Conjugadas acasalamento Os ensaios para a análise específica da sequência de proteínas de transferência envolvidos na conjugação bacteriana

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Erdogan, F., Lento, C., Yaseen, A., Nowroozi-Dayeni, R., Kheyson, S., Audette, G. F. Conjugative Mating Assays for Sequence-specific Analysis of Transfer Proteins Involved in Bacterial Conjugation. J. Vis. Exp. (119), e54854, doi:10.3791/54854 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

A transferência de genes e proteínas ao nível micro-organismo ao desempenha um papel central na sobrevivência e evolução bacteriana, bem como processos de infecção. A troca do ADN entre as bactérias ou entre uma bactéria e uma célula pode ser conseguido através de transformação, conjugação ou transdução de vector. Conjugação 1,2 é único em comparação com a transformação e transdução em que durante a conjugação entre as bactérias gram-negativas tais como Escherichia coli, a transferência de ADN ocorre de um modo controlado-doador no qual um sistema macromolecular complexa liga células dadoras e receptoras. A conjugação é também a maneira mais direta em que as células bacterianas interagem com as células hospedeiras para injetar genes, proteínas ou produtos químicos para sistemas host. 3 Muitas vezes, a transferência desses agentes tem efeitos notáveis sobre o anfitrião, que vão desde patogenia e carcinogênese para hospedar evolução e adaptação. Tem sido demonstrado que recombinatio conjugativon aumenta a taxa de adaptação 3 vezes em bactérias com taxas de mutação elevadas sob condições de stress ambiental. 4 Além disso, a conjugação é de longe a via mais comum, através do qual os genes de resistência a antibióticos em estirpes bacterianas são distribuídos. 5,6

Os microrganismos têm evoluído sistemas de secreção especializados para suportar a transferência de macromoléculas através das membranas celulares; existem actualmente 9 tipos de sistemas de secreção (TSSs) em bactérias gram-negativas que foram descritos: T1SS, T2SS, T3SS, T4SS, T5SS, T6SS, T7SS, bem como a SEC (secreção) e Tat (de dois arginina translocação) vias. 7,8 Cada tipo de sistema de secreção é dividido em diferentes subtipos, uma necessidade devido à diversidade de proteínas e o carácter distintivo de caminhos envolvidos, em diferentes estirpes bacterianas. Por exemplo, no sistema de secreção de tipo IV (T4SS), os sistemas de Ti e facilitar o transporte CAG efector ao passo que a F-plasmídeo, R27 umnd pKM101 T4SSs facilitar a transferência de um plasmídeo conjugada. 7,9,10 uma compreensão detalhada dos mecanismos pelos quais os organismos montam os seus respectivos sistemas de secreção de proteínas a partir de seus componentes e partilham conteúdo celular com um receptor ou o seu ambiente circundante é um factor importante no desenvolvimento de estratégias que apontam para combater microrganismos patogénicos e processos de infecção celular.

Após a conjugação bacteriana identificação inicial em E. coli por Lederberg & Tatum, 11 de um grande número de plasmídeos conjugativos móveis e têm sido identificadas e caracterizadas. 12 Tais plasmídeos móveis mostrar considerável gama é de tamanho (de 1 a mais de 200 quilobases (kb)), no entanto, todos os plasmídeos móveis contêm um relaxase, que reconhece a origem de transferência (oriT) permitindo assim a transmissão do plasmídeo. Os plasmídeos conjuntivos mais genes codificam para a montagem de um T4SS funcional, bem como um tipoproteína de ligação IV. 12 Por exemplo, a 100 kb F plasmídeo de E. coli codifica todos os genes conjugadas dentro de uma transferência de 33,3 kB (tra) região. 13 Os genes na região do tra do plasmídeo codifica F todas as proteínas que facilitam a formação de pilus, Acasalamento formação de pares (MPF), a transferência de DNA e as funções de exclusão durante a transferência de plasmídeo conjugada. 10,14,15 Um corpo significativo de conhecimento está disponível para T4SSs conjugada, porém detalhado estudos estruturais das proteínas conjugadas e complexos só são mais recentemente se tornando disponíveis. 16-28

Para montar uma visão abrangente do processo conjugada, é necessário um acoplamento de estudos estruturais detalhados para mutacional análises de proteínas de transferência conjugadas. Isto pode ser conseguido através de ensaios de encaixe conjugadas. Para o plasmídeo F, cada proteína codificada dentro da região de TRA desempenha um papel na co-F mediadanjugation; por conseguinte, o nocaute / eliminação de um gene de transferência vai abolir a capacidade conjugadas das células (Figura 1). Enquanto plasmídeos celulares mais pequenas são mais conducentes para procedimentos de eliminação padrão, por plasmídeos conjugativos maiores, tais como F, nocaute de genes são mais prontamente conseguidas através de recombinação homóloga em que o gene alvo é substituída com uma transmissão de um gene de resistência a antibiótico distinta. No protocolo atual, que empregam recombinação homóloga para substituir um gene transfer de interesse com cloranfenicol acetiltransferase (CAT) na 55 kb F plasmídeo derivado pOX38-Tc; 29,30 nocaute o plasmídeo resultante, pOX38-Tc :: Δgene Cm, facilita a resistência à presença de cloranfenicol (Cm) no meio de crescimento. células dadoras que albergam pOX38-Tc :: Δgene cm são incapazes de afectar conjugativo transferência de ADN / acasalamento como observado através da utilização de um ensaio de acoplamento; a eficácia de acoplamento de uma célula doadora pOX38-Tc Δgene :: cm e uma recip normaistário vai diminuir ou, mais frequentemente, ser abolido. transferência conjugativa do plasmídeo pOX38-Tc :: Δgene cm pode ser restaurada por meio de uma pequena recuperação de plasmídeo que alberga o gene alvo de transferência. Este plasmídeo de recuperação pode ser uma que proporciona a expressão constitutiva, tal como pK184 plasmídeo (pK184-gene), 31 ou um que fornece expressão indutível enquanto que o plasmídeo alvo correctamente o gene para a localização correcta no interior da célula (citoplasma ou periplasma). Consequentemente, em ensaios de acasalamento entre este novo doador (abrigando pOX38-Tc Δgene plasmídeos :: Cm + pK184 de gene) e uma célula receptora, a eficiência de acoplamento é esperado para restaurar a quase que de um ensaio de acoplamento doador-receptor normal. Este sistema permite uma para sondar a função do gene eliminado por meio da geração de uma série de construções pK184-Gene (deleções ou mutações pontuais) e testando a capacidade de cada construção para restaurar a capacidade de acoplamento do pOX38-Tc Δgene :: Cm abrigando célula doadoras.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Produção de construções de ADN

  1. Designing Oligómeros para recombinação homóloga do gene alvo
    1. Design um único oligómero de 55-72 pb para a frente como se segue: (a) escolher uma sequência de nucleótidos de comprimento 19-32 pb que é homóloga a uma sequência de ADN na região de 10-100 pb a montante do local de início da extremidade 5 'do gene da cloranfenicol-acetiltransferase no plasmídeo pBAD33 comercial, 32 e (b) seleccionar um nucleótido 36-54 pb de comprimento sequência homóloga a uma região de 10-150 pb a jusante do local de iniciação a 5 'do gene alvo de interesse.
      1. Junte-se "fim da sequência de nucleótidos colhidos em (b) à extremidade 5 'da 3 extremidade da sequência de nucleótidos colhidos em (a), dando assim um único oligómero 55-72 longo para a frente.
    2. Design um único oligómero de 55-72 pb reversa como segue: (a) escolher uma sequência de nucleótidos de comprimento 19-32 pb que é homóloga a uma sequência de ADN na região de 10-100 pb a jusanteda extremidade 3 'do gene da cloranfenicol no plasmídeo pBAD33 comercial, e (b) seleccionar um nucleótido 36-54 pb de comprimento sequência homóloga a uma região dentro de 10-150 pb a montante da extremidade 3' local do gene alvo de interesse .
      1. Junte-se ao "fim da sequência de nucleotídeos colhidas em (b) a 5 'a 3 fim da sequência de nucleótidos colhidas em (a) para torná-lo uma única oligômero.
      2. Copiar este oligómero para qualquer software de bioinformática disponíveis e convertê-sequência para o seu complemento inverso. Isto lhe dará um único 55-72 pb de comprimento oligômero inversa.
    3. O uso de qualquer programa de oligo-analisador disponível, verifique se os oligômeros de recombinação têm conteúdo GC entre 40-60%, temperatura de fusão baixo hairpin (T m), baixa auto e hetero-dimerização T m 's. Encomendar os primers para a síntese e expedição de qualquer empresa de biotecnologia preferido.
  2. Amplificação do Cassette CAT de pBAD33 (Cm R
  3. Crescer uma cultura durante a noite (O / N, 16-18 h) de células DH5a portadoras do plasmídeo pBAD33 em caldo estéril Lisogenia (LB) com 20 ug / ml de cloranfenicol (Cm) com agitação a 200 rpm e 37 ° C.
  4. Centrifugar 6-8 mL da cultura O / N à temperatura ambiente, 5,000 xg durante 3 min. Decantar o sobrenadante e extrai-se o plasmídeo pBAD33 a partir do sedimento utilizando um kit de plasmídeo mini-prep (Materiais Tabela) e o protocolo do fabricante.
  5. Fazer uma digestão do ADN do plasmídeo pBAD33 adicionando o seguinte num tubo estéril na ordem dada: volume adequado de água bidestilada (ddH2O) para um volume final de 50 ul, o volume de 1 ug de plasmídeo pBAD33, 5 pL de 10x de tampão de reacção de enzima, e 0,5 ul de enzima de restrição Aval (RE). Misturar suavemente por pipetagem e deixar a reacção prosseguir durante 1 h a 37 ° C. Inactivar pelo calor da reacção durante 20 minutos (min) a 80° C. Armazene as amostras a -20 ° C para não mais de 24 h para minimizar a degradação sticky-end.
  6. Prepara-se uma agarose a 1,2% gel de separação por mistura de 1,2 g de agarose com 100 mL de 1x TAE (Tris 40 mM, pH 8,5, ácido acético 20 mM; EDTA 1 mM) em tampão de um balão de Erlenmeyer de 250 mL. Calor e agitar para dissolver completamente num forno de microondas. Pare o aquecimento imediatamente quando o líquido começa a ferver e agite o frasco.
    1. Arrefece-se a agarose líquido durante 3 min, à temperatura ambiente durante a agitação, adicionar 2 mL de 10 mg / mL de brometo de etídio e agite para misturar. Verter a agarose para um tabuleiro de gel com um pente bem e permitir que ele solidificar durante 1 h a temperatura ambiente. géis armazenar a 4 ° C por até 2 dias em tampão 1 x TAE.
  7. Misturar cada RE digerir a partir de 1.2.3 com 0,2 volume de corante de carga de ADN (10? L de corante por reacção de 50 uL) por pipetagem. Carga de 5 mL de 500 ug / ml de ADN em escada o primeiro poço e toda a mistura RE Digest-corante no outro poço na umgel garose. Use 2-3 poços para carregar todo o volume de reacção para o gel.
    1. Submeter o gel mal submerso em tampão 1x TAE e operando a 45-50 V (4,5-5 V / cm) durante 65 minutos num dispositivo de electroforese em gel.
  8. Usando um armário de UV e uma lâmina de barbear estéril, rapidamente cortar a banda de 2,8 kb que corresponde à sequência de gato para fora do gel para minimizar a exposição à radiação UV de ADN. Extrai-se a DNA a partir da fatia de gel de corte usando um kit de extracção em gel (Tabela Materiais) de acordo com o protocolo do fabricante.
    Nota: Tenha cuidado para não expor a pele diretamente sob UV e lidar com a navalha com cuidado.
  9. Amplificar a cassete de CAT a partir de 1.2.6 extraída por Reacção em Cadeia da Polimerase (PCR) utilizando os iniciadores concebidos em 1,1 que contêm saliências homólogas à sequência do gene para permitir a recombinação homóloga. As reacções de PCR são configurados em gelo utilizando as orientações do fabricante (Materiais Tabela) na seguinte ordem:
    1. Dentro detubo de PCR estéril, adicionar um volume apropriado de ddH2O para um volume final de 50 mL, seguida por 10 ul de tampão PCR, 1 ul de dNTPs 10 mM, 2,5 uL de 10 mM Iniciador directo, 2,5 mL de 10 mM de primer reverso , 1-25 ng de ADN molde a partir de 1.2.6 e de 0,5 mL de 100 unidades / mL de polimerase de ADN.
    2. Defina-se um controlo negativo que leva os mesmos componentes que 1.2.7.1 mas com a excepção de ADN molde. Utilizar um volume apropriado de ddH2O, em vez de ADN molde. Configurar um controlo positivo utilizando DNA e primers que têm sido comprovada para trabalhar em uma reação de PCR, tais como os fornecidos como controle positivo pelo fabricante do modelo.
    3. Misture todos os conteúdos da reacção suavemente por pipetagem.
    4. Amplificar por PCR utilizando os seguintes ajustes: desnaturação inicial de 30 segundos a 98 ° C, 30 ciclos de desnaturação durante 10 s a 98 ° C, hibridação do iniciador durante 20 s, extensão durante 20 s por quilobase de amplicão a 72 ° C e um barbatanaai extensão durante 10 minutos a 72 ° C. Armazene as amostras a -20 ºC.
  10. Confirmar o tamanho correcto de amplificação através de electroforese em gel de agarose (ver 1.2.4-1.2.5), utilizando apenas 5 uL de cada reacção. Purifica-se o fragmento amplificado por PCR utilizando um kit de purificação de PCR e o protocolo do fabricante. Loja ADN purificado a -20 ° C.
  • O plasmídeo pK184 Recuperação do gene
    1. Conceber um iniciador directo começando a partir da sua extremidade 5 'e vai no sentido da extremidade 3', na seguinte ordem: (a) escolher 4 nucleótidos aleatórios (uma combinação de adenina, timina, guanina e citosina) para a eficiência de clivagem, ligado a (b) a enzima de restrição EcoRI (RE) sequência do local de corte (GAATTC), seguido por (c) uma sequência de nucleótidos de comprimento 21-25 pb que é homóloga com a extremidade 5 'do gene de interesse, incluindo o codão de iniciação. Se o gene alvo contém um sítio EcoRI, escolher um outro RE apropriado do pK184 local de clonagem múltipla.
    2. No caso de os genes que codificam as proteínas periplasmáticas, incluem uma sequência de comando adicional entre o local RE e o codão de iniciação no iniciador de sentido directo.
    3. O uso de qualquer oligo-analisador disponível, verifique se os iniciadores têm conteúdo GC entre 40-60%, hairpin T f baixa, baixa auto e hetero-dimerização T m 's. Encomendar os primers para a síntese.
    4. Crescer uma cultura O / N de células DY330R pOX38-TC em estéril LB contendo 10 ug / ml de tetraciclina (Tc) com agitação a 32 ° C e 200 rpm. Centrifugar 6-8 mL da cultura O / N à temperatura ambiente, 5,000 xg durante 3 min. Decantar osobrenadante e extrai-se o ADN plasmídico a partir do sedimento utilizando um kit de plasmídeo mini-prep (Materiais Tabela) e o protocolo do fabricante.
    5. Amplificar o gene completo de interesse com os iniciadores de 1.3.1-1.3.5 usando pOX38-Tc como o modelo (ver 1.2.7.1-1.2.7.3).
    6. Confirmar o tamanho correcto de amplificação através de electroforese em gel de agarose (ver 1.2.4-1.2.5), utilizando apenas 5 uL de cada reacção. Purifica-se o ADN amplificado utilizando um kit de purificação de PCR e o protocolo do fabricante. Loja ADN purificado a -20 ° C.
    7. Fazer uma digestão dupla de ambos o ADN de plasmídeo pK184 disponíveis comercialmente e o gene amplificado (a partir de 1.3.7.), Por adição do seguinte a um tubo de ensaio estéril na ordem dada: volume apropriado de ddH2O para um volume final de 50 uL , um volume de ug do plasmídeo pK184, 5 uL de tampão de reacção de enzima 10x e 1 ul de cada EcoRI e HindIII.
      1. Misture delicadamente por pipetagem e deixar a reacção prosseguir durante 1 ha 37 ºC. Inactivar pelo calor a reacção durante 20 min a 80 ºC. Armazene as amostras a -20 ° C para não mais de 24 h para minimizar a degradação sticky-end.
        Nota: O tipo de nuclease de restrição usada aqui depende do local de restrição com nuclease que foi manipulado para os iniciadores em etapas 1.3.1 e 1.3.2.
      2. Como um controlo positivo, configurar digestões simples do plasmídeo pK184, preparando a mesma reacção que no 1.3.8, excepto adicionar apenas um dos ERs para um tubo de reacção. Fazer isso separadamente com ambos os REs.
    8. Executar as digestões sobre um gel de agarose a 1,2% utilizando protocolos 1.2.4-1.2.5 Extrai-se a ADN de dupla digerir fragmentos de ambos pK184 e o gene de interesse de acordo com o passo 1.2.6.
    9. Ligadura a inserção do gene no vector pK184 pela adição de componentes para um tubo estéril na seguinte ordem: 2 pL de 10x tampão de ligase de ADN de T4, num total de 100 ng de ADN composto de uma mistura 1: vector de 3: inserir (pK184: gene) razão, ddH2O até umvolume total de 20 ul e 1 ul da ligase do DNA de T4. Como um controlo negativo, definir-se uma reacção similar, usando 100 ng de vector sem o gene de inserção.
      1. Homogeneizar todos os conteúdos da reacção utilizando uma micropipeta e incubar durante 30 min a 25 ° C. Calor-inactivar a reacção de ligação durante 10 minutos a 65 ° C e, em seguida, colocar em gelo.
    10. Enquanto em gelo, adicionar 15 ul do pK184-gene reacção de ligação a partir do passo 1.3.10 a 100 ul de células competentes DH5a quimicamente em um tubo de 1,5 ml estéril. Misturar suavemente por pipetagem e incubar em gelo durante 10 min. Faça o mesmo para a amostra de controlo negativo. Para um controlo positivo, usar 20-100 ng de um plasmídeo, tal como pBAD33 e transformá-la em 50 ul de células DHα.
    11. Transferir directamente as amostras de gelo para um banho de água a 42 ° C e incubar durante 90 segundos. Isto proporciona as células de um choque de calor e permite-lhes a absorção do ADN plasmídeo.
    12. células lugar de volta no gelo para outra5 min e, em seguida, adicionar 900 mL de LB estéril Incubar a 37 ° C durante 1 hora, agitando a 125 rpm.
    13. Alíquota um volume de 100 uL de amostra a partir de cada reacção de ligação em 1.3.13 sobre uma placa de agar contendo 50 ug / ml de canamicina (km) e espalhar as células usando um espalhador estéril. A placa de controlo positivo deve ter antibióticos adequados. Mantenha a área estéril e trabalhar perto de uma chama. Incubar a placa de cabeça para baixo, a 37 ° C durante a noite.
    14. Usando uma pipeta ou ansa estéril, colher uma única colónia distinta de células e inocular um mL estéril LB 20 com 50 ng / mL Km. Mantenha a área estéril e trabalhar perto de uma chama. Crescer as células O / N a 37 ° C com agitação a 200 rpm.
    15. Adicione 3-5 estoques de glicerol de DH5a as células transformadas através da mistura de 500 mL da cultura D / N com 500 mL de solução estéril de glicerol 100% (final de 50% v / v) em crio-tubos estéreis. Armazenar a -80 ° C.
    16. Também centrífuga 6-8 mL de O / N a cultura à temperatura ambiente, 5,000 xg durante 3 min. Decantar o sobrenadante e extrai-se o plasmídeo pK184 recuperação do gene a partir do sedimento utilizando um kit de plasmídeo mini-prep (Materiais Tabela) e o protocolo do fabricante.
  • pK184 - mutantes do gene
    Nota: Os iniciadores concebidos para a deleções, inserções e / ou mutações pontuais pode ser facilmente gerada utilizando ferramentas de linha disponíveis do fabricante.
    1. Conceber cada iniciador de sentido directo, escolhendo uma sequência longa de nucleótidos 18-32 pb que é homóloga com a extremidade 5 'do gene de interesse, incluindo o codão de iniciação. iniciadores de desenho de tal modo que cada iniciador directo liga-se 30-180 pb a jusante do anterior, resultando em mutantes de deleção que faltam fragmentos peptídicos N-terminais de comprimentos adequados.
    2. Conceber um iniciador inverso, escolhendo uma sequência de nucleótidos de comprimento 18-32 pb que é homóloga com a extremidade 3 'do gene de interesse, incluindo o codão de paragem. Copie esta cartilha em umny programa de bioinformática disponíveis e converter a seqüência em seu complemento inverso. Este é o iniciador inverso.
      1. No caso de os genes que codificam as proteínas periplasmáticas, conceber o iniciador de sentido inverso que é o complemento reverso de "fim de uma sequência líder que flanqueia o 5 'a 3 fim do gene e é necessário para a localização correcta do produto de proteína no periplasma.
    3. O uso de qualquer programa de oligo-analisador disponível, verifique se os iniciadores de exclusão ter conteúdo GC entre 40-60%, temperatura de fusão baixo hairpin (T m), baixa auto e hetero-dimerização T m 's. Encomendar os primers para a síntese e expedição de qualquer empresa de biotecnologia disponível.
    4. Usando a construção pK184-gene obtido no Protocolo 1.3 como o modelo e as diretrizes em 1.2.7-1.2.8, PCR amplificar as construções de deleção com os primers desenhados em passos 1.4.1-1.4.3 para gerar produtos de amplificação Ax pK184 de gene . Loja ADN amplificado umt -20 ° C.
    5. Ligar o construto amplificado utilizando qualquer kit de mutagénese disponíveis (Tabela Materiais).
    6. Transformar cada um dos ligates Ax pK184-gene separadamente em células DH5a quimicamente competentes, utilizando um protocolo de choque térmico padrão (veja 1.3.11-1.3.13).
    7. Alíquota um volume de 100 uL de amostra a partir de cada reacção de ligação em 1.4.12 sobre uma placa de agar contendo 50 ug / mL de Km e espalhar as células usando um espalhador estéril. Mantenha a área estéril e trabalhar perto de uma chama. Incubar a placa de cabeça para baixo, a 37 ° C durante a noite.
    8. Usando uma pipeta ou ansa estéril, colher uma única colónia distinta de células e inocular a 20 mL de mídia estéril LB com 50 mg / mL Km. Mantenha a área estéril e trabalhar perto de uma chama. Crescer as células O / N a 37 ° C com agitação a 200 rpm.
    9. Adicione 3-5 estoques de glicerol de DH5a as células transformadas através da mistura de 500 mL da cultura D / N com 500 mL de solução estéril de glicerol a 100% (final 50% v / v) em crio-tubos estéreis. Armazenar a -80 ° C.
    10. Centrifugar 6-8 mL da cultura O / N à temperatura ambiente, 5,000 xg durante 3 min. Decantar o sobrenadante e extrai-se o plasmídeo do gene AX pK184 construir a partir do sedimento utilizando um kit de plasmídeo mini-prep (Materiais Tabela) e o protocolo do fabricante. ADN Armazenar a -20 ° C.
  • 2. Geração de pOX38-Tc Δgene :: Cm Cepas

    1. DY330R pOX38-Tc Δgene :: Cm nocautes
      1. Prepara-se uma cultura de S / N de células DY330R pOX38-TC em 10 ml de LB estéril contendo 10 ug / ml Tc. Crescer a cultura O / N a 32 ° C e 200 rpm.
      2. Fazer uma diluição da cultura D / N 1:70 em 20 ml de LB estéril fresco Crescer as células a 32 ° C até (0,4-0,6 OD 600nm) de crescimento de fase mid-log.
      3. Transferem-se 10 ml de cultura para um frasco estéril e incubar a 42 ° C durante 15 minutos a 150 rpm numa ba água que agitamº. Isto irá induzir a expressão de proteínas específicas de recombinação em DY330R.
      4. Arrefeça a cultura num banho de gelo-água durante 10 min. Preparar células electrocompetentes como se segue.
        1. Transferência das células refrigerados em tubos cônicos de pré-refrigerados e centrifugar a 4.000 g durante 7 minutos a 4 ºC. Todos os tubos e pipetas que ser utilizados nos próximos passos devem ser colocadas a 4 ° C ou sobre gelo para arrefecer.
        2. Remover o sobrenadante e suavemente ressuspensas as células em 1 mL de DDH gelada 2 O. Adicionar outros 30 mL de gelo frio ddH 2 O.
        3. Centrifugar as células (4000 xg, 7 min, 4 ° C), Descartar o sobrenadante e suavemente ressuspensas as células em 1 mL de DDH gelada 2 O.
        4. Transferir as células ressuspensas em pré-refrigerada tubos de microcentrífuga de 1,5 ml e centrifugar a 15000 xg durante 1 min a 4 ºC.
        5. Suavemente ressuspensas o sedimento em 200 ul de DDH gelada 2 O e alíquota em volumes de 50 ul. Electrocompetecélulas NT pode ser armazenado a -80 ° C
      5. Adicionar 300 ng da cassete CAT amplificado de 1,2 em 50 mL de células DY330R pOX38-TC electrocompetentes, enquanto a mistura em gelo, delicadamente por pipetagem cima e para baixo. Repita este passo usando plasmídeo pBAD33 não modificada como um controlo positivo.
      6. Transferir as células para uma cuvete de electroporação de pré-arrefecida (-20 ° C) de 1 mm. Electroporate as células em 1,8 kV com uma constante de tempo de 5,5 ms, utilizando um electroporador. Imediatamente após a aplicação do impulso, diluir as células com 1 ml de meios SOC e transferir para um tubo de microcentrífuga novo. Incubar as células a 32 ° C durante 2 h.
      7. Alíquota de 100 uL de cada amostra em placas de agar contendo 10 ug / ml Tc e 20 ug / ml de CM e espalhadas usando um espalhador estéril. Mantenha a área estéril e trabalhar perto de uma chama. Incubar a placa de cabeça para baixo a 32 ° C durante a noite para seleccionar os recombinantes bem sucedidos. A cassete CAT introduzido na célula vai sofrer re homólogacombinação com o gene de interesse e criar o DY330R pOX38-Tc :: Δgene cm (Rif R, R Tc, Cm R) do clone.
        Nota: É importante a crescer células DY330R a 32 ° C, com a excepção dos 15 minutos de indução a 42 ° C do Passo 2.1.3 antes da geração de células electrocompetentes, como crescimento prolongado a temperaturas elevadas, corre o risco de morte celular devido à produção de produtos tóxicos do p L operon responsável por funções de recombinação em DY330R. 33,34
      8. Prepara-se uma O / N de DY330R pOX38-Tc :: Δgene células cm por colheita de uma única colónia distinta de células com uma pipeta ou ansa estéril, e inoculando um meio de 20 ml estéril LB com 10 ug / ml Tc, e 20 ug / mL Cm. Mantenha a área estéril e trabalhar perto de uma chama. Crescer as células O / N a 32 ° C com agitação a 200 rpm.
      9. Adicione 3-5 estoques de glicerol a partir de O / N por mistura de 500 ul da cultura D / N com 500 mL de solução estéril de GL 100%ycerol (final de 50% v / v) em crio-tubos estéreis. Armazenar a -80 ° C.
      10. Centrifugar 6-8 mL da cultura O / N à temperatura ambiente, 5,000 xg durante 3 min. Decantar o sobrenadante e extrair o pOX38-Tc Δgene :: Cm construir a partir do sedimento utilizando um kit plasmídeo mini-prep (Materials Table) e protocolo do fabricante; armazenar ADN purificado a -20 ° C.
      11. Realizar um ensaio de acasalamento por conjugação utilizando XK1200 células como o destinatário para confirmar a interrupção da conjugação por nocaute de genes, conforme o protocolo 3.1.
    2. DY330R pOX38-Tc :: Δgene Cm + pK184-gene
      1. Transformar células DY330R pOX38-Tc :: Δgene Cm electrocompetentes com 300 ng do constructo pK184-gene através de electroporação como por passos 2.1.4-2.1.7. Todos os meios selectivos deve conter 20 ug / mL de Cm e 50 ug / mL de Km. Incubar a 32 ° C. O plasmídeo de recuperação nas células electroporadas irá agora restaurar a função do gene eliminado na DY330R pOX38-Tc Δgene :: células cm.
      2. Prepara-se uma O / N de DY330R pOX38-Tc :: Δgene células recombinantes Cm + pK184-gene por colheita de uma única colónia distinta das células com uma pipeta ou ansa estéril, e inoculando um meio de 20 ml estéril LB com 20 ug / ml Cm e 50 ug / mL de Km. Mantenha a área estéril e trabalhar perto de uma chama. Crescer as células O / N a 32 ° C com agitação a 200 rpm.
      3. Adicione 3-5 estoques de glicerol a partir de O / N por mistura de 500 ul da cultura D / N com 500 mL de solução estéril de glicerol 100% (final de 50% v / v) em crio-tubos estéreis. Armazenar a -80 ° C.
      4. Também executam o protocolo 3.1 para gerar XK1200 pOX38-Tc :: Δgene Cm células recombinantes.
    3. XK1200 pOX38-Tc :: Δgene Cm + pK184-gene e mutantes
      1. Prepare células electrocompetentes XK1200 pOX38-Tc Δgene :: cm (a partir da etapa 2.2.4).
      2. Separadamente electroporate 300 ng do pK184-gene ou genes-pK184 plasmídeos mutantes em 50 mL de ELEctrocompetent XK1200 pOX38-Tc Δgene :: células Cm como por passos 2.1.4-2.1.7. Todos os meios selectivos deve conter 10 ug / ml de ácido nalidíxico (Nal), 20 ug / ml de CM, e 50 ug / mL de Km e colocado numa estufa a 37 ° C.
      3. Prepara-se uma O / N de XK1200 pOX38-Tc Δgene :: células recombinantes Cm + pK184-gene por colheita de uma única colónia distinta das células com uma pipeta ou ansa estéril, e inoculando um meio de 20 ml estéril LB com Nal, 20 ug / mL cm e 50 ug / mL de Km. Mantenha a área estéril e trabalhar perto de uma chama. Crescer as células O / N a 37 ° C com agitação a 200 rpm.
      4. Adicione 3-5 estoques de glicerol a partir de O / N por mistura de 500 ul da cultura D / N com 500 mL de solução estéril de glicerol 100% (final de 50% v / v) em crio-tubos estéreis. Armazenar a -80 ° C.

    3. conjuntivos acasalamento Ensaios

    1. Conjugada Acasalamento para gerar XK1200 pOX38-Tc Δgene :: Cm Cells
      1. Prepare a 20 mL estéril LB O / N cultura de DY330R pOX38-Tc Δgene :: células Cm + pK184 de gene usando uma pipeta ou ansa estéril para inocular um mL estéril LB 20 contendo 20 mg / mL cm e 50 mcg / mL Km com um estoque de glicerol ou colónia única em um placa de agar. Crescer a 32 ° C com agitação a 200 rpm. Prepara-se o mesmo para XK1200 células em 20 ml de LB estéril com 10 ug / mL de Nal, crescendo a 37 ° C.
      2. Fazer diluições 1:70 de cada cultura separadamente em 2 ml de LB estéril com as mesmas concentrações de antibióticos; adicionar glucose para uma concentração final de 100 mM a todas as células do dador. Crescer as células até à fase mid-log (DO600 0,5-0,7) a 37 ° C com agitação a 200 rpm.
      3. Centrífuga (4000 xg durante 5 min a 4 ° C) para sedimentar as células, descartar o sobrenadante, lavar uma vez com LB frio estéril para remover os antibióticos, e ressuspender as células em 2 ml de LB estéril frio
      4. Alíquota de 100 uL de cada cultura em 800 mL de meio LB estéril e permitir-lhes para acasalar a 32 ° C durante 1 h sem agitação.
      5. <li> Vortex as células durante 30 s para perturbar os pares de acasalamento e colocá-los em gelo durante 10 min, para evitar mais acasalamento.
      6. Alíquota de 100 uL da mistura de células para uma placa de agar contendo 10 ug / mL de Nal e 20 ug / mL de Cm para seleccionar células XK1200 pOX38-Tc Δgene :: cm. Espalhe as células usando um espalhador estéril. Mantenha a área estéril e trabalhar perto de uma chama. Incubou-se a placa de O / N a 37 ° C, de cabeça para baixo.
      7. Colher uma única colónia do gene novo XK1200 pOX38-Tc Δ :: Cm estirpe knockout utilizando uma pipeta estéril ou loop e crescer em LB estéril com 20 ng / mL Cm, O / N em 37 ° C com agitação a 200 rpm. Adicione 3-5 estoques de glicerol a partir de O / N por mistura de 500 ul da cultura D / N com 500 mL de solução estéril de glicerol 100% (final de 50% v / v) em crio-tubos estéreis. Armazenar a -80 ° C.
        Nota: As células resultantes são agora capazes de ser competentes para a transformação com as construções pK184-gene (protocolos 1.3 e 1.4) para assessing do gene e dos seus mutantes na capacidade de recuperar transferência conjugativa no protocolo 3.2.
    2. Conjugada Acasalamento Ensaio de XK1200 dadores aos receptores MC4100
      1. Prepara-se uma O / N de cultura XK1200 pOX38-Tc :: Δgene Cm + pK184-gene células em 20 mL de LB estéril com 20 ug / ml de CM, 50 ug / mL de Km e MC4100 células em 5 mL de LB com 50 ug / mL de estreptomicina (Sm) utilizando as células de um stock de glicerol ou de colónias únicas sobre uma placa de agar e estéril pipeta ou loop. Crescer culturas em 37 ° C com agitação 200 rpm.
      2. Fazer diluições 1:70 de cada cultura D / N separadamente em 2 ml de LB estéril com os mesmos antibióticos. Adicionar glicose até uma concentração final de 100 mM a todas as células do dador. Crescer as células até à fase mid-log (DO600 0,5-0,7) a 37 ° C com agitação a 200 rpm.
      3. Centrífuga (4000 xg durante 5 min a 4 ° C) para sedimentar as células, descartar o sobrenadante, lavar uma vez com LB frio estéril para remover antibiotiques, e Ressuspender as células em 2 mL LB. estéril frio
      4. Em duplicado, alíquota de 100 uL de cada cultura em 800 mL de meio LB estéril e permitir-lhes para acasalar a 37 ° C durante 1 h sem agitação.
      5. Agitar as células durante 30 s para perturbar os pares de acasalamento e colocá-los em gelo durante 10 min para evitar o agravamento do acasalamento.
      6. Usando as culturas mid-log a partir do passo 3.2.2 e fresco LB estéril, preparar a 6 diluições em série de células dadoras e receptoras a partir de 10 -2 a 10 -7.
      7. Em cada uma das duas metades de uma placa de agar contendo 10 ug / mL de Nal, 20 ug / mL de Cm e 50 ug / ml de km, mancha alíquotas de 10 ul de cada diluição de XK1200 células do dador, conforme mostrado na Figura 2. Repetir para as diluições das células receptoras MC4100 em placas de agar contendo 50 ug / mL de Sm. Incubar as placas de O / N a 37 ° C.
      8. Usando a mistura de vórtice do passo 3.2.5 e fresco LB estéril, prepare-se 6 diluições (10 -2 a 10 -7 Figura 2. Repita o procedimento para ambas as misturas duplicados. Mantenha a área estéril e trabalhar perto de uma chama. Incubar as placas de O / N a 37 ° C.
      9. Determinar a eficiência de acoplamento de cada construção, como descrito no protocolo 3.3.
      10. Repetir este protocolo para todos os plasmídeos de recuperação para avaliar o efeito de uma mutação particular, sobre a eficiência da conjugação.
    3. O cálculo da eficiência de acoplamento
      1. Contar o número de colónias a partir da mesma mancha de diluição para cada dador, receptor e as células transconjugante em suas respectivas placas.
      2. Contagem das colónias receptores para testar qualquer tendência que possa resultar de ter um maior número de transconjugantes que os receptores em que dada diluição.
      3. Calculate a eficiência de acoplamento como o número de colónias transconjugante dividido pelo número de colónias de doadores. Multiplique por 100 para obter valor de eficiência por 100 células doadoras.

    Subscription Required. Please recommend JoVE to your librarian.

    Representative Results

    O processo de conjugação bacteriana F-driven plasmídeo é um processo coordenado que envolve proteínas de transferência dentro da região do tra de o F-plasmídeo que monta um T4SS para facilitar a síntese de pilus e transferência de ADN conjugativo. A proteína TRAF (Registo de GenBank # BAA97961; UniProt ID P14497) é necessária para a formação de F-pilus conjugativo. 10,14,35 - 37 A proteína contém um domínio tioredoxina-como C-terminal, apesar de não ter o motivo CXXC catalítica. 35,38 Embora tenha sido previsto para interagir com a proteína Trah através do seu domínio N-terminal, uma região 39 mostrou-se mais dinâmico do que o seu domínio do terminal C, 37 não se sabe muito mais sobre as características estruturais da proteína. Para avaliar os aspectos funcionais da proteína de TRAF em conjunto com estudos estruturais, que primeiro eliminado o gene TRAF sobre a pOX38-Tc através homólogarecombinação, gerando o plasmídeo pOX38-Tc :: ΔtraF cm (Tabela 1) em células de E. coli DY330R. 33,34 Também gerado foi o plasmídeo pK184-TRAF de TRAF iniciadores espec�icos (Tabela 2) para fornecer recuperação de conjugação e permitir sondagem sequência da proteína. A transferência do plasmídeo pOX38-Tc :: ΔtraF Cm XK1200 em células a partir de células 40 quando DY330R pK184-TRAF foram fornecidas in trans (transconjugantes cresceram em 10 ug / mL de Nal, 10 ug / ml Tc e 20 ug / ml cm) indica que (a) o nocaute TRAF em pOx38-Tc :: ΔtraF Cm fornece uma cassete de CAT em grelha, e (b) que pK184-TRAF pode restaurar a função conjugativo.

    Uma série de mutantes de TRAF foram gerados por análise utilizando o ensaio de acasalamento por conjugação utilizando 37 XK1200 pOX38-Tc :: ΔtraF Cm + pK184-TRAF AXe células MC4100 41 como doadores e receptores, respectivamente. Um mutante é representativa TRAF 55-247 (Tabela 1), um mutante de deleção N-terminal que remove a região da proteína prevista para interagir com Trah. Quando a proteína de comprimento completo TRAF é fornecido para as células do dador, transferência conjugativa é restaurado (Figura 2), enquanto fornece as pK184 plasmídeo vazia não (Tabela 3). Da mesma forma, a função conjugada nas células dadoras XK1200 não é restaurado quando fornecido com pK184-TRAF plasmídeo 55-247 (Tabela 3). Isto indica que a região truncada da proteína é importante para a função do TRAF dentro do aparelho conjugativo, provavelmente através da interacção com Trah, e proporciona uma região da proteína alvo para posterior análise mutacional.

    figura 1
    em trans por meio de um plasmídeo de recuperação (pK184-gene). O resultante pOX38-Tc :: Δgene Cm plasmídeo é transferido para uma estirpe XK1200 (Passo 2) para posterior avaliação do gene utilizando ensaios de acasalamento com um destinatário MC4100 (Passo 3). Por favor clique aqui para ver uma versão maior desta figura.

    Figura 2
    Figura 2: Mating ensaio para avaliar a função do gene alvo, em conjugação. Células do doador e do receptor foram E. coli XK1200 pOX38-Tc ΔtraF :: Cm transformada com pK184-TRAF e MC4100, respectivamente. Os transconjugantes resultantes (MC4100 pOX38-Tc ΔtraF :: cm) crescer em placas contendo Sm e Cm, indicando recuperação bem sucedida da função conjugada. A experiência é feita em duplicado numa única placa de agar, e as diluições em série são utilizados de forma a calcular a eficiência de acoplamento de mutantes de genes restauradores (Tabela 2). Por favor clique aqui para ver uma versão maior desta figura.

    Estirpe bacteriana / plasmídeo Características relevantes Marcador selectivo (s) Referência
    As estirpes bacterianas
    DY330R W3110 ΔlacU169 gal490 λc1857 Δ (cro-BIOA) Rif R Rif 33,34
    XK1200 F - lacΔU124 Δ (NADA AROG gal attλ bio gyrA) nal 40
    MC4100 araD139 Δ (argFlac) U169 rpsL150 relA1 flbB3501 deoC1 ptsF25 rbsR Sm 41
    Vectores e Constructos
    pBAD33 O plasmídeo para a expressão a partir de P sob araBAD Cm 32
    pK184 2,4 kb vector de clonagem, replicão p15A km 31
    pK184-TRAF </ Td> F TRAF de pOX38 em pK184 km 35
    pK184-TRAF 56-247 F TRAF aa 56-247 da pK184-TRAF km
    Os plasmídeos conjugativos
    pOX38-Tc IncFI, Tra +, RepFIA +, o fragmento F1 HindIII de F, mini-Tn Tc 29,30
    pOX38-Tc :: ΔtraF Cm pOX38-Tc com CAT inserido no TRAF Tc Cm 35
    † Cm, cloranfenicol; Km, canamicina; Nal, ácido nalidíxico; Rif, rifampicina; Sm, estreptomicina; Tc, tetraciclina
    ‡ Todas as construções TRAF contêm a sequência líder de 19-resíduo para assegurar localização para o espaço periplásmico.

    Tabela 1: estirpes de E. coli e os plasmídeos usados neste estudo.

    Construir Primer *
    TRAF-Cm-For 5'-GATCGAGGCTGGCAGTGGTATAACGAGAAAATAAATCCGAAGGA - CTGTGACG GAAGATCACTTC -3 '
    TRAF-Cm-Rev 5'-TCTTCAGAAACGTTCAGGAACTGTTTTGCCAGGTCGTCCT - CTTATTCAGGCGT AGCACCAG -3 '
    pK184-TRAF-For 5'-TTTTTT GAATTC TATGAATAAAGCATTACTGCCAC -3 '
    pK184-TRAF-Rev 5'-TTTTTT AAGCTT TAAAAATTGGGTTTAAAATCTTCAGAAA -3 '
    pK184-TRAF 55-247 -Para 5'-TACG CATATG ATGGCCGCACTGCAGACGG -3 '
    pK184-TRAF 55-247 5'-TACG CATATG TCCTGACGCCGGAAAAATAAAGCAGCAGAGTAA -3 '
    † Tabela adaptado de Lento et ai. 2016 35 com permissão
    * Regiões salientes TRAF estão em itálico. sítios de enzimas de restrição encontram-se sublinhados (HindIII: AAGCTT, EcoRI: GAATTC, Ndel: CATATG)

    Tabela 2: Lista de iniciadores utilizados neste estudo.

    O plasmídeo Dador de † recuperação plasmídeo Transconjugantes ‡ § (células mL -1) Acasalamento Efficiency§ ||
    pOX38-Tc :: ΔtraF Cm Nenhum 0 0
    pOX38-tc ΔtraF :: Cm pK184 0 0
    pOX38-Tc :: ΔtraF Cm pK184-TRAF 5 x 10 3 0,0167
    pOX38-Tc :: ΔtraF Cm pK184-TRAF 55-247 0 0
    * Tabela adaptado de Lento et ai. 2016 35 com permissão
    † células doadoras de E. coli foram XK1200, com uma concentração média de 3 x 10 7 células mL -1
    ‡ células receptoras foram E. coli MC4100. O número de transconjugantes para o controlo positivo é de uma diluição de 5/10. 0 indica que não há transconjugantes de uma diluição 10-2.
    §An média de duas a quatro experiências de acasalamento foram realizadas para cada constructo.
    || Acasalamento eficiência é defined como transconjugantes por 100 células doadoras. 0 indica que não há a eficiência de acoplamento transconjugantes de uma diluição 2/10

    Tabela 3: eficiência de acasalamento abolido por construções de deleção TRAF.

    Subscription Required. Please recommend JoVE to your librarian.

    Discussion

    processo de conjugação bacteriana fornece um meio pelo qual as bactérias podem espalhar genes proporcionando uma vantagem evolutiva para o crescimento em ambientes difíceis, tais como a propagação de marcadores de resistência a antibióticos. Porque muitos dos plasmídeos conjugativos são tão grandes, 12 estudos funcionais sobre as proteínas envolvidas na montagem do aparelho de transferência através de mutação de genes alvo no próprio plasmídeo conjugativo são pesadas. Os protocolos aqui descritos proporcionam um meio pelo qual se pode avaliar mais facilmente o gene alvo de interesse através da utilização de menores plasmídeos de expressão, mais manejáveis (Figura 1). Nós empregamos o plasmídeo F derivado pOX38-Tc (Tabela 1) para estudar F conjugação mediada por plasmídeo; outros plasmídeos conjugativos pode ser estudada utilizando os protocolos descritos aqui e plasmídeos derivados apropriados. Os ensaios de acasalamento descritas foram adaptados a partir de Frost e colegas, 42 com algumas modifications. Em estudos anteriores, 8,33,42 a criação do construto pOX38-Tc :: Δgene Cm foi conseguido por clivagem do gene de interesse com as enzimas de restrição apropriadas e inserindo a cassete CAT amplificado para dentro de pOX38-Tc. 42 No método atual, que empregam recombinação homóloga na recombineering E. coli DY330R 33,34 para nocautear o gene alvo e substituí-lo com a cassete CAT. Isto tem uma vantagem de permitir que a estirpe que alberga o DY330R resultante pOX38-Tc :: Δgene Cm construir para actuar como um controlo para o knockout de genes específicos de a F-T4SS mediada por transferência conjugativa a recuperação através de transferência usando o plasmídeo pK184 recuperação do gene . Embora possa ser possível para gerar knockouts utilizando uma metodologia mais nítidas-Cas9, 43 não têm neste momento explorou essa possibilidade.

    O processo começa com a geração de um nocaute do gene no plasmídeo pOX38 derivado F-Tc (FigurE 1). Isto é alcançado através de recombinação homóloga em células DY330R (Tabela 1), também podem ser utilizadas outras estirpes com características semelhantes, tais como DY329, e DY331 DY378. Os iniciadores são inicialmente concebidos para amplificar por PCR a cassete de CAT a partir do plasmídeo pBAD33 32 e que pende sobre conter bases que são específicos para o gene alvo (Tabela 2); o produto de PCR é então electroporado em células que albergam DY330R pOX38-Tc. recombinação homóloga gera o plasmídeo pOX38-Tc Δgene :: Cm knock-out, onde a cassete CAT é inserido no quadro dentro do gene alvo, interrompendo eficazmente montagem T4SS e conjugação, proporcionando Cm resistência. Ao mesmo tempo, o gene alvo é amplificado por PCR a partir de pOX38-Tc e inserido num plasmídeo de expressão pequena; neste protocolo usamos pK184 para a expressão constitutiva, no entanto pode-se escolher um plasmídeo com expressão indutível do gene alvo, se desejado. O plasmídeo pK184-gene é então transformadonas células DY330R pOX38-Tc :: Δgene cm, e estas células são então utilizados como dadores para transferir a pOX38-Tc :: Δgene Cm construir por conjugação em XK1200 células para ensaios de acasalamento. Nos ensaios de acasalamento, as células doador e receptor são XK1200 pOX38-Tc Δgene :: Cm e MC4100, respectivamente. O plasmídeo de recuperação pK184-gene, bem como os mutantes da série do gene alvo (deleções ou mutações pontuais), é fornecida às células do dador para avaliar a sua capacidade para restaurar o acasalamento, e determinar a sua eficiência, com células MC4100 receptores (Figura 2 ; Tabela 3).

    Fundamental para o processo é a utilização de doador adequado e estirpes receptoras (Quadro 1), e a concepção dos iniciadores utilizados. Para cada iniciador concebido, existem orientações gerais que devem ser seguidas. Enquanto tentamos estritamente cumprir com o conteúdo GC de 40-60%, isto pode não ser sempre possível. Em tais casos, é critério do experimentador para testar um iniciador Wconteúdo GC om um pouco abaixo ou acima dessa faixa. A temperatura de fusão (Tm) do iniciador em sentido directo e reverso deve ser semelhante, e a temperatura de recozimento (T a) valor deve ser sempre menor do que a Tm de 2-5 ° C durante a PCR. A energia livre disponível para permitir que um gancho de cabelo para desenvolver deve ser muito menor do que a t um, enquanto que o homo- e hetero-dimerização t m 's deve ser muito baixa (inferior a -10 kJ e 30 ° C). Os iniciadores podem ser concebidos para sondar deleções, inserções ou mutações pontuais, como desejado. É claro que é importante que a construção de gene resultante ser amplificado e ligado ao plasmídeo de recuperação dentro da moldura de modo a que ele está correctamente expressa. A transformação de células competentes pode ser feito através de electroporação ou de choque de calor usando células electrocompetentes ou quimicamente competentes, respectivamente. Nós achamos que eletroporação é mais eficiente para construções maiores, como pOX38-Tc eo oligonucle recombinação homólogaotide, enquanto que os plasmídeos de expressão menores, tais como pK184-TRAF pode ser facilmente transformado em células utilizando métodos de choque térmico. Por último, é importante lembrar que haverá vários antibióticos em uso em todo o protocolo, ambas as estirpes doadores e receptores requerem diferentes resistências que são diferentes dos utilizados nas conjugadas e de recuperação de plasmídeos.

    Para além das técnicas de acoplamento ensaios descritos aqui, existem outros métodos que são utilizados para estudar a conjugação bacteriana, variando ligeiramente na sua abordagem. transferência horizontal de genes é um processo em que as bactérias transferir um plasmídeo para uma célula receptora, incluindo receptores inter-espécies. 44 Um estudo realizado por Dahlberg e colegas 44 por exemplo utilizados conjugação bacteriana para determinar a extensão da transferência de genes horizontal interespécies. Eles utilizaram a incorporação de proteína fluorescente verde (GFP) em um plasmídeo clonado em células KT2442; cromossómica lac I gene q nas células KT2442 reprimir a expressão GFP. Quando o GFP portadoras do plasmídeo é transferido para uma espécie sem o gene lacl Q, a fluorescência é observado. 44 Apesar da sua limitação para fornecer a função específica de proteína em várias espécies, a experiência de conjugação entre espécies poderia ser acoplado com os protocolos aqui apresentados para fazer previsões evolutivas para interacções proteína-proteína entre espécies diferentes.

    Subscription Required. Please recommend JoVE to your librarian.

    Disclosures

    Os autores declaram que não têm interesses financeiros concorrentes.

    Acknowledgments

    Esta pesquisa foi apoiada por uma Grant Descoberta da Ciência e Engenharia Conselho Natural do Canadá (NSERC).

    Materials

    Name Company Catalog Number Comments
    GeneJet Plasmid Mini-Prep Kit Fisher Scientific K0503
    GeneJet Gel Extraction Kit Fisher Scientific K0692
    GeneJet PCR Purification Kit Fisher Scientific K0702
    Q5 Site-Directed Mutagenesis Kit New England Biolabs E0554S
    Broad Range DNA Ladder New England Biolabs N0303A
    Petri Dishes Fisher Scientific FB0875713
    Electroporator Eppendorf 4309000027
    Electroporation cuvettes Fisher Scientific FB101 Cuvettes have a 1 mm gap.
    Enzymes
    AvaI New England Biolabs R0152S
    EcoRI New England Biolabs R0101S
    HindIII New England Biolabs R0104L
    NdeI New England Biolabs R0111S
    Phusion DNA Polymerase New England Biolabs M0530L
    T4 DNA Ligase New England Biolabs M0202S
    DpnI New England Biolabs R0176S
    Antibiotics Final Concentrations
    Chloramphenicol (Cm) Fisher Scientific BP904-100 20 µg/mL
    Kanamycin (Km) BioBasic Inc. DB0286 50 µg/mL
    Nalidixic acid (Nal) Sigma-Aldrich N8878-25G 10 µg/mL
    Rifampicin (Rif) Calbiochem 557303 20 µg/mL
    Tetracycline (Tc) Fisher Scientific BP912-100 10 µg/mL
    Streptomycin (Sm) Fisher Scientific BP910-50 50 µg/mL

    DOWNLOAD MATERIALS LIST

    References

    1. Dobrindt, U., Hochhut, B., Hentschel, U., Hacker, J. Genomic islands in pathogenic and environmental microorganisms. Nat Rev Microbiol. 2, (5), 414-424 (2004).
    2. Furuya, E. Y., Lowy, F. D. Antimicrobial-resistant bacteria in the community setting. Nat Rev Microbiol. 4, (1), 36-45 (2006).
    3. Griffiths, A., Miller, J., Suzuki, D., Lewontin, R., Gelbart, W. An Introduction to Genetic Analysis, 7th Edition. W.H. Freeman. San Fransisco. (2000).
    4. Cooper, T. F. Recombination Speeds Adaptation by Reducing Competition between Beneficial Mutations in Populations of Escherichia coli. PLoS Biol. Barton, N. H. 5, (9), 225 (2007).
    5. Lujan, S. A., Guogas, L. M., Ragonese, H., Matson, S. W., Redinbo, M. R. Disrupting antibiotic resistance propagation by inhibiting the conjugative DNA relaxase. Proc Natl Acad Sci. 104, (30), 12282-12287 (2007).
    6. Carattoli, A. Plasmids and the spread of resistance. Int J Med Microbiol. 303, (6-7), 298-304 (2013).
    7. Shala, A., Ferraro, M., Audette, G. F. Bacterial Secretion Systems: Nanomachines for Infection and Genetic Diversity. Handbook of Clinical Nanomedicine: Nanoparticles, Imaging, Therapy and Clinical Applications. Bawa, R., Audette, G. F., Rubenstein, I. Pan Sanford Publishing. Singapore. 657-686 (2016).
    8. Tseng, T. T., Tyler, B. M., Setubal, J. C. Protein secretion systems in bacterial-host associations, and their description in the Gene Ontology. BMC Microbiol. 9, (1), Suppl 1 2 (2009).
    9. Alvarez-Martinez, C. E., Christie, P. J. Biological diversity of prokaryotic type IV secretion systems. Microbiol Mol Biol Rev. 73, (4), 775-808 (2009).
    10. Lawley, T. D., Klimke, W. A., Gubbins, M. J., Frost, L. S. F factor conjugation is a true type IV secretion system. FEMS Microbiol Lett. 224, (1), 1-15 (2003).
    11. Lederberg, J., Tatum, E. L. Gene Recombination in Escherichia Coli. Nature. 158, (4016), 558-558 (1946).
    12. Smillie, C., Garcillan-Barcia, M. P., Francia, M. V., Rocha, E. P. C., de la Cruz, F. Mobility of Plasmids. Microbiol Mol Biol Rev. 74, (3), 434-452 (2010).
    13. Willetts, N., Skurray, R. The Conjugation System of F-Like Plasmids. Annu Rev Genet. 14, (1), 41-76 (1980).
    14. Frost, L. S., Ippen-Ihler, K., Skurray, R. A. Analysis of the sequence and gene products of the transfer region of the F sex factor. Microbiol Rev. 58, (2), 162-210 (1994).
    15. Audette, G. F., Manchak, J., Beatty, P., Klimke, W. A., Frost, L. S. Entry exclusion in F-like plasmids requires intact TraG in the donor that recognizes its cognate TraS in the recipient. Microbiology. 153, Pt 2 442-451 (2007).
    16. Christie, P. J., Atmakuri, K., Krishnamoorthy, V., Jakubowski, S., Cascales, E. Biogenesis, Architecture, and Function of Bacterial Type Iv Secretion Systems. Annu Rev Microbiol. 59, (1), 451-485 (2005).
    17. Christie, P. J. Type IV secretion: the Agrobacterium VirB/D4 and related conjugation systems. Biochim Biophys Acta - Mol Cell Res. 1694, (1-3), 219-234 (2004).
    18. Bhatty, M., Laverde Gomez, J. a, Christie, P. J. The expanding bacterial type IV secretion lexicon. Res Microbiol. 164, (6), 620-639 (2013).
    19. Christie, P. J., Cascales, E. Structural and dynamic properties of bacterial Type IV secretion systems (Review). Mol Membr Biol. 22, (1-2), 51-61 (2005).
    20. Christie, P. J. Type IV secretion: Intercellular transfer of macromolecules by systems ancestrally related to conjugation machines. Mol Microbiol. 40, (2), 294-305 (2001).
    21. Christie, P. J., Whitaker, N., González-Rivera, C. Mechanism and structure of the bacterial type IV secretion systems. Biochim Biophys Acta. 1843, (8), 1578-1591 (2014).
    22. Cascales, E. The type VI secretion toolkit. EMBO Rep. 9, 735 (2008).
    23. Silverman, J. M., Brunet, Y. R., Cascales, E., Mougous, J. D. Structure and Regulation of the Type VI Secretion System. Annu Rev Microbiol. 66, (1), 453-472 (2012).
    24. Chandran, V., et al. Structure of the outer membrane complex of a type IV secretion system. Nature. 462, (7276), 1011-1015 (2009).
    25. Rivera-Calzada, A., et al. Structure of a bacterial type IV secretion core complex at subnanometre resolution. EMBO J. 32, (8), 1195-1204 (2013).
    26. Waksman, G., Fronzes, R. Molecular architecture of bacterial type IV secretion systems. Trends Biochem Sci. 35, 691 (2010).
    27. Fronzes, R., Christie, P. J., Waksman, G. The structural biology of type IV secretion systems. Nat Rev Microbiol. 7, (10), 703-714 (2009).
    28. Kaplan, M., et al. Probing a cell-embedded megadalton protein complex by DNP-supported solid-state NMR. Nat Methods. 12, (7), 5-9 (2015).
    29. Guyer, M. S., Reed, R. R., Steitz, J. A., Low, K. B. Identification of a sex-factor-affinity site in E. coli as gamma delta. Cold Spring Harb Symp Quant Biol. 45, Pt 1 135-140 (1981).
    30. Anthony, K. G., Sherburne, C., Sherburne, R., Frost, L. S. The role of the pilus in recipient cell recognition during bacterial conjugation mediated by F-like plasmids. Mol Microbiol. 13, (6), 939-953 (1994).
    31. Jobling, M. G., Holmes, R. K. Construction of vectors with the pl5a replicon, kanamycin resistance, inducible lacZα and pUC18 or pUC19 multiple cloning sites. Nucleic Acids Res. 18, (17), 5315 (1990).
    32. Guzman, L. M., Belin, D., Carson, M. J., Beckwith, J. Tight regulation, modulation, and high-level expression by vectors containing the arabinose P(BAD) promoter. J Bacteriol. 177, (14), 4121-4130 (1995).
    33. Yu, D., et al. An efficient recombination system for chromosome engineering in Escherichia coli. Proc Natl Acad Sci U S A. 97, (11), 5978-5983 (2009).
    34. Lawley, T. D., Gilmour, M. W., Gunton, J. E., Standeven, L. J., Taylor, D. E. Functional and Mutational Analysis of Conjugative Transfer Region 1 (Tra1) from the IncHI1 Plasmid R27. J Bacteriol. 184, (8), 2173-2180 (2002).
    35. Elton, T. C., Holland, S. J., Frost, L. S., Hazes, B. F-Like Type IV Secretion Systems Encode Proteins with Thioredoxin Folds That Are Putative DsbC Homologues. J Bacteriol. 187, (24), 8267-8277 (2005).
    36. Hazes, B., Frost, L. Towards a systems biology approach to study type II/IV secretion systems. Biochim Biophys Acta. 1778, 1839-1850 (2008).
    37. Lento, C., Ferraro, M., Wilson, D., Audette, G. F. HDX-MS and deletion analysis of the type 4 secretion system protein TraF from the Escherichia coli F plasmid. FEBS Lett. Tsolis, R. 590, (3), 376-386 (2016).
    38. Audette, G. F., Van Schaik, E. J., Hazes, B., Irvin, R. T. DNA-binding protein nanotubes: Learning from nature's nanotech examples. Nano Lett. 4, 1897-1902 (2004).
    39. Harris, R. L., Silverman, P. A. Tra proteins characteristic of F-like type IV secretion systems constitute an interaction group by yeast two-hybrid analysis. J Bacteriol. 186, (16), 5480-5485 (2004).
    40. Moore, D., et al. Characterization of the F-Plasmid Conjugative Transfer Gene traU. J Bacteriol. 172, (8), 4263-4270 (1990).
    41. Anthony, K. G., Sherburne, C., Sherburne, R., Frost, L. S. The role of the pilus in recipient cell recognition during bacterial conjugation mediated by F-like plasmids. Mol Microbiol. 13, (6), 939-953 (1994).
    42. Klimke, W. A., Frost, L. S. Genetic analysis of the role of the transfer gene, traN, of the F and R100-1 plasmids in mating pair stabilization during conjugation. J Bacteriol. 180, (16), 4036-4043 (1998).
    43. Jiang, W., Marraffini, L. A. CRISPR-Cas: New Tools for Genetic Manipulations from Bacterial Immunity Systems. Annu Rev Microbiol. 69, (1), 209-228 (2015).
    44. Dahlberg, C., Bergstrom, M., Andreasen, M., Christensen, B. B., Molin, S., Hermansson, M. Interspecies bacterial conjugation by plasmids from marine environments visualized by gfp expression. Mol Biol Evol. 15, (4), 385-390 (1998).

    Comments

    0 Comments


      Post a Question / Comment / Request

      You must be signed in to post a comment. Please or create an account.

      Usage Statistics