות או מוטציות נקודתיות), מוצע תאים התורם להעריך את יכולתם לשחזר ההזדווגות, ולקבוע יעילותה, עם תאים הנמען MC4100 (איור 2 ; טבלה 3).

    קריטי ההליך הוא השימוש תורם מתאים זני נמען (טבלה 1), ואת העיצוב של פריימרים בשימוש. עבור כל צבע יסוד שנועד, ישנם קווים מנחים כלליים שראוי ליישם. למרות שאנו בהחלט לנסות לקיים עם תוכן GC 40-60%, זה לא תמיד אפשרי. במקרים כאלה, זה שיקול דעתו של הנסיין לבדוק פריימר wתוכן GC ה- i מעט מתחת או מעל לטווח זה. טמפרטורת ההתכה (T מ) של פריימר קדימה לאחור חייבת להיות דומה, וטמפרטורת החישול (T א) ערך תמיד צריכה להיות נמוכה יותר מ T על ידי C 2-5 מעלות במשך PCR. האנרגיה החופשית זמינה עבור מאפשר סיכת ראש לפתח צריך להיות הרבה יותר נמוך מאשר חולץ, בעוד שָׁוֶה ו- m T dimerization הטרוגניות של חייב להיות מאוד נמוכים (פחות מ -10 kJ ו -30 מעלות צלזיוס). יכול להיות מתוכנן Primers לחקור מחיקות, תוספות או מוטציות נקודתיות כפי רצויים. זה כמובן קריטי שהמבנה הגנטי כתוצאה מוגבר ולהיות ligated לתוך פלסמיד התאוששות-פריים כזה כי הוא בא לידי ביטוי כראוי. טרנספורמציה של תאי מוסמכות ניתן לעשות זאת באמצעות הלם electroporation או חום באמצעות תאי electrocompetent או כימי מוסמכות, בהתאמה. אנו מוצאים כי electroporation יעיל יותר עבור מבנים גדולים כגון pOX38-TC ואת oligonucle ההומולוגיotide, בעוד פלסמידים ביטוי קטנים כגון pK184-traf ניתן להפוך בקלות לתוך התאים באמצעות שיטות הלם חום. לבסוף, חשוב לזכור כי תהיה אנטיביוטיקה מרובה הנמצאות בשימוש בכל הפרוטוקול, כמו שני זני התורם ומקבל דורשים התנגדויות שונות שאינן שונים מאלה המועסקים על פלסמידים conjugative והתאוששות.

    מלבד טכניקות מבחני הזדווגות המתוארות כאן, ישנן שיטות אחרות המשמשות ללמוד קוניוגציה, משתנות מעט בגישתם. העברת גנים אופקית היא תהליך שבו חיידקים להעביר פלסמיד לתא הנמען, כולל מקבלי interspecies. 44 מחקר שנערך על ידי Dahlberg ועמיתיו 44 למשל בשימוש קוניוגציה כדי לקבוע את מידת העברת גנים אופקית בין מיני. הם ניצלו את ההתאגדות של חלבון פלואורסצנטי ירוק (GFP) לתוך פלסמיד משובט לתאים KT2442; כרומוזומליות lAC ואני q גנים בתאים KT2442 להדחיק ביטוי של GFP. כאשר GFP נושאת פלסמיד מועברת מינים ללא גן q לאק אני, הקרינה הוא ציין. 44 על אף המגבלה שלה לספק תפקוד חלבון ספציפי במינים שונים, ניסוי נטיית interspecies כבר יכולים להיות בשילוב עם הפרוטוקולים שהוצגו כאן לעשות תחזיות האבולוציוני אינטראקציות בין חלבונים בין מינים שונים.

    Subscription Required. Please recommend JoVE to your librarian.

    Disclosures

    החוקרים מצהירים כי אין להם אינטרסים כלכליים מתחרים.

    Acknowledgments

    מחקר זה מומן על ידי דיסקברי גרנט ממדעי הטבע וההנדסה המועצה של קנדה (NSERC).

    Materials

    Name Company Catalog Number Comments
    GeneJet Plasmid Mini-Prep Kit Fisher Scientific K0503
    GeneJet Gel Extraction Kit Fisher Scientific K0692
    GeneJet PCR Purification Kit Fisher Scientific K0702
    Q5 Site-Directed Mutagenesis Kit New England Biolabs E0554S
    Broad Range DNA Ladder New England Biolabs N0303A
    Petri Dishes Fisher Scientific FB0875713
    Electroporator Eppendorf 4309000027
    Electroporation cuvettes Fisher Scientific FB101 Cuvettes have a 1 mm gap.
    Enzymes
    AvaI New England Biolabs R0152S
    EcoRI New England Biolabs R0101S
    HindIII New England Biolabs R0104L
    NdeI New England Biolabs R0111S
    Phusion DNA Polymerase New England Biolabs M0530L
    T4 DNA Ligase New England Biolabs M0202S
    DpnI New England Biolabs R0176S
    Antibiotics Final Concentrations
    Chloramphenicol (Cm) Fisher Scientific BP904-100 20 µg/mL
    Kanamycin (Km) BioBasic Inc. DB0286 50 µg/mL
    Nalidixic acid (Nal) Sigma-Aldrich N8878-25G 10 µg/mL
    Rifampicin (Rif) Calbiochem 557303 20 µg/mL
    Tetracycline (Tc) Fisher Scientific BP912-100 10 µg/mL
    Streptomycin (Sm) Fisher Scientific BP910-50 50 µg/mL

    DOWNLOAD MATERIALS LIST

    References

    1. Dobrindt, U., Hochhut, B., Hentschel, U., Hacker, J. Genomic islands in pathogenic and environmental microorganisms. Nat Rev Microbiol. 2, (5), 414-424 (2004).
    2. Furuya, E. Y., Lowy, F. D. Antimicrobial-resistant bacteria in the community setting. Nat Rev Microbiol. 4, (1), 36-45 (2006).
    3. Griffiths, A., Miller, J., Suzuki, D., Lewontin, R., Gelbart, W. An Introduction to Genetic Analysis, 7th Edition. W.H. Freeman. San Fransisco. (2000).
    4. Cooper, T. F. Recombination Speeds Adaptation by Reducing Competition between Beneficial Mutations in Populations of Escherichia coli. PLoS Biol. Barton, N. H. 5, (9), 225 (2007).
    5. Lujan, S. A., Guogas, L. M., Ragonese, H., Matson, S. W., Redinbo, M. R. Disrupting antibiotic resistance propagation by inhibiting the conjugative DNA relaxase. Proc Natl Acad Sci. 104, (30), 12282-12287 (2007).
    6. Carattoli, A. Plasmids and the spread of resistance. Int J Med Microbiol. 303, (6-7), 298-304 (2013).
    7. Shala, A., Ferraro, M., Audette, G. F. Bacterial Secretion Systems: Nanomachines for Infection and Genetic Diversity. Handbook of Clinical Nanomedicine: Nanoparticles, Imaging, Therapy and Clinical Applications. Bawa, R., Audette, G. F., Rubenstein, I. Pan Sanford Publishing. Singapore. 657-686 (2016).
    8. Tseng, T. T., Tyler, B. M., Setubal, J. C. Protein secretion systems in bacterial-host associations, and their description in the Gene Ontology. BMC Microbiol. 9, (1), Suppl 1 2 (2009).
    9. Alvarez-Martinez, C. E., Christie, P. J. Biological diversity of prokaryotic type IV secretion systems. Microbiol Mol Biol Rev. 73, (4), 775-808 (2009).
    10. Lawley, T. D., Klimke, W. A., Gubbins, M. J., Frost, L. S. F factor conjugation is a true type IV secretion system. FEMS Microbiol Lett. 224, (1), 1-15 (2003).
    11. Lederberg, J., Tatum, E. L. Gene Recombination in Escherichia Coli. Nature. 158, (4016), 558-558 (1946).
    12. Smillie, C., Garcillan-Barcia, M. P., Francia, M. V., Rocha, E. P. C., de la Cruz, F. Mobility of Plasmids. Microbiol Mol Biol Rev. 74, (3), 434-452 (2010).
    13. Willetts, N., Skurray, R. The Conjugation System of F-Like Plasmids. Annu Rev Genet. 14, (1), 41-76 (1980).
    14. Frost, L. S., Ippen-Ihler, K., Skurray, R. A. Analysis of the sequence and gene products of the transfer region of the F sex factor. Microbiol Rev. 58, (2), 162-210 (1994).
    15. Audette, G. F., Manchak, J., Beatty, P., Klimke, W. A., Frost, L. S. Entry exclusion in F-like plasmids requires intact TraG in the donor that recognizes its cognate TraS in the recipient. Microbiology. 153, Pt 2 442-451 (2007).
    16. Christie, P. J., Atmakuri, K., Krishnamoorthy, V., Jakubowski, S., Cascales, E. Biogenesis, Architecture, and Function of Bacterial Type Iv Secretion Systems. Annu Rev Microbiol. 59, (1), 451-485 (2005).
    17. Christie, P. J. Type IV secretion: the Agrobacterium VirB/D4 and related conjugation systems. Biochim Biophys Acta - Mol Cell Res. 1694, (1-3), 219-234 (2004).
    18. Bhatty, M., Laverde Gomez, J. a, Christie, P. J. The expanding bacterial type IV secretion lexicon. Res Microbiol. 164, (6), 620-639 (2013).
    19. Christie, P. J., Cascales, E. Structural and dynamic properties of bacterial Type IV secretion systems (Review). Mol Membr Biol. 22, (1-2), 51-61 (2005).
    20. Christie, P. J. Type IV secretion: Intercellular transfer of macromolecules by systems ancestrally related to conjugation machines. Mol Microbiol. 40, (2), 294-305 (2001).
    21. Christie, P. J., Whitaker, N., González-Rivera, C. Mechanism and structure of the bacterial type IV secretion systems. Biochim Biophys Acta. 1843, (8), 1578-1591 (2014).
    22. Cascales, E. The type VI secretion toolkit. EMBO Rep. 9, 735 (2008).
    23. Silverman, J. M., Brunet, Y. R., Cascales, E., Mougous, J. D. Structure and Regulation of the Type VI Secretion System. Annu Rev Microbiol. 66, (1), 453-472 (2012).
    24. Chandran, V., et al. Structure of the outer membrane complex of a type IV secretion system. Nature. 462, (7276), 1011-1015 (2009).
    25. Rivera-Calzada, A., et al. Structure of a bacterial type IV secretion core complex at subnanometre resolution. EMBO J. 32, (8), 1195-1204 (2013).
    26. Waksman, G., Fronzes, R. Molecular architecture of bacterial type IV secretion systems. Trends Biochem Sci. 35, 691 (2010).
    27. Fronzes, R., Christie, P. J., Waksman, G. The structural biology of type IV secretion systems. Nat Rev Microbiol. 7, (10), 703-714 (2009).
    28. Kaplan, M., et al. Probing a cell-embedded megadalton protein complex by DNP-supported solid-state NMR. Nat Methods. 12, (7), 5-9 (2015).
    29. Guyer, M. S., Reed, R. R., Steitz, J. A., Low, K. B. Identification of a sex-factor-affinity site in E. coli as gamma delta. Cold Spring Harb Symp Quant Biol. 45, Pt 1 135-140 (1981).
    30. Anthony, K. G., Sherburne, C., Sherburne, R., Frost, L. S. The role of the pilus in recipient cell recognition during bacterial conjugation mediated by F-like plasmids. Mol Microbiol. 13, (6), 939-953 (1994).
    31. Jobling, M. G., Holmes, R. K. Construction of vectors with the pl5a replicon, kanamycin resistance, inducible lacZα and pUC18 or pUC19 multiple cloning sites. Nucleic Acids Res. 18, (17), 5315 (1990).
    32. Guzman, L. M., Belin, D., Carson, M. J., Beckwith, J. Tight regulation, modulation, and high-level expression by vectors containing the arabinose P(BAD) promoter. J Bacteriol. 177, (14), 4121-4130 (1995).
    33. Yu, D., et al. An efficient recombination system for chromosome engineering in Escherichia coli. Proc Natl Acad Sci U S A. 97, (11), 5978-5983 (2009).
    34. Lawley, T. D., Gilmour, M. W., Gunton, J. E., Standeven, L. J., Taylor, D. E. Functional and Mutational Analysis of Conjugative Transfer Region 1 (Tra1) from the IncHI1 Plasmid R27. J Bacteriol. 184, (8), 2173-2180 (2002).
    35. Elton, T. C., Holland, S. J., Frost, L. S., Hazes, B. F-Like Type IV Secretion Systems Encode Proteins with Thioredoxin Folds That Are Putative DsbC Homologues. J Bacteriol. 187, (24), 8267-8277 (2005).
    36. Hazes, B., Frost, L. Towards a systems biology approach to study type II/IV secretion systems. Biochim Biophys Acta. 1778, 1839-1850 (2008).
    37. Lento, C., Ferraro, M., Wilson, D., Audette, G. F. HDX-MS and deletion analysis of the type 4 secretion system protein TraF from the Escherichia coli F plasmid. FEBS Lett. Tsolis, R. 590, (3), 376-386 (2016).
    38. Audette, G. F., Van Schaik, E. J., Hazes, B., Irvin, R. T. DNA-binding protein nanotubes: Learning from nature's nanotech examples. Nano Lett. 4, 1897-1902 (2004).
    39. Harris, R. L., Silverman, P. A. Tra proteins characteristic of F-like type IV secretion systems constitute an interaction group by yeast two-hybrid analysis. J Bacteriol. 186, (16), 5480-5485 (2004).
    40. Moore, D., et al. Characterization of the F-Plasmid Conjugative Transfer Gene traU. J Bacteriol. 172, (8), 4263-4270 (1990).
    41. Anthony, K. G., Sherburne, C., Sherburne, R., Frost, L. S. The role of the pilus in recipient cell recognition during bacterial conjugation mediated by F-like plasmids. Mol Microbiol. 13, (6), 939-953 (1994).
    42. Klimke, W. A., Frost, L. S. Genetic analysis of the role of the transfer gene, traN, of the F and R100-1 plasmids in mating pair stabilization during conjugation. J Bacteriol. 180, (16), 4036-4043 (1998).
    43. Jiang, W., Marraffini, L. A. CRISPR-Cas: New Tools for Genetic Manipulations from Bacterial Immunity Systems. Annu Rev Microbiol. 69, (1), 209-228 (2015).
    44. Dahlberg, C., Bergstrom, M., Andreasen, M., Christensen, B. B., Molin, S., Hermansson, M. Interspecies bacterial conjugation by plasmids from marine environments visualized by gfp expression. Mol Biol Evol. 15, (4), 385-390 (1998).

    Comments

    0 Comments


      Post a Question / Comment / Request

      You must be signed in to post a comment. Please or create an account.

      Usage Statistics