Coniugazione saggi di accoppiamento per l'analisi specifica per sequenza di proteine ​​di trasferimento relativi coniugazione batterica

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Erdogan, F., Lento, C., Yaseen, A., Nowroozi-Dayeni, R., Kheyson, S., Audette, G. F. Conjugative Mating Assays for Sequence-specific Analysis of Transfer Proteins Involved in Bacterial Conjugation. J. Vis. Exp. (119), e54854, doi:10.3791/54854 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Il trasferimento di geni e proteine ​​a livello micro-organismal svolge un ruolo centrale nella sopravvivenza dei batteri e l'evoluzione, nonché i processi di infezione. Lo scambio di DNA tra batteri o tra un batterio e una cellula può essere ottenuto attraverso la trasformazione, coniugazione o trasduzione vettoriale. 1,2 coniugazione è unico rispetto alla trasformazione e trasduzione dal fatto che durante la coniugazione tra batteri gram-negativi come Escherichia coli, il trasferimento del DNA avviene in modo donatore controllato quale un sistema macromolecolare complesso collega cellule donatrici e riceventi. Coniugazione è anche il modo più diretto in cui le cellule batteriche interagiscono con le cellule ospiti per iniettare i geni, proteine ​​o sostanze chimiche a sistemi host. 3 Molto spesso, il trasferimento di tali agenti ha effetti notevoli sulla serie, che vanno dalla patogenesi e carcinogenesi ad ospitare evoluzione e adattamento. E 'stato dimostrato che recombinatio conjugativen aumenta il tasso di adattamento 3 volte nei batteri con alti tassi di mutazione in condizioni di stress ambientale. 4 Inoltre, la coniugazione è di gran lunga la via più comune attraverso il quale si diffondono i geni di resistenza agli antibiotici in ceppi batterici. 5,6

I microrganismi sono evoluti sistemi di secrezione specializzati per supportare il trasferimento di macromolecole attraverso le membrane cellulari; attualmente ci sono 9 tipi di sistemi di secrezione (Tsss) in batteri gram negativi che sono stati descritti: T1SS, T2SS, T3SS, T4SS, T5SS, T6SS, T7SS, così come la Sec (secrezione) e Tat (due-arginina traslocazione) percorsi. 7,8 Ogni tipo di sistema di secrezione è ulteriormente suddiviso in diversi sottotipi, una necessità a causa della diversità delle proteine e la peculiarità di meccanismi coinvolti, in differenti ceppi batterici. Ad esempio, nel sistema di secrezione di tipo IV (T4SS), i sistemi di Ti e Cag facilitano il trasporto effettore che l'F-plasmide, R27 unND pKM101 T4SSs facilitare il trasferimento di un plasmide coniugativo. 7,9,10 Una comprensione dettagliata dei meccanismi attraverso i quali gli organismi assemblano i loro rispettivi sistemi di secrezione dalle loro proteine componenti e condividono contenuti cellulari con un destinatario o il loro ambiente circostante è un fattore importante per lo sviluppo di strategie mirate per combattere i microrganismi e processi di patogeni infezione cellulare.

Dopo l'identificazione coniugazione batterica iniziale in E. coli da Lederberg e Tatum, 11 sono state identificate e caratterizzate numerose plasmidi mobili e coniugazione. 12 Tali plasmidi mobili mostrano notevole gamma è formato (da 1 a oltre 200 kilobasi (kb)), tuttavia tutti i plasmidi mobili contengono una relaxase, che riconosce l'origine di trasferimento (orit) consentendo così la trasmissione del plasmide. plasmidi coniugativi ulteriori geni codificano per il montaggio di un T4SS funzionale così come un tipoIV proteine ​​accoppiamento. 12 Ad esempio 100 kb F plasmide di E. coli codifica tutti i geni coniugazione di una regione (tra) 33,3 trasferimento kB. 13 I geni della regione Tra del plasmide codifica F tutte le proteine che facilitano la formazione di pilus, accoppiamento formazione coppia (MPF), il trasferimento del DNA e le funzioni di esclusione durante il trasferimento plasmide conjugative. 10,14,15 un corpus significativo di conoscenze è disponibile per conjugative T4SSs, per quanto dettagliati studi strutturali delle proteine e dei complessi di coniugazione sono solo più di recente diventando disponibili. 16 - 28

Per assemblare una visione complessiva del processo conjugative, è necessario un accoppiamento di studi strutturali dettagliate per mutazionale analisi delle proteine ​​di trasferimento coniugazione. Ciò può essere ottenuto mediante saggi accoppiamento coniugazione. Per il plasmide F, ciascuna proteina codificata all'interno della regione di tra gioca un ruolo nella co F-mediatanjugation; Pertanto, il knockout / delezione di un gene transfer abolisce la capacità conjugative della cella (Figura 1). Mentre più piccoli plasmidi mobili sono più favorevoli per le procedure di cancellazione standard per i plasmidi coniugazione più grandi come F, knockout genici si ottengono più facilmente tramite ricombinazione omologa in cui il gene bersaglio viene sostituito con uno trasmettere un distinto gene di resistenza agli antibiotici. Nel protocollo corrente, ci avvaliamo di ricombinazione omologa per sostituire un gene trasferimento di interesse con cloramfenicolo acetiltransferasi (CAT) nella 55 kb F plasmide derivato pOX38-Tc; 29,30 plasmide knockout risultante, pOX38-Tc Δgene :: Cm, facilita resistenza alla presenza di cloramfenicolo (Cm) in terreni di crescita. Cellule del donatore ospitano pOX38-Tc Δgene :: Cm potuto influenzare conjugative trasferimento di DNA / accoppiamento come osservata attraverso l'uso di un saggio di accoppiamento; l'efficienza di accoppiamento di una cellula donatrice pOX38-Tc Δgene :: cm e una recip normaleiente diminuirà o, più spesso, essere abolito. trasferimento conjugative del plasmide pOX38-Tc Δgene :: Cm può essere ripristinato tramite un piccolo plasmide recupero ospitare il gene trasferimento mirato. Questo plasmide recupero può essere uno che fornisce l'espressione costitutiva, come plasmide pK184 (pK184-gene), 31 o uno che fornisce l'espressione inducibile finché tale plasmide obiettivi correttamente il gene nella posizione corretta all'interno della cellula (citoplasma o periplasma). Di conseguenza, in saggi di accoppiamento tra questo nuovo donatore (ospitare pOX38-Tc Δgene plasmidi :: Cm + pK184-gene) ed una cellula ricevente, l'efficienza di accoppiamento è previsto per ripristinare quasi quella di un normale dosaggio accoppiamento donatore-ricevente. Questo sistema permette di sondare la funzione del gene eliminato attraverso la generazione di una serie di costrutti pK184 gene (delezioni o mutazioni puntiformi) e testare la capacità di ogni costrutto di ripristinare la capacità di accoppiamento del harbouring pOX38-Tc Δgene :: Cm cellula donatriceS.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Generazione di costrutti di DNA

  1. Progettare oligomeri per ricombinazione omologa del gene bersaglio
    1. Progettare un singolo 55-72 bp oligomero avanti come segue: (a) scegliere un 19-32 bp lunga sequenza nucleotidica che è omologa ad una sequenza di DNA della regione 10-100 bp a monte del sito di inizio della 5 'del gene acetiltransferasi cloramfenicolo nel plasmide pBAD33 commerciale, 32 e (b) selezionare un 36-54 bp lunga sequenza nucleotidica omologa ad una regione 10-150 bp a valle del sito di inizio della 5 'del gene bersaglio di interesse.
      1. Partecipa 'fine sequenza nucleotidica raccolti in (b) al 5' del 3 fine della sequenza nucleotidica raccolto in (a), dando così una singola 55-72 lungo oligomero avanti.
    2. Progettare un singolo 55-72 bp inverso oligomero come segue: (a) scegliere un 19-32 bp lunga sequenza nucleotidica che è omologa ad una sequenza di DNA della regione 10-100 bp a valledella estremità 3 'del gene cloramfenicolo nel plasmide pBAD33 commerciale, e (b) selezionare un 36-54 bp lunga sequenza nucleotidica omologa a una regione all'interno 10-150 bp a monte del 3' sito fine del gene bersaglio di interesse .
      1. Partecipa 'fine della sequenza nucleotidica raccolti a (b) al 5' del 3 fine della sequenza nucleotidica raccolto in (a) per renderlo un singolo oligomeri.
      2. Copia questo oligomero in qualsiasi software di bioinformatica disponibili e convertire la sequenza in suo complemento inverso. Questo darà un singolo 55-72 bp lungo oligomeri inverso.
    3. L'utilizzo di qualsiasi programma di oligo-analizzatore disponibili, verificare che gli oligomeri di ricombinazione hanno un contenuto GC tra il 40-60%, temperatura di fusione a bassa tornante (T m), bassa auto ed etero-dimerizzazione T m s '. Ordinare i primer per la sintesi e la spedizione da qualsiasi società di biotecnologie preferito.
  2. L'amplificazione del CAT cassetta da pBAD33 (Cm R
  3. Crescere un (O / N, 16-18 h) cultura durante la notte di cellule DH5α ospitano il plasmide pBAD33 in brodo lisogenia sterile (LB) con 20 mg / ml cloramfenicolo (Cm) con agitazione a 200 rpm e 37 ° C.
  4. Centrifuga 6-8 mL della coltura O / N a temperatura ambiente, 5,000 xg per 3 min. Decantare il surnatante ed estrarre il plasmide pBAD33 dal pellet tramite un mini-prep kit plasmide (Materials Table) e il protocollo del produttore.
  5. Fare un digest del DNA plasmide pBAD33 aggiungendo quanto segue in una provetta sterile nell'ordine indicato: adeguato volume di acqua bidistillata (DDH 2 O) per un volume finale di 50 ml, il volume 1 mg di pBAD33 plasmide, 5 ml 10x tampone di reazione enzimatica, e 0,5 ml di Avai enzima di restrizione (RE). Mescolare delicatamente pipettando e lasciare che la reazione procede per 1 ora a 37 ° C. Calore inattivare la reazione per 20 minuti (min) a 80° C. Conservare i campioni a -20 ° C per non più di 24 ore per ridurre al minimo la degradazione appiccicoso-end.
  6. Preparare una agarosio 1,2% gel di separazione mescolando 1,2 g di agarosio con 100 mL di TAE 1x (40 mM Tris, pH 8,5, 20 mM di acido acetico, 1 mM EDTA) buffer in un pallone da 250 ml Erlenmeyer. Calore e agitare per sciogliere completamente in un forno a microonde. Interrompere il riscaldamento immediatamente quando il liquido comincia a bollire e agitare il pallone.
    1. Raffreddare l'agarosio liquido per 3 minuti a temperatura ambiente, mentre vorticoso, aggiungere 2 ml di 10 mg / ml di etidio bromuro e agitare per mescolare. Versare l'agarosio in un vassoio gel con una ben pettine e farlo solidificare per 1 ha temperatura ambiente. gel Conservare a 4 ° C per un massimo di 2 giorni in 1x tampone TAE.
  7. Mescolare ogni RE digerire da 1.2.3 con 0,2 volume di DNA colorante di caricamento (10 ml di colorante per 50 reazione mL) pipettando. Carico 5 ml di 500 mg / mL DNA ladder nel primo pozzetto e tutta la miscela RE digest-dye in un altro bene sul ungel garose. Utilizzare 2-3 pozzi per caricare tutto il volume di reazione sul gel.
    1. Eseguire il gel malapena sommerso in 1x tampone TAE e operando a 45-50 V (4,5-5 V / cm) per 65 min in un dispositivo di elettroforesi su gel.
  8. Utilizzando un cabinet UV e un rasoio sterile rapidamente tagliare la banda di 2,8 kb che corrisponde alla sequenza CAT su gel per minimizzare l'esposizione UV del DNA. Estrarre il DNA dalla fetta di gel cut-out utilizzando un kit di estrazione gel (Materials Table) secondo il protocollo del produttore.
    Nota: Fare attenzione a non esporre la pelle direttamente ai raggi UV e gestire il rasoio con cura.
  9. Amplificare la cassetta CAT estratto da 1.2.6 da Polymerase Chain Reaction (PCR) utilizzando i primers disegnati in 1.1 che contengono sovrasta omologo alla sequenza genica per consentire la ricombinazione omologa. Le reazioni di PCR sono impostati su ghiaccio utilizzando le linee guida del produttore (Materiali tabella) nel seguente ordine:
    1. In unprovetta PCR sterili, aggiungere un volume adeguato di DDH 2 O per un volume finale di 50 ml, seguito da 10 ml di tampone PCR, 1 ml di 10 mM dNTP, 2,5 ml di 10 micron di primer in avanti, 2,5 ml di 10 micron di primer Reverse , 1-25 ng del DNA stampo da 1.2.6 e 0.5 ml di 100 unità / ml DNA polimerasi.
    2. Impostare un controllo negativo che porta gli stessi componenti 1.2.7.1 ma con l'eccezione del DNA stampo. Utilizzare un volume adeguato di DDH 2 O al posto del DNA stampo. Impostare un controllo positivo utilizzando DNA stampo e primer che hanno dimostrato di funzionare in una reazione PCR, come quelli forniti come controllo positivo dal costruttore.
    3. Mescolare tutti i contenuti di reazione delicatamente pipettando.
    4. Amplificazione tramite PCR usando le seguenti impostazioni: denaturazione iniziale per 30 s a 98 ° C, 30 cicli di denaturazione per 10 s a 98 ° C, annealing primer per 20 s, estensione per 20 s per kilobase di amplicone a 72 ° C e pinnaAl estensione per 10 min a 72 ° C. Conservare i campioni a -20 ° C.
  10. Verificare la corretta dimensione di amplificazione tramite elettroforesi su gel di agarosio (vedi 1.2.4-1.2.5) utilizzando solo 5 ml di ogni reazione. Purificare della PCR utilizzando un kit di purificazione PCR e protocollo del produttore. Conservare purificato DNA a -20 ° C.
  • Il plasmide recupero pK184-gene
    1. Progettare un primer in avanti a partire dalla sua estremità 5 'e andare verso la 3' nel seguente ordine: (a) Scelta 4 nucleotidi casuali (una combinazione di adenina, timina, guanina e citosina) per l'efficienza scissione, collegati a (b) l'enzima di restrizione EcoRI (RE) sequenza sito taglio (GAATTC), seguita da (c) a 21-25 bp lunga sequenza nucleotidica che è omologa alla estremità 5 'del gene di interesse, compreso il codone di inizio. Se il gene bersaglio contiene un sito EcoRI, scegliere un altro RE appropriata dal polylinker pK184.
    2. Nel caso dei geni codificanti proteine ​​periplasmatiche, includere una sequenza leader aggiuntivo tra il sito RE e il codone di inizio sul primer forward.
    3. L'utilizzo di qualsiasi oligo-analizzatore disponibili, verificare che i primer hanno un contenuto GC tra il 40-60%, basso tornante T m, bassa auto ed etero-dimerizzazione T m s '. Ordinare i primer per la sintesi.
    4. Crescere un / N cultura O di cellule DY330R pOX38-Tc in sterili LB contenente 10 mg tetraciclina / mL (Tc) con agitazione a 32 ° C e 200 rpm. Centrifuga 6-8 mL della coltura O / N a temperatura ambiente, 5,000 xg per 3 min. decantare ilsurnatante ed estrarre il DNA plasmidico dal pellet tramite un mini-prep kit plasmide (Materials Table) e il protocollo del produttore.
    5. Amplificare la piena gene di interesse con primer da 1.3.1-1.3.5 usando pOX38-Tc come il modello (vedi 1.2.7.1-1.2.7.3).
    6. Verificare la corretta dimensione di amplificazione tramite elettroforesi su gel di agarosio (vedi 1.2.4-1.2.5) utilizzando solo 5 ml di ogni reazione. Purificare il DNA amplificato utilizzando un kit di purificazione PCR e protocollo del produttore. Conservare purificato DNA a -20 ° C.
    7. Fare un doppio digest sia del DNA plasmidico pK184 commercialmente disponibili e il gene amplificato (da 1.3.7.), Aggiungendo la seguente in una provetta sterile nell'ordine indicato: volume appropriato di DDH 2 O per un volume finale di 50 microlitri , 1 volume mg di pK184 plasmide, 5 microlitri tampone di reazione 10x enzimatica, e 1 ml di ogni EcoRI e HindIII.
      1. Mescolare delicatamente pipettando e lasciare che la reazione procede per 1 oraa 37 ° C. Il calore inattivare la reazione per 20 minuti a 80 ° C. Conservare i campioni a -20 ° C per non più di 24 ore per ridurre al minimo la degradazione appiccicoso-end.
        Nota: Il tipo di restrizione nucleasi usata qui dipende dal sito di restrizione nucleasi che è stato progettato nei primer nei passaggi 1.3.1 e 1.3.2.
      2. Come controllo positivo, impostare singole digest del plasmide pK184 preparando la stessa reazione in 1.3.8 tranne aggiungere uno solo dei ER ad un tubo di reazione. Fare questo a parte con entrambe le ER.
    8. Eseguire le digerisce su un gel di agarosio 1,2% utilizzando i protocolli 1.2.4-1.2.5 Estrarre il DNA a doppia digerire frammenti di entrambi pK184 e il gene di interesse in base al punto 1.2.6.
    9. Legare l'inserto gene nel vettore pK184 aggiungendo componenti in una provetta sterile nel seguente ordine: 2 ml di 10x T4 DNA Ligase Buffer, un totale di 100 ng DNA composto da 1: 3 vector: inserire (pK184: gene) Rapporto, DDH 2 O fino ad unvolume totale di 20 microlitri e 1 ml T4 DNA ligasi. Come controllo negativo, impostare una reazione simile usando 100 ng del vettore senza gene inserto.
      1. Mescolare delicatamente tutti i contenuti di reazione utilizzando una micropipetta e incubare per 30 minuti a 25 ° C. Calore inattivare la reazione di ligasi per 10 min a 65 ° C e poi posto su ghiaccio.
    10. Mentre sul ghiaccio, aggiungere 15 ml di pK184-gene reazione legatura dal punto 1.3.10 a 100 ml di cellule DH5α chimicamente competenti di uno sterile 1,5 ml di tubo. Mescolare delicatamente pipettando e incubare in ghiaccio per 10 min. Fare lo stesso per il campione di controllo negativo. Per un controllo positivo, utilizzare 20-100 ng di plasmide come pBAD33 e trasformarla in 50 microlitri di DHα cellule.
    11. Direttamente trasferire i campioni da ghiaccio in un bagno di acqua C 42 ° e incubare per 90 secondi. Questo fornisce alle cellule una scossa di calore e permette loro di assorbono il DNA plasmide.
    12. Cellule posto di nuovo sul ghiaccio per un altro5 minuti e poi aggiungere 900 ml di LB. sterili Incubare a 37 ° C per 1 ora agitando a 125 giri al minuto.
    13. Aliquota un volume di 100 ml di campione da ogni reazione legatura in 1.3.13 su una piastra di agar contenente 50 mg / ml kanamicina (Km) e la diffusione delle cellule utilizzando una spatola sterile. La piastra di controllo positivo dovrebbe avere antibiotici appropriati. Mantenere l'area sterile e lavorare nei pressi di una fiamma. Incubare la piastra capovolta a 37 ° C durante la notte.
    14. Usando una pipetta sterile o loop, raccogliere una singola colonia distinto di cellule e inoculare 20 ml sterile LB con 50 mg / ml Km. Mantenere l'area sterile e lavorare nei pressi di una fiamma. Crescere le cellule O / N a 37 ° C con agitazione a 200 rpm.
    15. Fare 3-5 scorte glicerolo delle cellule trasformate DH5α mescolando 500 ml di / cultura O N con 500 ml di sterile 100% glicerolo (finale il 50% v / v) in sterili crio-tubi. Conservare a -80 ° C.
    16. Anche centrifuga 6-8 mL di O / N coltura a temperatura ambiente, 5,000 xg per 3 min. Decantare il surnatante ed estrarre il plasmide recupero pK184-gene dal pellet tramite un mini-prep kit plasmide (Materials Table) e il protocollo del produttore.
  • pK184 - Mutants gene
    Nota: primer disegnati per delezioni, inserzioni e / o mutazioni puntiformi possono essere facilmente generati utilizzando on-line strumenti a disposizione dei produttori.
    1. Progettare ciascun primer in avanti con la scelta di una sequenza di nucleotidi lungo 18-32 bp che è omologa alla fine del 5 'del gene di interesse, tra cui il codone di inizio. primer disegno tale che ciascun primer forward ricotture 30-180 bp a valle del precedente, con conseguente mutanti di delezione privi frammenti peptidici N-terminali di lunghezza corrispondente.
    2. Progettare un primer reverse scegliendo una lunga sequenza nucleotidica 18-32 bp che è omologo all'estremità 3 'del gene di interesse compreso il codone di stop. Copia questo primer in unny programma bioinformatica disponibili e convertire la sequenza nel suo complemento inverso. Questo è il primer inverso.
      1. Nel caso dei geni codificanti proteine ​​periplasmatiche, progettare il primer reverse che è il complemento inverso 'estremità di una sequenza leader che fiancheggia il 5' 3 'del gene ed è necessaria per la corretta localizzazione del prodotto di proteina nel periplasma.
    3. L'utilizzo di qualsiasi programma di oligo-analizzatore disponibile, verificare che la delezione primer hanno un contenuto GC tra il 40-60%, temperatura di fusione a bassa tornante (T m), bassa auto ed etero-dimerizzazione T m s '. Ordinare i primer per la sintesi e la spedizione da qualsiasi società di biotecnologia a disposizione.
    4. Utilizzando il costrutto pK184-gene ottenuto nel protocollo 1.3, come il modello e le linee guida in 1.2.7-1.2.8, PCR amplifica i costrutti eliminazione con il primer disegnati nei passaggi 1.4.1-1.4.3 per generare pK184-gene ampliconi Ax . Conservare DNA amplificato unt -20 ° C.
    5. Legare il costrutto amplificato utilizzando qualsiasi kit di mutagenesi disponibili (Materials Table).
    6. Trasformare ciascuna delle ligates Ax pK184-gene separatamente in cellule DH5α chimicamente competenti che utilizzano un protocollo di shock termico standard (vedere 1.3.11-1.3.13).
    7. Aliquota un volume di 100 ml di campione da ogni reazione legatura in 1.4.12 su una piastra di agar contenente 50 mg / ml Km e diffondere le cellule utilizzando una spatola sterile. Mantenere l'area sterile e lavorare nei pressi di una fiamma. Incubare la piastra capovolta a 37 ° C durante la notte.
    8. Usando una pipetta sterile o loop, raccogliere una singola colonia distinto di cellule e inoculare a 20 mL supporto sterile LB con 50 mg / ml Km. Mantenere l'area sterile e lavorare nei pressi di una fiamma. Crescere le cellule O / N a 37 ° C con agitazione a 200 rpm.
    9. Fare 3-5 scorte glicerolo delle cellule trasformate DH5α mescolando 500 ml di / cultura O N con 500 ml di sterile 100% glicerolo (finale 50% v / v) in sterili crio-tubi. Conservare a -80 ° C.
    10. Centrifuga 6-8 mL della coltura O / N a temperatura ambiente, 5,000 xg per 3 min. Decantare il surnatante ed estrarre il AX plasmide gene pK184 costruire dal pellet tramite un mini-prep kit plasmide (Materials Table) e il protocollo del produttore. DNA Conservare a -20 ° C.
  • 2. Generazione di pOX38-Tc Δgene :: Cm Ceppi

    1. DY330R pOX38-Tc Δgene :: ko Cm
      1. Preparare un / N cultura O di cellule DY330R pOX38-Tc in 10 ml sterile LB contenente 10 mg / ml Tc. Grow cultura O / N a 32 ° C e 200 giri al minuto.
      2. Effettuare una diluizione 1:70 del / cultura O N in 20 ml di LB. fresca sterile Far crescere le cellule a 32 ° C fino fase di mid-log (OD 600nm 0,4-0,6) la crescita.
      3. Trasferire 10 ml di coltura in un pallone sterile e incubare a 42 ° C per 15 min a 150 rpm in stringono ba acquaesimo. Ciò induce l'espressione di proteine ​​specifiche ricombinazione in DY330R.
      4. Raffreddare la cultura in un bagno di ghiaccio-acqua per 10 min. Preparare le cellule electrocompetent come segue.
        1. Trasferire le cellule refrigerati in provette coniche pre-refrigerati e centrifugare a 4000 xg per 7 minuti a 4 ° C. Tutti i tubi e pipette da utilizzare nei prossimi passi dovrebbero essere posizionati a 4 ° C o su ghiaccio per raffreddare.
        2. Rimuovere il surnatante e delicatamente le cellule risospese in 1 ml di ghiacciata DDH 2 O. Aggiungere altri 30 ml di ghiaccio freddo DDH 2 O.
        3. Centrifugare le cellule (4.000 XG, 7 min, 4 ° C), scartare il surnatante e delicatamente le cellule risospeso in 1 ml di ghiacciata DDH 2 O.
        4. Trasferire le cellule risospese in pre-refrigerati provette da 1,5 ml microcentrifuga e centrifugare a 15.000 xg per 1 min a 4 ° C.
        5. Delicatamente risospeso il pellet in 200 ml di ghiacciata DDH 2 O e aliquota in 50 volumi microlitri. Electrocompetecellule nt possono essere conservati a -80 ° C
      5. Aggiungere 300 ng della cassetta CAT amplificato da 1,2 a 50 ml di cellule DY330R pOX38-Tc electrocompetent mescolando su ghiaccio, delicatamente pipettando su e giù. Ripetere questa operazione utilizzando non modificato plasmide pBAD33 come controllo positivo.
      6. Trasferire le cellule ad una cuvetta elettroporazione pre-raffreddata (-20 ° C) 1 mm. Elettroporazione le cellule a 1,8 kV con una costante di tempo di 5,5 ms, utilizzando un elettroporatore. Immediatamente dopo l'applicazione il polso, diluire le cellule con 1 ml di SOC media e trasferire in una provetta per microcentrifuga fresca. Incubare le cellule a 32 ° C per 2 h.
      7. Aliquota 100 ml di ogni campione su piastre di agar contenenti 10 mg / ml Tc e 20 mg / ml Cm e diffondere utilizzando una spatola sterile. Mantenere l'area sterile e lavorare nei pressi di una fiamma. Incubare la piastra a testa in giù a 32 ° C per una notte di selezionare per i ricombinanti di successo. La cassetta CAT introdotto nella cella subirà re omologacombinazione con il gene di interesse e creare il DY330R pOX38-Tc Δgene :: Cm (Rif R, Tc R, Cm R) clone.
        Nota: È importante far crescere cellule DY330R a 32 ° C, con l'eccezione del 15 min a induzione a 42 ° C del passaggio 2.1.3 prima di generare cellule electrocompetent, la crescita prolungata a temperature elevate rischia la morte cellulare dovuta alla produzione di prodotti tossici dalla p L operone responsabile delle funzioni di ricombinazione in DY330R. 33,34
      8. Preparare un O / N di DY330R pOX38-Tc Δgene :: cellule cm per la raccolta una singola colonia distinto di cellule con una pipetta sterile o loop, e inoculando un supporto da 20 ml sterile LB con 10 mg / ml Tc, e 20 mg / ml Centimetro. Mantenere l'area sterile e lavorare nei pressi di una fiamma. Crescere le cellule O / N a 32 ° C con agitazione a 200 rpm.
      9. Fare 3-5 scorte glicerolo dal O / N mescolando 500 ml di / cultura O N con 500 ml di sterile 100% glycerol (finale il 50% v / v) in sterili crio-tubi. Conservare a -80 ° C.
      10. Centrifuga 6-8 mL della coltura O / N a temperatura ambiente, 5,000 xg per 3 min. Decantare il surnatante ed estrarre il pOX38-Tc Δgene :: Cm costruire dal pellet tramite un mini-prep kit plasmide (Materials Table) e il protocollo del produttore; memorizzare DNA purificato a -20 ° C.
      11. Eseguire un test di accoppiamento coniugativo utilizzando XK1200 cellule come il destinatario di confermare interruzione di coniugazione da gene knockout come da protocollo 3.1.
    2. DY330R pOX38-Tc Δgene :: Cm + pK184-gene
      1. Trasformare cellule DY330R pOX38-Tc Δgene :: Cm electrocompetent con 300 ng del costrutto pK184-gene tramite elettroporazione secondo passi 2.1.4-2.1.7. Tutti i terreni selettivi devono contenere 20 mg / ml cm e 50 mg / ml Km. Incubare a 32 ° C. Il plasmide recupero nelle cellule elettroporate ora ripristinare la funzione del gene eliminato nel DY330R pOX38-Tc Δgene :: cellule Cm.
      2. Preparare un O / N di DY330R pOX38-Tc Δgene :: Cm + pK184-gene cellule ricombinanti di raccolta una singola colonia distinta delle cellule con una pipetta sterile o loop, e inoculando un supporto da 20 ml sterile LB con 20 mg / ml Cm e 50 ug / mL Km. Mantenere l'area sterile e lavorare nei pressi di una fiamma. Crescere le cellule O / N a 32 ° C con agitazione a 200 rpm.
      3. Fare 3-5 scorte glicerolo dal O / N mescolando 500 ml di / cultura O N con 500 ml di sterile 100% glicerolo (finale il 50% v / v) in sterili crio-tubi. Conservare a -80 ° C.
      4. Eseguire anche il protocollo 3.1 per generare XK1200 pOX38-Tc Δgene :: Cm cellule ricombinanti.
    3. XK1200 pOX38-Tc Δgene :: Cm + pK184-gene e mutanti
      1. Preparare le cellule electrocompetent XK1200 pOX38-Tc Δgene :: cm (dal punto 2.2.4).
      2. Separatamente l'elettroporazione di 300 ng di pK184 gene o pK184-gene plasmidi mutanti in 50 ml di electrocompetent XK1200 pOX38-Tc Δgene :: cellule Cm come da passi 2.1.4-2.1.7. Tutti i terreni selettivi dovrebbero contenere 10 mg / mL di acido nalidixico (Nal), 20 mg / ml Cm, e 50 mg / ml Km ed essere incubate a 37 ° C.
      3. Preparare un O / N di XK1200 pOX38-Tc Δgene :: Cm + pK184-gene cellule ricombinanti di raccolta una singola colonia distinta delle cellule con una pipetta sterile o loop, e inoculando un supporto da 20 ml sterile LB con Nal, 20 mg / ml cm e 50 ug / mL Km. Mantenere l'area sterile e lavorare nei pressi di una fiamma. Crescere le cellule O / N a 37 ° C con agitazione a 200 rpm.
      4. Fare 3-5 scorte glicerolo dal O / N mescolando 500 ml di / cultura O N con 500 ml di sterile 100% glicerolo (finale il 50% v / v) in sterili crio-tubi. Conservare a -80 ° C.

    3. coniugazione saggi di accoppiamento

    1. Coniugazione di accoppiamento per generare cellule XK1200 pOX38-Tc Δgene :: Cm
      1. Preparare una da 20 ml sterile LB O / N cultura di DY330R pOX38-Tc Δgene :: cellule Cm + pK184-gene utilizzando una pipetta sterile o loop per inoculare un 20 ml sterile LB contenente 20 mg / ml cm e 50 mg / ml Km con uno stock di glicerolo o singola colonia su un piastra di agar. Crescere a 32 ° C con agitazione a 200 rpm. Preparare la stessa per XK1200 cellule in 20 mL sterile LB con 10 ug / mL Nal, crescendo a 37 ° C.
      2. Rendere 1:70 diluizioni di ciascuna cultura separatamente in 2 mL di sterile LB con lo stesso contenuto antibiotici; aggiungere il glucosio ad una concentrazione finale di 100 mM a tutte le cellule del donatore. Grow cellule alla fase mid-log (OD 600 0,5-0,7) a 37 ° C con agitazione a 200 rpm.
      3. Centrifuga (4.000 xg per 5 minuti a 4 ° C) a pellet cellule, scartare il surnatante, lavare una volta con freddo sterile, LB per eliminare gli antibiotici, e risospendere le cellule in 2 ml di LB. sterile freddo
      4. Aliquota 100 ml di ogni cultura in 800 ml di mezzi LB sterili e permettere loro di accoppiarsi a 32 ° C per 1 ora senza agitare.
      5. <li> Vortex le cellule per 30 s per disturbare le coppie di accoppiamento e disporli sul ghiaccio per 10 minuti per evitare un ulteriore accoppiamento.
      6. Aliquota 100 ml di miscela di cellule su una piastra di agar contenente 10 mg / ml Nal e 20 mg / ml Cm per selezionare le cellule XK1200 pOX38-Tc Δgene :: Cm. Stendere le cellule utilizzando una spatola sterile. Mantenere l'area sterile e lavorare nei pressi di una fiamma. Incubato la piastra di O / N a 37 ° C a testa in giù.
      7. Raccogliere una singola colonia del gene nuova XK1200 pOX38-Tc Δ :: Cm ceppo eliminazione diretta utilizzando una pipetta sterile o loop e crescere in sterili LB con 20 mg / ml Cm, O / N a 37 ° C con agitazione a 200 rpm. Fare 3-5 scorte glicerolo dal O / N mescolando 500 ml di / cultura O N con 500 ml di sterile 100% glicerolo (finale il 50% v / v) in sterili crio-tubi. Conservare a -80 ° C.
        Nota: Le celle risultanti sono ora in grado di essere competente per la trasformazione con i costrutti pK184-gene (protocolli 1.3 e 1.4) per il culoessing il gene ei suoi mutanti sulla capacità di recuperare il trasferimento conjugative nel protocollo 3.2.
    2. Coniugazione di accoppiamento test da XK1200 donatori a riceventi MC4100
      1. Preparare un O / N di cultura XK1200 pOX38-Tc Δgene :: Cm + pK184-gene cellule in 20 ml di sterile LB con 20 ug / mL Cm, 50 pg / mL Km e MC4100 cellule in 5 ml LB con 50 ug / ml di streptomicina (Sm) utilizzando cellule da uno stock di glicerolo o singola colonia su una piastra di agar e sterile pipetta o loop. Grow culture a 37 ° C con 200 giri al minuto agitazione.
      2. Fare 1:70 diluizioni di ciascun / cultura O N separatamente in 2 ml di sterile LB con gli stessi antibiotici. Aggiungere glucosio ad una concentrazione finale di 100 mM a tutte le cellule del donatore. Grow cellule alla fase mid-log (OD 600 0,5-0,7) a 37 ° C con agitazione a 200 rpm.
      3. Centrifuga (4.000 xg per 5 minuti a 4 ° C) a pellet cellule, scartare il surnatante, lavare una volta con freddo sterile, LB per rimuovere antibiotic, e Risospendere le cellule in 2 ml freddo LB. sterile
      4. In duplice copia, un'aliquota di 100 ml di ogni cultura in 800 ml di mezzi LB sterili e consentire loro di accoppiarsi a 37 ° C per 1 ora senza agitare.
      5. Vortex le cellule per 30 s per interrompere le coppie di accoppiamento e metterli in ghiaccio per 10 minuti per evitare un ulteriore accoppiamento.
      6. Utilizzando le culture metà di registro dal punto 3.2.2 e fresco sterili LB, preparare 6 diluizioni seriali delle cellule del donatore e del ricevente da 10 -2 a 10 -7.
      7. Su ciascuna delle due metà di una piastra di agar contenente 10 ug / mL Nal, 20 mg / ml Cm e 50 ug / mL Km, posto 10 microlitri aliquote di ciascuna diluizione di XK1200 cellule donatrici, come mostrato in Figura 2. Ripetere l'operazione per le diluizioni delle cellule destinatario MC4100 su piastre di agar contenenti 50 mg / ml Sm. Incubare le piastre O / N a 37 ° C.
      8. Utilizzando la miscela in agitazione dal punto 3.2.5 e fresco sterili LB, preparare 6 diluizioni (10 -2 a 10 -7 Figura 2. Ripetere l'operazione per entrambe le miscele duplicati. Mantenere l'area sterile e lavorare nei pressi di una fiamma. Incubare le piastre O / N a 37 ° C.
      9. Determinare l'efficienza di accoppiamento di ciascun costrutto come descritto nel protocollo 3.3.
      10. Ripetere questo protocollo per tutti i plasmidi di recupero per valutare l'effetto di una particolare mutazione sull'efficienza di coniugazione.
    3. Calcolo dell'efficienza di accoppiamento
      1. Contare il numero di colonie dalla stessa macchia di diluizione per ogni donatore, destinatario e le cellule transconjugant sui rispettivi piatti.
      2. Contare le colonie beneficiari per testare qualsiasi pregiudizio che deriverebbe da avere un numero maggiore di transconjugants di destinatari in quel dato diluizione.
      3. Calculate l'efficienza di accoppiamento come numero di colonie transconjugant diviso per il numero di colonie donatori. Moltiplicare per 100 per ottenere il valore di efficienza per 100 cellule del donatore.

    Subscription Required. Please recommend JoVE to your librarian.

    Representative Results

    Il processo di F coniugazione batterica plasmide-driven è un processo coordinato che coinvolge le proteine di trasferimento all'interno della regione Tra della F-plasmide che assembla un T4SS per facilitare la sintesi pilus e il trasferimento di DNA coniugativo. La proteina traffico (GenBank adesione # BAA97961; UniProt ID P14497) è necessario per conjugative formazione F-pilus. 10,14,35 - 37 La proteina contiene un dominio tioredossina come C-terminale, anche se non ha motivo CXXC catalitico. 35,38 Anche se è stato previsto per interagire con la proteina TraH attraverso il suo dominio N-terminale, una regione 39 rivelata più dinamica rispetto suo dominio C-terminale, 37 non si sa molto altro sulle caratteristiche strutturali della proteina. Per valutare gli aspetti funzionali della proteina traffico in collaborazione con studi strutturali, in primo luogo abbiamo eliminato il gene traffico sul pOX38-Tc via omologaricombinazione, generando il plasmide pOX38-Tc ΔtraF :: Cm (Tabella 1) in cellule di E. coli DY330R. 33,34 Anche generata era il plasmide pK184-traffico dal traffico primer specifico d'(Tabella 2) per fornire il recupero di coniugazione e consentire sondare la sequenza della proteina. Il trasferimento del plasmide pOX38-Tc ΔtraF :: Cm in XK1200 celle 40 dalle cellule DY330R quando pK184-traffico è stato fornito in trans (transconjugants coltivato in 10 mg / ml Nal, 10 mg / ml Tc e 20 mg / ml Cm) indica che (a) il ko traffico in pOx38-Tc ΔtraF :: Cm fornisce una cassetta CAT in-frame, e (b) che pK184-traffico in grado di ripristinare la funzione conjugative.

    Una serie di mutanti traffico sono stati generati per l'analisi con il saggio di accoppiamento conjugative 37 utilizzando XK1200 pOX38-Tc ΔtraF :: Cm + pK184-traffico AXcellule e cellule MC4100 41 come donatori e riceventi, rispettivamente. Un mutante rappresentativo è TRAF 55-247 (Tabella 1), un mutante di delezione N-terminale che rimuove la regione della proteina previsto per interagire con TraH. Quando la proteina TRAF full-length viene fornita alle cellule del donatore, trasferimento coniugativo viene ripristinato (figura 2), fornendo i pK184 plasmide Vuoto Non (Tabella 3). Analogamente, la funzione coniugativo nelle cellule del donatore XK1200 non viene ripristinata quando fornito con il plasmide pK184-TRAF 55-247 (Tabella 3). Ciò indica che la regione troncata della proteina è importante per la funzione del traffico all'interno dell'apparato conjugative, probabilmente attraverso interazione con TraH, e fornisce una regione della proteina target per ulteriori analisi mutazionale.

    Figura 1
    in trans tramite un plasmide di recupero (pK184-gene). La risultante plasmide pOX38-Tc Δgene :: Cm viene trasferito in un ceppo XK1200 (Fase 2) per un'ulteriore valutazione del gene utilizzando saggi di accoppiamento con un destinatario MC4100 (Fase 3). Clicca qui per vedere una versione più grande di questa figura.

    figura 2
    Figura 2: Mating test per valutare la funzione del gene bersaglio in coniugazione. Cellule donatore e ricevente sono stati E. coli XK1200 pOX38-Tc ΔtraF :: Cm trasformato con pK184-traffico e MC4100, rispettivamente. I transconjugants risultanti (MC4100 pOX38-Tc ΔtraF :: cm) crescono su piastre contenenti Sm e Cm, indicando recupero di successo della funzione conjugative. L'esperimento è fatto in duplicato su una singola piastra di agar, e diluizioni seriali vengono utilizzati per calcolare l'efficienza di accoppiamento di mutanti del gene di riparazione (Tabella 2). Clicca qui per vedere una versione più grande di questa figura.

    Ceppo batterico / plasmidi Caratteristiche rilevanti Marker selettiva (s) Riferimento
    ceppi batterici
    DY330R W3110 ΔlacU169 gal490 λc1857 Δ (CRO-BIOA) Rif R rif 33,34
    XK1200 F - lacΔU124 Δ (nadA aroG gal attλ bio gyrA) Nal 40
    MC4100 araD139 Δ (ARGF-lac) U169 rpsL150 relA1 flbB3501 deoC1 ptsF25 rbsR Sm 41
    Vettori e costrutti
    pBAD33 Plasmidi per l'espressione sotto da P araBAD Centimetro 32
    pK184 2.4 kb clonazione vettore, p15a Replicon km 31
    pK184-TRAF </ Td> F traffico da pOX38 in pK184 km 35
    pK184-TRAF 56-247 F aa 56-247 traffico da pK184-traffico km
    I plasmidi coniugazione
    pOX38-Tc IncFI, Tra +, RepFIA +, f1 HindIII frammento di F, mini-Tn Tc 29,30
    pOX38-Tc ΔtraF :: Cm pOX38-Tc con CAT inserito nel traffico Tc Cm 35
    † Cm, cloramfenicolo; Km, kanamicina; Nal, acido nalidixico; Rif, rifampicina; Sm, streptomicina; Tc, tetraciclina
    ‡ Tutti i costrutti traffico contengono la sequenza leader di 19 residui per garantire la localizzazione nello spazio periplasmatico.

    Tabella 1: ceppi coli e plasmidi utilizzati in questo studio.

    Costruire Primer *
    TRAF-Cm-For 5'-GATCGAGGCTGGCAGTGGTATAACGAGAAAATAAATCCGAAGGA - CTGTGACG GAAGATCACTTC -3 '
    TRAF-Cm-Rev 5'-TCTTCAGAAACGTTCAGGAACTGTTTTGCCAGGTCGTCCT - CTTATTCAGGCGT AGCACCAG -3 '
    pK184-TRAF-For 5'-TTTTTT GAATTC TATGAATAAAGCATTACTGCCAC -3 '
    pK184-TRAF-Rev 5'-TTTTTT AAGCTT TAAAAATTGGGTTTAAAATCTTCAGAAA -3 '
    pK184-TRAF 55-247 -Per 5'-TACG CATATG ATGGCCGCACTGCAGACGG -3 '
    pK184-TRAF 55-247 5'-TACG CATATG TCCTGACGCCGGAAAAATAAAGCAGCAGAGTAA -3 '
    † Tabella adattato da Lento et al. 2016 35 con il permesso
    * Traffico regioni sovrastanti sono in corsivo. siti enzima di restrizione sono sottolineati (HindIII: AAGCTT, EcoRI: GAATTC, NdeI: CATATG)

    Tabella 2: un elenco dei primer utilizzati in questo studio.

    Donatore plasmidi † Recupero plasmidi Transconjugants ‡ § (cellule mL -1) L'accoppiamento Efficiency§ ||
    pOX38-Tc ΔtraF :: Cm Nessuna 0 0
    pOX38-Tc ΔtraF :: Cm pK184 0 0
    pOX38-Tc ΔtraF :: Cm pK184-traffico 5 x 10 3 0,0167
    pOX38-Tc ΔtraF :: Cm pK184-TRAF 55-247 0 0
    * Tabella adattata da Lento et al. 2016 35 con il permesso
    † cellule donatrici erano E. coli XK1200, con una concentrazione media di 3 x 10 7 cellule mL -1
    ‡ cellule riceventi erano E. coli MC4100. Il numero di transconjugants per il controllo positivo è da una diluizione 10-5. 0 indica nessun transconjugants da una diluizione 10-2.
    media §An da due a quattro esperimenti di accoppiamento sono stati eseguiti per ogni costrutto.
    || Efficienza accoppiamento è definEd come transconjugants per 100 cellule del donatore. 0 efficienza di accoppiamento indica nessun transconjugants da una diluizione 10-2

    Tabella 3: Abolito l'efficienza di accoppiamento da traffico cancellazione costrutti.

    Subscription Required. Please recommend JoVE to your librarian.

    Discussion

    processo Coniugazione batterica fornisce un mezzo attraverso il quale i batteri possono diffondersi geni mediante un vantaggio evolutivo di crescita in ambienti difficili, come la diffusione di marcatori di resistenza agli antibiotici. Poiché molti dei plasmidi coniugativi sono così grandi, 12 studi funzionali sulle proteine coinvolte nel montaggio del dispositivo di trasferimento attraverso la mutazione di geni bersaglio sul plasmide coniugativo si sono ingombranti. I protocolli descritti qui forniscono un mezzo attraverso il quale si può più facilmente valutare il gene bersaglio di interesse attraverso l'uso di piccole, plasmidi di espressione più maneggevoli (Figura 1). Impieghiamo il plasmide F derivato pOX38-Tc (Tabella 1) per studiare F coniugazione plasmide-mediata; altri plasmidi coniugazione possono essere studiate usando i protocolli descritti qui e opportuni plasmidi derivati. I saggi di accoppiamento descritte sono state adattate da Frost e colleghi, 42 con alcuni Modifications. In studi precedenti, 8,33,42 la creazione del costrutto pOX38-Tc Δgene :: Cm è stato ottenuto con l'adesione del gene di interesse con gli enzimi di restrizione appropriati e l'inserimento della cassetta CAT amplificato in pOX38-Tc. 42 Nel metodo attuale, impiegano ricombinazione omologa nel recombineering ceppo di E. coli DY330R 33,34 per knockout gene bersaglio e sostituirlo con la cassetta CAT. Questo ha un vantaggio di consentire ceppo DY330R risultante ospitare il pOX38-Tc Δgene :: Cm costrutto di agire come un controllo per il knockout gene-specifico out F-T4SS mediata trasferimento conjugative tramite il recupero di trasferimento usando il plasmide recupero pK184-gene . Mentre può essere possibile generare fori utilizzando una metodologia più nitide-Cas9, 43 non abbiamo in questo momento esplorato questa possibilità.

    Il processo inizia con la generazione di un knockout gene nel plasmide derivato F pOX38-Tc (Figure 1). Ciò è ottenuto mediante ricombinazione omologa in cellule DY330R (Tabella 1), altri ceppi con caratteristiche simili come DY329, DY331 e DY378 possono anche essere utilizzati. Primer sono inizialmente progettati per PCR amplificare il cassetto CAT dal plasmide pBAD33 32 e contenere sovrastante basi che sono specifici per il gene bersaglio (Tabella 2); il prodotto di PCR è poi elettroporate in cellule che ospitano DY330R pOX38-Tc. ricombinazione omologa genera il knock-out plasmide pOX38-Tc Δgene :: Cm in cui è inserita la cassetta CAT in-frame all'interno del gene bersaglio, interrompendo efficacemente T4SS assemblaggio e la coniugazione fornendo al contempo la resistenza Cm. Allo stesso tempo, il gene bersaglio è PCR amplificato da pOX38-Tc e inserito in un piccolo plasmide di espressione; in questo protocollo che usiamo pK184 per l'espressione costitutiva, tuttavia si potrebbe scegliere un plasmide con l'espressione inducibile del gene bersaglio se lo si desidera. Il plasmide pK184-gene viene poi trasformatonelle cellule DY330R pOX38-Tc Δgene :: Cm, e queste cellule vengono poi utilizzati come donatori per trasferire il pOX38-Tc Δgene :: Cm costruire tramite coniugazione in XK1200 cellule per saggi di accoppiamento. Nei saggi di accoppiamento, le cellule del donatore e del ricevente sono XK1200 pOX38-Tc Δgene :: rispettivamente Cm e MC4100,. Il plasmide recupero pK184-gene, così come i mutanti serie del gene bersaglio (delezioni o mutazioni puntiformi), è fornita alle cellule del donatore per valutare la loro capacità di ripristinare l'accoppiamento, e determinare la sua efficienza, con cellule riceventi MC4100 (Figura 2 ; Tabella 3).

    Fondamentale per il procedimento è l'uso di donatori appropriato e ceppi riceventi (Tabella 1), e il disegno dei primer utilizzati. Per ciascun primer progettato, ci sono linee guida generali che dovrebbero essere seguite. Mentre noi cerchiamo di rispettare rigorosamente con il contenuto GC 40-60%, questo potrebbe non essere sempre possibile. In tali casi, è discrezione dello sperimentatore per testare un primer wcontenuto GC-esimo leggermente al di sotto o al di sopra di questo intervallo. La temperatura di fusione (Tm) del primer forward e reverse deve essere simile, e la temperatura di ricottura (T a) valore deve essere sempre inferiore alla T m da 2-5 ° C per PCR. L'energia libera disponibile per consentire una forcina per sviluppare dovrebbe essere molto inferiore alla T a, mentre la omo e etero dimerizzazione T m 's deve essere molto bassa (inferiore a -10 kJ e 30 ° C). Primer possono essere progettati per sondare delezioni, inserzioni o mutazioni puntiformi, se lo desideri. Naturalmente è fondamentale che il gene costrutto risultante amplificato e ligato nel plasmide recupero in-frame tale che sia ben espresso. Trasformazione di cellule competenti può essere fatto tramite elettroporazione o shock termico utilizzando cellule electrocompetent o chimicamente competenti, rispettivamente. Troviamo che l'elettroporazione è più efficiente per i costrutti più grandi come pOX38-Tc e la oligonucle ricombinazione omologaotide, mentre i plasmidi di espressione più piccoli come pK184-traffico possono essere facilmente trasformate in cellule con metodi da shock termico. Infine, è importante ricordare che ci saranno più antibiotici in uso nel protocollo, come entrambi i ceppi donatore e ricevente richiedono differenti resistenze che sono diversi da quelli impiegati sulle coniugazione e recupero plasmidi.

    A parte le tecniche saggi accoppiamento qui descritte, ci sono altri metodi che vengono utilizzati per studiare coniugazione batterica, che variano leggermente nel loro approccio. trasferimento genico orizzontale è un processo in cui i batteri trasferiscono una plasmide ad una cellula ricevente, compresi interspecie destinatari. 44 Uno studio di Dahlberg e colleghi 44, ad esempio, utilizzato coniugazione batterica per determinare l'entità del interspecie trasferimento genico orizzontale. Hanno utilizzato l'incorporazione di proteina fluorescente verde (GFP) in un plasmide clonato in cellule KT2442; il cromosomica lAC I q gene nelle cellule KT2442 reprimere l'espressione della GFP. Quando la GFP trasporta plasmide viene trasferito ad una specie senza il gene lac I q, si osserva la fluorescenza. 44 Nonostante la sua limitazione per fornire specifica funzione della proteina in varie specie, l'esperimento interspecie coniugazione potrebbe essere accoppiato con i protocolli presentati qui per fare previsioni evolutive per le interazioni proteina-proteina tra specie diverse.

    Subscription Required. Please recommend JoVE to your librarian.

    Disclosures

    Gli autori dichiarano di non avere interessi finanziari concorrenti.

    Acknowledgments

    Questa ricerca è stata sostenuta da una sovvenzione da parte del Discovery Sciences & Engineering Consiglio Naturale del Canada (NSERC).

    Materials

    Name Company Catalog Number Comments
    GeneJet Plasmid Mini-Prep Kit Fisher Scientific K0503
    GeneJet Gel Extraction Kit Fisher Scientific K0692
    GeneJet PCR Purification Kit Fisher Scientific K0702
    Q5 Site-Directed Mutagenesis Kit New England Biolabs E0554S
    Broad Range DNA Ladder New England Biolabs N0303A
    Petri Dishes Fisher Scientific FB0875713
    Electroporator Eppendorf 4309000027
    Electroporation cuvettes Fisher Scientific FB101 Cuvettes have a 1 mm gap.
    Enzymes
    AvaI New England Biolabs R0152S
    EcoRI New England Biolabs R0101S
    HindIII New England Biolabs R0104L
    NdeI New England Biolabs R0111S
    Phusion DNA Polymerase New England Biolabs M0530L
    T4 DNA Ligase New England Biolabs M0202S
    DpnI New England Biolabs R0176S
    Antibiotics Final Concentrations
    Chloramphenicol (Cm) Fisher Scientific BP904-100 20 µg/mL
    Kanamycin (Km) BioBasic Inc. DB0286 50 µg/mL
    Nalidixic acid (Nal) Sigma-Aldrich N8878-25G 10 µg/mL
    Rifampicin (Rif) Calbiochem 557303 20 µg/mL
    Tetracycline (Tc) Fisher Scientific BP912-100 10 µg/mL
    Streptomycin (Sm) Fisher Scientific BP910-50 50 µg/mL

    DOWNLOAD MATERIALS LIST

    References

    1. Dobrindt, U., Hochhut, B., Hentschel, U., Hacker, J. Genomic islands in pathogenic and environmental microorganisms. Nat Rev Microbiol. 2, (5), 414-424 (2004).
    2. Furuya, E. Y., Lowy, F. D. Antimicrobial-resistant bacteria in the community setting. Nat Rev Microbiol. 4, (1), 36-45 (2006).
    3. Griffiths, A., Miller, J., Suzuki, D., Lewontin, R., Gelbart, W. An Introduction to Genetic Analysis, 7th Edition. W.H. Freeman. San Fransisco. (2000).
    4. Cooper, T. F. Recombination Speeds Adaptation by Reducing Competition between Beneficial Mutations in Populations of Escherichia coli. PLoS Biol. Barton, N. H. 5, (9), 225 (2007).
    5. Lujan, S. A., Guogas, L. M., Ragonese, H., Matson, S. W., Redinbo, M. R. Disrupting antibiotic resistance propagation by inhibiting the conjugative DNA relaxase. Proc Natl Acad Sci. 104, (30), 12282-12287 (2007).
    6. Carattoli, A. Plasmids and the spread of resistance. Int J Med Microbiol. 303, (6-7), 298-304 (2013).
    7. Shala, A., Ferraro, M., Audette, G. F. Bacterial Secretion Systems: Nanomachines for Infection and Genetic Diversity. Handbook of Clinical Nanomedicine: Nanoparticles, Imaging, Therapy and Clinical Applications. Bawa, R., Audette, G. F., Rubenstein, I. Pan Sanford Publishing. Singapore. 657-686 (2016).
    8. Tseng, T. T., Tyler, B. M., Setubal, J. C. Protein secretion systems in bacterial-host associations, and their description in the Gene Ontology. BMC Microbiol. 9, (1), Suppl 1 2 (2009).
    9. Alvarez-Martinez, C. E., Christie, P. J. Biological diversity of prokaryotic type IV secretion systems. Microbiol Mol Biol Rev. 73, (4), 775-808 (2009).
    10. Lawley, T. D., Klimke, W. A., Gubbins, M. J., Frost, L. S. F factor conjugation is a true type IV secretion system. FEMS Microbiol Lett. 224, (1), 1-15 (2003).
    11. Lederberg, J., Tatum, E. L. Gene Recombination in Escherichia Coli. Nature. 158, (4016), 558-558 (1946).
    12. Smillie, C., Garcillan-Barcia, M. P., Francia, M. V., Rocha, E. P. C., de la Cruz, F. Mobility of Plasmids. Microbiol Mol Biol Rev. 74, (3), 434-452 (2010).
    13. Willetts, N., Skurray, R. The Conjugation System of F-Like Plasmids. Annu Rev Genet. 14, (1), 41-76 (1980).
    14. Frost, L. S., Ippen-Ihler, K., Skurray, R. A. Analysis of the sequence and gene products of the transfer region of the F sex factor. Microbiol Rev. 58, (2), 162-210 (1994).
    15. Audette, G. F., Manchak, J., Beatty, P., Klimke, W. A., Frost, L. S. Entry exclusion in F-like plasmids requires intact TraG in the donor that recognizes its cognate TraS in the recipient. Microbiology. 153, Pt 2 442-451 (2007).
    16. Christie, P. J., Atmakuri, K., Krishnamoorthy, V., Jakubowski, S., Cascales, E. Biogenesis, Architecture, and Function of Bacterial Type Iv Secretion Systems. Annu Rev Microbiol. 59, (1), 451-485 (2005).
    17. Christie, P. J. Type IV secretion: the Agrobacterium VirB/D4 and related conjugation systems. Biochim Biophys Acta - Mol Cell Res. 1694, (1-3), 219-234 (2004).
    18. Bhatty, M., Laverde Gomez, J. a, Christie, P. J. The expanding bacterial type IV secretion lexicon. Res Microbiol. 164, (6), 620-639 (2013).
    19. Christie, P. J., Cascales, E. Structural and dynamic properties of bacterial Type IV secretion systems (Review). Mol Membr Biol. 22, (1-2), 51-61 (2005).
    20. Christie, P. J. Type IV secretion: Intercellular transfer of macromolecules by systems ancestrally related to conjugation machines. Mol Microbiol. 40, (2), 294-305 (2001).
    21. Christie, P. J., Whitaker, N., González-Rivera, C. Mechanism and structure of the bacterial type IV secretion systems. Biochim Biophys Acta. 1843, (8), 1578-1591 (2014).
    22. Cascales, E. The type VI secretion toolkit. EMBO Rep. 9, 735 (2008).
    23. Silverman, J. M., Brunet, Y. R., Cascales, E., Mougous, J. D. Structure and Regulation of the Type VI Secretion System. Annu Rev Microbiol. 66, (1), 453-472 (2012).
    24. Chandran, V., et al. Structure of the outer membrane complex of a type IV secretion system. Nature. 462, (7276), 1011-1015 (2009).
    25. Rivera-Calzada, A., et al. Structure of a bacterial type IV secretion core complex at subnanometre resolution. EMBO J. 32, (8), 1195-1204 (2013).
    26. Waksman, G., Fronzes, R. Molecular architecture of bacterial type IV secretion systems. Trends Biochem Sci. 35, 691 (2010).
    27. Fronzes, R., Christie, P. J., Waksman, G. The structural biology of type IV secretion systems. Nat Rev Microbiol. 7, (10), 703-714 (2009).
    28. Kaplan, M., et al. Probing a cell-embedded megadalton protein complex by DNP-supported solid-state NMR. Nat Methods. 12, (7), 5-9 (2015).
    29. Guyer, M. S., Reed, R. R., Steitz, J. A., Low, K. B. Identification of a sex-factor-affinity site in E. coli as gamma delta. Cold Spring Harb Symp Quant Biol. 45, Pt 1 135-140 (1981).
    30. Anthony, K. G., Sherburne, C., Sherburne, R., Frost, L. S. The role of the pilus in recipient cell recognition during bacterial conjugation mediated by F-like plasmids. Mol Microbiol. 13, (6), 939-953 (1994).
    31. Jobling, M. G., Holmes, R. K. Construction of vectors with the pl5a replicon, kanamycin resistance, inducible lacZα and pUC18 or pUC19 multiple cloning sites. Nucleic Acids Res. 18, (17), 5315 (1990).
    32. Guzman, L. M., Belin, D., Carson, M. J., Beckwith, J. Tight regulation, modulation, and high-level expression by vectors containing the arabinose P(BAD) promoter. J Bacteriol. 177, (14), 4121-4130 (1995).
    33. Yu, D., et al. An efficient recombination system for chromosome engineering in Escherichia coli. Proc Natl Acad Sci U S A. 97, (11), 5978-5983 (2009).
    34. Lawley, T. D., Gilmour, M. W., Gunton, J. E., Standeven, L. J., Taylor, D. E. Functional and Mutational Analysis of Conjugative Transfer Region 1 (Tra1) from the IncHI1 Plasmid R27. J Bacteriol. 184, (8), 2173-2180 (2002).
    35. Elton, T. C., Holland, S. J., Frost, L. S., Hazes, B. F-Like Type IV Secretion Systems Encode Proteins with Thioredoxin Folds That Are Putative DsbC Homologues. J Bacteriol. 187, (24), 8267-8277 (2005).
    36. Hazes, B., Frost, L. Towards a systems biology approach to study type II/IV secretion systems. Biochim Biophys Acta. 1778, 1839-1850 (2008).
    37. Lento, C., Ferraro, M., Wilson, D., Audette, G. F. HDX-MS and deletion analysis of the type 4 secretion system protein TraF from the Escherichia coli F plasmid. FEBS Lett. Tsolis, R. 590, (3), 376-386 (2016).
    38. Audette, G. F., Van Schaik, E. J., Hazes, B., Irvin, R. T. DNA-binding protein nanotubes: Learning from nature's nanotech examples. Nano Lett. 4, 1897-1902 (2004).
    39. Harris, R. L., Silverman, P. A. Tra proteins characteristic of F-like type IV secretion systems constitute an interaction group by yeast two-hybrid analysis. J Bacteriol. 186, (16), 5480-5485 (2004).
    40. Moore, D., et al. Characterization of the F-Plasmid Conjugative Transfer Gene traU. J Bacteriol. 172, (8), 4263-4270 (1990).
    41. Anthony, K. G., Sherburne, C., Sherburne, R., Frost, L. S. The role of the pilus in recipient cell recognition during bacterial conjugation mediated by F-like plasmids. Mol Microbiol. 13, (6), 939-953 (1994).
    42. Klimke, W. A., Frost, L. S. Genetic analysis of the role of the transfer gene, traN, of the F and R100-1 plasmids in mating pair stabilization during conjugation. J Bacteriol. 180, (16), 4036-4043 (1998).
    43. Jiang, W., Marraffini, L. A. CRISPR-Cas: New Tools for Genetic Manipulations from Bacterial Immunity Systems. Annu Rev Microbiol. 69, (1), 209-228 (2015).
    44. Dahlberg, C., Bergstrom, M., Andreasen, M., Christensen, B. B., Molin, S., Hermansson, M. Interspecies bacterial conjugation by plasmids from marine environments visualized by gfp expression. Mol Biol Evol. 15, (4), 385-390 (1998).

    Comments

    0 Comments


      Post a Question / Comment / Request

      You must be signed in to post a comment. Please or create an account.

      Usage Statistics