Conjugatif Mating Assays pour l'analyse des protéines de transfert impliqués dans Conjugaison bactérienne spécifique à la séquence

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Erdogan, F., Lento, C., Yaseen, A., Nowroozi-Dayeni, R., Kheyson, S., Audette, G. F. Conjugative Mating Assays for Sequence-specific Analysis of Transfer Proteins Involved in Bacterial Conjugation. J. Vis. Exp. (119), e54854, doi:10.3791/54854 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Le transfert de gènes et de protéines au niveau des micro-organismal joue un rôle central dans la survie des bactéries et de l'évolution ainsi que les processus d'infection. L'échange d'ADN entre les bactéries ou entre une bactérie et une cellule peut être obtenue par transformation, conjugaison ou transduction du vecteur. 1,2 Conjugaison est unique en comparaison à la transformation et la transduction en ce que pendant la conjugaison entre les bactéries Gram-négatives telles que Escherichia coli, le transfert d'ADN a lieu de façon contrôlée du donneur dans lequel un système complexe macromoléculaire relie les cellules du donneur et du receveur. Conjugaison est aussi le moyen le plus direct dans lequel les cellules bactériennes interagissent avec les cellules hôtes pour injecter des gènes, des protéines ou des produits chimiques pour les systèmes hôtes. 3 Très souvent, le transfert de ces agents a des effets remarquables sur l'hôte, allant de la pathogenèse et la carcinogenèse d'accueillir l' évolution et l' adaptation. Il a été démontré que recombinatio conjugatifn augmente le taux d'adaptation de 3 fois dans les bactéries avec des taux de mutation élevés dans des conditions de stress environnemental. 4 En outre, la conjugaison est de loin la voie la plus commune à travers laquelle les gènes de résistance aux antibiotiques dans les souches bactériennes sont réparties. 5,6

Les micro-organismes ont développé des systèmes de sécrétion spécialisés pour soutenir le transfert de macromolécules à travers les membranes cellulaires; il y a actuellement 9 types de systèmes de sécrétion (TSSS) dans les bactéries Gram négatives qui ont été décrites: T1SS, T2SS, T3SS, T4SS, T5SS, T6SS, T7SS, ainsi que le Sec (sécrétion) et Tat (deux-arginine translocation) voies. 7,8 Chaque type de système de sécrétion est divisé en différents sous - types, une nécessité en raison de la diversité des protéines et la spécificité des voies impliquées dans différentes souches bactériennes. Par exemple, dans le système de sécrétion de type IV (T4SS), les systèmes Ti et Cag facilitent le transport effecteur tandis que le F-plasmide, un R27nd pKM101 T4SSs faciliter le transfert d'un plasmide conjugatif. 7,9,10 Une compréhension détaillée des mécanismes par lesquels les organismes assemblent leurs systèmes de sécrétion respectifs de leurs protéines et composants partagent contenu cellulaire avec un destinataire ou leur environnement est un facteur important dans le développement de stratégies ciblées pour lutter contre les micro - organismes et les processus de pathogènes infection cellulaire.

Suite à la conjugaison bactérienne initiale d'identification dans E. coli par Lederberg et Tatum, 11 un grand nombre de plasmides conjugatifs et mobiles ont été identifiés et caractérisés. 12 Ces plasmides mobiles montrent gamme considérable est la taille (de 1 à plus de 200 kilobases (kb)), mais tous les plasmides mobiles contiennent un relaxase, qui reconnaît l'origine du transfert (ORIT) permettant ainsi la transmission du plasmide. les plasmides conjugatifs autres gènes codent pour l'assemblage d'un T4SS fonctionnel ainsi que d'un typeIV protéine de couplage. 12 Par exemple , le F 100 kb du plasmide de E. coli code pour l' ensemble des gènes conjugatifs dans une région 33,3 kB de transfert (tra). 13 Les gènes de la région tra du plasmide F encode les protéines qui facilitent la formation de pili, l' accouplement formation de paires (MPF), le transfert de l' ADN et des fonctions d'exclusion pendant le transfert du plasmide conjugatif. 10,14,15 Un important corpus de connaissances est disponible pour conjugatif T4SSs, cependant détaillé des études structurales des protéines et des complexes de conjugaison ne sont plus récemment devenues disponibles. 16-28

Pour assembler une vue d'ensemble du processus de conjugaison, un couplage des études structurales détaillées mutationnelle analyses de protéines de transfert de conjugaison est nécessaire. Ceci peut être réalisé grâce à des essais d'accouplement de conjugaison. Pour le plasmide F, chaque protéine codée dans la région de tra joue un rôle dans la co F médiationnjugation; par conséquent, le knock - out / suppression d'un gène de transfert abolira la capacité de conjugaison de la cellule (Figure 1). Tandis que les petits plasmides mobiles sont plus propices à la procédure d'effacement standard, pour les plasmides de conjugaison plus grandes telles que F, knock-out de gène sont plus facilement atteints par l'intermédiaire d'une recombinaison homologue dans laquelle le gène cible est remplacée par une transporter un gène de résistance aux antibiotiques distincts. Dans le protocole actuel, nous employons la recombinaison homologue pour remplacer un gène de transfert d'intérêt avec le chloramphénicol acétyltransférase (CAT) dans le 55 kb F plasmide dérivé pOX38-Tc; 29,30 plasmide résultant knock-out, pOX38-Tc :: cm Δgene facilite la résistance à la présence de chloramphénicol (Cm) dans les milieux de croissance. Les cellules donneuses qui hébergent pOX38-Tc :: cm sont Δgene incapable d'affecter le transfert d'ADN par conjugaison / accouplement comme observé par l'utilisation d'un essai d'accouplement; l'efficacité de l'accouplement d'une cellule donneuse pOX38-Tc :: Δgene cm et une normale recipient diminuera ou, plus souvent, être aboli. transfert conjugatif du pOX38-Tc Δgene :: Cm plasmidique peut être restauré par un petit plasmide de récupération hébergeant le gène de transfert ciblé. Ce plasmide de récupération peut être celle qui fournit une expression constitutive, tels que le plasmide pK184 (pK184 gène), 31 ou qui fournit une expression inductible tant que ce plasmide cible correctement le gène à l'emplacement approprié dans la cellule (cytoplasme ou le périplasme). Par conséquent, dans des essais d'accouplement entre ce nouveau donneur (hébergeant pOX38-Tc Δgene plasmides :: Cm + pK184 gène) et une cellule receveuse, l'efficacité de l'accouplement est prévu pour rendre à peu près celle d'un test d'appariement donneur-receveur normal. Ce système une permet de sonder la fonction du gène éliminé par la génération d'une série de constructions pK184 gène (délétions ou mutations ponctuelles) et en testant la capacité de chaque construction pour rétablir la capacité d'accouplement de la pOX38-Tc Δgene :: cm recel cellule donneuses.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Génération de constructions d'ADN

  1. Conception Oligomères pour recombinaison homologue du gène cible
    1. Concevoir une seule 55-72 pb oligomère avant la manière suivante: (a) prendre une longue séquence de nucleotides 19 à 32 pb qui est homologue à une séquence d'ADN dans la région 10 à 100 pb en amont du site de l'extrémité 5 'du début du gène de la chloramphénicol acétyltransférase dans le pBAD33 plasmide commercial, 32 et (b) sélectionner une longue séquence nucléotidique homologue 36-54 pb à une région 10-150 pb en aval du site de 5 'de début du gène cible d'intérêt.
      1. Join 'extrémité de la séquence nucléotidique choisi en (b) à l'extrémité 5' de la 3 fin de la séquence nucléotidique choisi en (a), donnant ainsi une seule longue 55-72 oligomère avant.
    2. Concevoir une seule 55-72 pb inverse oligomère comme suit: (a) prendre une longue séquence de nucleotides 19 à 32 pb qui est homologue à une séquence d'ADN dans la région 10 à 100 pb en avalde l'extrémité 3 'du gène de la chloramphénicol dans le pBAD33 plasmide commercial, et (b) sélectionner une longue séquence nucléotidique homologue 36-54 pb à une région à l'intérieur de 10 à 150 pb en amont du site 3' du gène cible d'intérêt final .
      1. Joignez-vous à «fin de séquence nucléotidique choisi dans (b) à la 5 '3 fin de la séquence nucléotidique choisi dans (a) pour en faire un seul oligomère.
      2. Copiez cet oligomère dans un logiciel de bioinformatique disponible et convertir la séquence dans son complément inverse. Cela donnera une seule 55-72 pb oligomère inverse.
    3. L' utilisation d' un programme d' oligo-analyseur disponible, vérifiez que les oligomères de recombinaison ont une teneur en GC entre 40-60%, faible en épingle à cheveux température de fusion (T m), à faible autonomie et l 'hétéro-dimérisation T m. Commandez les amorces pour la synthèse et l'expédition de toute société de biotechnologie préférée.
  2. Amplification de la CAT Cassette de pBAD33 (Cm R
  3. Cultivez un (O / N, 16-18 h) culture d'une nuit de cellules DH5a abritant le plasmide pBAD33 dans un bouillon Lysogénie stérile (LB) avec 20 pg / ml de chloramphénicol (Cm) avec agitation à 200 tours par minute et 37 ° C.
  4. Centrifugeuse 6-8 ml de la culture O / N à la température ambiante, 5000 g pendant 3 min. Décanter le surnageant et on extrait le plasmide pBAD33 à partir du culot en utilisant un mini-kit de préparation de plasmide (tableau Materials) et le protocole du fabricant.
  5. Faites un condensé de l'ADN plasmidique pBAD33 en ajoutant ce qui suit dans un tube stérile dans l'ordre donné: volume approprié d'eau distillée deux fois (ddH 2 O) à un volume final de 50 ul, volume de 1 pg de pBAD33 plasmide, 5 ul 10x un tampon de réaction enzymatique, et 0,5 ul d'enzyme de restriction Aval (RE). Mélanger doucement par pipetage et laisser la réaction se déroule pendant 1 h à 37 ° C. Heat inactiver la réaction pendant 20 minutes (min) à 80° C. Conserver les échantillons à -20 ° C pour plus de 24 h pour minimiser la dégradation collant fin.
  6. Préparer un agarose à 1,2% de séparation du gel en mélangeant 1,2 g d'agarose avec 100 ml de TAE 1X (Tris 40 mM, pH 8,5, de l'acide acétique 20 mM, EDTA 1 mM) de tampon dans un flacon Erlenmeyer de 250 ml. Chauffer et agiter pour dissoudre complètement dans un four micro-ondes. Arrêter le chauffage immédiatement lorsque le liquide commence à bouillir et agiter le flacon.
    1. Refroidir l'agarose liquide pendant 3 min à température ambiante en agitant, ajouter 2 pi de 10 mg / ml de bromure d'éthidium et agiter pour mélanger. Verser de l'agarose dans un plateau de gel à l'aide d'un peigne de puits et de lui permettre de se solidifier pendant 1 h à température ambiante. gels Conserver à 4 ° C pendant jusqu'à 2 jours dans un tampon TAE 1x.
  7. Mélanger chaque RE digérer à partir de 1.2.3 avec 0,2 volume d'ADN colorant de chargement (10 pi de colorant par 50 réaction ul) par pipetage. Charge 5 pi de 500 pg / mL échelle d'ADN dans le premier puits et la totalité du mélange RE digest-colorant dans un autre puits sur ungel garose. Utiliser 2-3 puits pour charger la totalité du volume réactionnel sur le gel.
    1. Exécuter le gel à peine immergé dans le tampon TAE 1X et fonctionnant à 45 à 50 V (4,5 à 5 V / cm) pendant 65 min dans un dispositif d'électrophorèse sur gel.
  8. En utilisant un boîtier UV et une lame de rasoir stérile, couper rapidement la bande de 2,8 kb correspondant à la séquence CAT du gel pour réduire au minimum l'exposition aux UV de l'ADN. Extraire l'ADN à partir de la tranche de gel découpée en utilisant un kit d'extraction de gel (tableau des matériaux) selon le protocole du fabricant.
    Remarque: Prenez soin de ne pas exposer la peau directement sous UV et de gérer le rasoir avec soin.
  9. Amplifier la cassette CAT extraite de 1,2,6 par réaction en chaîne par polymérase (PCR) en utilisant les amorces conçues à 1,1 surplombs qui contiennent des homologues à la séquence du gène pour permettre la recombinaison homologue. Les réactions de PCR sont mis en place sur la glace en utilisant les directives du fabricant (tableau Matériaux) dans l'ordre suivant:
    1. Dans unetube stérile PCR, ajouter un volume approprié de ddH 2 O pour un volume final de 50 ul, suivi par 10 pi de tampon de PCR, 1 pi d'mM dNTP 10, 2,5 pi de 10 pM d' amorce avant, 2,5 pi de 10 pM Amorce , 1-25 ng de l'ADN matrice à partir 1.2.6 et 0,5 pi de 100 unités / ul d'ADN polymerase.
    2. Mettre en place un contrôle négatif qui porte les mêmes composants que ceux 1.2.7.1, mais à l'exception de l'ADN matrice. Utiliser un volume approprié de ddH 2 O au lieu de l' ADN matrice. Mettre en place un contrôle positif en utilisant l'ADN matrice et des amorces qui ont été prouvés pour travailler dans une réaction PCR, tels que ceux fournis comme témoin positif par le fabricant.
    3. Mélanger tous les contenus de réaction doucement par pipetage.
    4. Amplifier par PCR en utilisant les paramètres suivants: Dénaturation initiale pendant 30 s à 98 ° C, 30 cycles de dénaturation pendant 10 s à 98 ° C, l'hybridation des amorces pendant 20 s, extension pour 20 s par kilobase d'amplicon à 72 ° C et un ailettel'extension al pendant 10 min à 72 ° C. Conserver les échantillons à -20 ° C.
  10. Vérifiez la taille correcte de l'amplification par électrophorèse sur gel d'agarose (voir 1.2.4-1.2.5) en utilisant seulement 5 pi de chaque réaction. Purifier l'amplicon de PCR en utilisant un kit de purification PCR et le protocole du fabricant. Magasin ADN purifié à -20 ºC.
  • Le plasmide de récupération pK184 gène
    1. Concevoir une amorce avant de commencer à partir de son extrémité 5 'et en allant vers l'extrémité 3' dans l'ordre suivant: (a) prendre 4 nucléotides aléatoires (une combinaison de adénine, thymine, guanine et cytosine) pour l'efficacité de clivage, attachés à (b) l'enzyme de restriction EcoRI (RE) séquence de site de coupure (GAATTC), suivie par (c) une longue séquence de nucléotides de 21 à 25 pb qui est homologue à l'extrémité 5 'du gène d'intérêt, y compris le codon d'initiation. Si le gène cible contient un site EcoRI, choisir un autre RE approprié à partir du site de clonage multiple de pK184.
    2. Dans le cas des gènes codant pour des protéines périplasmiques, inclure une séquence de tête supplémentaire entre le site de RE et le codon de démarrage sur l'amorce sens.
    3. L' utilisation d' un oligo-analyseur disponible, vérifiez que les amorces ont une teneur en GC entre 40-60%, en épingle à cheveux à faible T m, faible autonomie et l 'hétéro-dimérisation T m. Commandez les amorces pour la synthèse.
    4. Cultiver un rapport O / N culture de cellules DY330R pOX38-Tc dans du milieu LB stérile contenant 10 pg / ml de tetracycline (Tc) en agitant à 32 ° C et 200 tours par minute. Centrifugeuse 6-8 ml de la culture O / N à la température ambiante, 5000 g pendant 3 min. Décanter lesurnageant et on extrait l'ADN plasmidique à partir de la pastille en utilisant un mini-kit de préparation de plasmide (tableau Materials) et le protocole du fabricant.
    5. Amplifier le plein gène d'intérêt avec les amorces de 1.3.1-1.3.5 utilisant pOX38-Tc comme modèle (voir 1.2.7.1-1.2.7.3).
    6. Vérifiez la taille correcte de l'amplification par électrophorèse sur gel d'agarose (voir 1.2.4-1.2.5) en utilisant seulement 5 pi de chaque réaction. Purifier l'ADN amplifié en utilisant un kit de purification PCR et le protocole du fabricant. Magasin ADN purifié à -20 ° C.
    7. Faites un double digestion de l'ADN à la fois pK184 plasmidique disponible dans le commerce et le gène amplifié (de 1.3.7.), Par adjonction, dans un tube stérile dans l'ordre donné: volume approprié de ddH 2 O à un volume final de 50 pi , volume 1 pg de plasmide pK184, 5 pi de tampon de réaction 10X de l'enzyme, et 1 ul de chaque Eco RI et Hind III.
      1. Mélanger doucement par pipetage et laisser la réaction se déroule pendant 1 hà 37 ºC. Inactivent la chaleur de la réaction pendant 20 min à 80 ° C. Conserver les échantillons à -20 ° C pour plus de 24 h pour minimiser la dégradation collant fin.
        Remarque: Le type de restriction nucléase utilisé ici dépend du site de restriction nucléase qui a été conçu dans les amorces dans les étapes 1.3.1 et 1.3.2.
      2. En tant que contrôle positif, mettre en place les digestions simples du plasmide pK184 en préparant la même réaction que dans 1.3.8, sauf ajouter qu'un seul des REs à un tube de réaction. Pour ce faire, séparément avec les deux REs.
    8. Exécuter les digestions sur un gel d'agarose à 1,2% en utilisant des protocoles 1.2.4-1.2.5 extrait l'ADN double fragments de digestion à la fois pK184 et le gène d'intérêt selon l'étape 1.2.6.
    9. Ligaturer l'insert de gène dans le vecteur d'pK184 en ajoutant des composants dans un tube stérile dans l'ordre suivant: 2 pi de 10x T4 DNA Ligase Buffer, un total de 100 ng d'ADN composé d'un 1: vecteur 3: insérer (pK184: gène) rapport, ddH 2 O jusqu'à unvolume total de 20 pl et 1 ul d'ADN ligase de T4. Comme témoin négatif, mis en place une réaction similaire en utilisant 100 ng de vecteur sans le gène d'insertion.
      1. Mélanger délicatement tous les contenus de réaction en utilisant une micropipette et incuber pendant 30 min à 25 ° C. Inactivent la chaleur de la réaction de ligature pendant 10 min à 65 ° C, puis placer sur la glace.
    10. Alors que sur la glace, ajouter 15 ul du pK184 gène réaction de ligature de l'étape 1.3.10 à 100 uL de cellules DH5a chimiquement compétentes dans un tube stérile de 1,5 ml. Mélanger doucement par pipetage et incuber sur de la glace pendant 10 min. Faites de même pour l'échantillon témoin négatif. Pour un contrôle positif, utilisez 20-100 ng d'un plasmide tel que pBAD33 et la transformer en 50 cellules ul de DHα.
    11. transférer directement les échantillons de la glace dans un bain d'eau C 42 ° et incuber pendant 90 secondes. Cela fournit aux cellules un choc thermique et leur permet l'absorption de l'ADN plasmidique.
    12. La place des cellules de retour sur la glace pour une autre5 min, puis ajouter 900 pi de LB. stérile Incuber à 37 ° C pendant 1 h en agitant à 125 rpm.
    13. Aliquoter un volume de 100 pi d'échantillon de chaque réaction de ligature dans 01/03/13 sur une plaque de gélose contenant 50 pg / ml de kanamycine (Km) et étaler les cellules à l'aide d'une spatule stérile. La plaque de contrôle positif devrait avoir des antibiotiques appropriés. Garder la zone stérile et travailler à proximité d'une flamme. Incuber la plaque à l'envers à 37 ° C pendant la nuit.
    14. En utilisant une pipette ou une boucle stérile, récolter une seule colonie distincte de cellules et ensemencer mL stérile LB 20 avec 50 pg / ml Km. Garder la zone stérile et travailler à proximité d'une flamme. Cultiver les cellules O / N à 37 ° C sous agitation à 200 tours par minute.
    15. Faire 3-5 stocks de glycérol des cellules DH5a transformées en mélangeant 500 ul de la culture O / N avec 500 ul de 100% de glycerol stérile (50% final v / v) dans des tubes stériles cryoprotecteurs. Conserver à -80 ° C.
    16. En outre centrifugeuse 6-8 ml de O / N culture à température ambiante, 5,000 xg pendant 3 min. Décanter le surnageant et on extrait le gène pK184 récupération du plasmide à partir de la pastille en utilisant un mini-kit de préparation de plasmide (tableau Materials) et le protocole du fabricant.
  • pK184 - Mutants géniques
    Note: Amorces conçus pour des délétions, insertions et / ou des mutations ponctuelles peuvent être facilement générés en utilisant les outils disponibles en ligne des fabricants.
    1. Concevoir chaque amorce sens en choisissant une longue séquence de nucleotides 18 à 32 pb qui est homologue à l'extrémité 5 'du gène d'intérêt, y compris le codon d'initiation. Concevoir des amorces telles que chaque amorce directe recuits 30-180 bp en aval du précédent, ce qui entraîne des mutants de délétion dépourvus de fragments de peptides N-terminaux de longueurs appropriées.
    2. Concevoir une amorce inverse en sélectionnant une longue séquence de nucleotides 18 à 32 pb qui est homologue à l'extrémité 3 'du gène d'intérêt, y compris le codon d'arrêt. Copiez cette amorce dans unny programme de bioinformatique disponibles et convertir la séquence dans son complément inverse. Ceci est l'amorce inverse.
      1. Dans le cas des gènes codant pour des protéines périplasmiques, la conception de l'amorce inverse qui est le complément inverse de l'extrémité d'une séquence de tête qui flanque l'extrémité 5 'de la 3 du gène et est nécessaire pour la localisation correcte du produit de protéine dans le périplasme.
    3. L' utilisation d' un programme d' oligo-analyseur disponible, vérifier que les amorces de deletion ont une teneur en GC entre 40-60%, faible en épingle à cheveux température de fusion (T m), à faible autonomie et l 'hétéro-dimérisation T m. Commandez les amorces pour la synthèse et l'expédition de toute société de biotechnologie disponible.
    4. Utilisation de la construction pK184-gène obtenu dans le protocole 1.3 comme matrice et les lignes directrices en 1.2.7-1.2.8, PCR amplifient les constructions de deletion avec les amorces conçues dans les étapes 1.4.1-1.4.3 pour générer pK184 gène amplicons Dx . Magasin ADN amplifié unt -20 ° C.
    5. Ligaturer la construction amplifiée en utilisant toute trousse de mutagenèse (Tableau Matériaux).
    6. Transformez chacun des ligation de Dx pK184 gène séparément dans des cellules DH5a chimiquement compétentes en utilisant un protocole de choc thermique standard (voir 1.3.11-1.3.13).
    7. Aliquoter un volume de 100 pi d'échantillon de chaque réaction de ligature dans 01/04/12 sur une plaque de gélose contenant 50 pg / ml de Km et étaler les cellules à l'aide d'une spatule stérile. Garder la zone stérile et travailler à proximité d'une flamme. Incuber la plaque à l'envers à 37 ° C pendant la nuit.
    8. À l'aide d'une pipette stérile ou une boucle, la récolte d'une seule colonie distincte de cellules et inoculer à 20 ml de milieu LB stérile avec 50 pg / ml de Km. Garder la zone stérile et travailler à proximité d'une flamme. Cultiver les cellules O / N à 37 ° C sous agitation à 200 tours par minute.
    9. Faire 3-5 stocks de glycérol des cellules DH5a transformées en mélangeant 500 ul de la culture O / N avec 500 pi de stériles 100% de glycérol (finale 50% v / v) dans des tubes stériles cryoprotecteurs. Conserver à -80 ° C.
    10. Centrifugeuse 6-8 ml de la culture O / N à la température ambiante, 5000 g pendant 3 min. Décanter le surnageant et on extrait le gène pK184 AX construction plasmidique à partir de la pastille en utilisant un mini-kit de préparation de plasmide (tableau Materials) et le protocole du fabricant. ADN Conserver à -20 ° C.
  • 2. Génération de pOX38-Tc Δgene :: Cm Souches

    1. DY330R pOX38-Tc Δgene :: cm KOs
      1. Préparer un rapport O / N culture de cellules DY330R pOX38-Tc dans 10 ml stérile LB contenant 10 pg / ml de Tc. Cultiver la culture O / N à 32 ° C et 200 rpm.
      2. Faire une dilution 1:70 de la culture O / N dans 20 ml de LB. frais stérile Faire croître les cellules à 32 ° C jusqu'à ce que la croissance en phase mi-log (DO à 600 nm de 0,4 à 0,6).
      3. Transférer 10 ml de la culture dans un flacon stérile et laisser incuber à 42 ° C pendant 15 min à 150 tours par minute dans une secousse d'eau bae. Cela va induire l'expression des protéines de recombinaison spécifiques dans DY330R.
      4. Refroidir la culture dans un bain d'eau glacée pendant 10 minutes. Préparer les cellules électrocompétentes comme suit.
        1. Transférer les cellules réfrigérées dans des tubes coniques pré-réfrigérés et centrifuger à 4000 xg pendant 7 min à 4 ° C. Tous les tubes et pipettes à utiliser dans les étapes à venir doivent être placés à 4 ° C ou sur de la glace pour refroidir.
        2. Retirer le surnageant et doucement remis en suspension les cellules dans 1 ml de glace froide ddH 2 O. Ajouter un autre 30 ml de glace froide ddH 2 O.
        3. Centrifuger les cellules (4000 g, 7 min, 4 ° C), jeter le surnageant et doucement remis en suspension les cellules dans 1 ml de glace froide ddH 2 O.
        4. Transférer les cellules remises en suspension dans pré-réfrigérées 1,5 ml microtubes et centrifuger à 15 000 xg pendant 1 min à 4 ° C.
        5. Remis en suspension doucement le culot dans 200 pi de glace froide ddH 2 O et aliquote dans 50 volumes ul. Electrocompetecellules nt peuvent être conservés à -80 ° C
      5. Ajouter 300 ng de la cassette de CAT amplifié de 1,2 dans 50 ul de cellules DY330R pOX38-Tc électrocompétentes tout en mélangeant sur la glace, doucement par pipetage de haut en bas. Répétez cette étape en utilisant non modifié plasmide pBAD33 comme témoin positif.
      6. Transférer les cellules dans un (-20 ° C) de 1 mm cuvette d'électroporation prérefroidie. Électroporation les cellules à 1,8 kV avec une constante de temps de 5,5 ms, en utilisant une électroporation. Immédiatement après l'application de l'impulsion, diluer les cellules avec 1 ml de SOC médias et transfert à un tube de microcentrifugation frais. Incuber les cellules à 32 ° C pendant 2 h.
      7. Aliquote de 100 pi de chaque échantillon sur des plaques d'agar-agar contenant 10 pg / ml de Tc et 20 pg / ml de Cm et la propagation à l'aide d'une spatule stérile. Garder la zone stérile et travailler à proximité d'une flamme. Incuber la plaque à l'envers à 32 ° C pendant la nuit pour sélectionner les recombinants réussis. La cassette de CAT introduit dans la cellule va subir un nouvel homologuecombinaison avec le gène d'intérêt et de créer le DY330R pOX38-Tc Δgene :: cm (RifR, TcR, CmR) clone.
        Remarque: il est important de cultiver des cellules DY330R à 32 ° C, à l'exception de 15 min à induction à 42 ° C de l'étape 2.1.3 avant de générer des cellules électrocompétentes, la croissance prolongée à des températures élevées, les risques de mort cellulaire due à la production de produits toxiques de la p l opéron responsable des fonctions de recombinaison dans DY330R. 33,34
      8. Préparer un rapport O / N DY330R pOX38-Tc :: cm Δgene cellules en récoltant une colonie unique distincte de cellules avec une pipette ou une boucle stérile et inoculer un milieu stérile, 20 ml de LB avec 10 pg / ml de Tc et 20 pg / ml Cm. Garder la zone stérile et travailler à proximité d'une flamme. Cultiver les cellules O / N à 32 ° C sous agitation à 200 tours par minute.
      9. Faire 3-5 stocks de glycérol de l'O / N en mélangeant 500 ul de la culture O / N avec 500 pi de 100% stérile glycerol (définitif 50% v / v) dans des tubes stériles cryoprotecteurs. Conserver à -80 ° C.
      10. Centrifugeuse 6-8 ml de la culture O / N à la température ambiante, 5000 g pendant 3 min. Décanter le surnageant et extraire le pOX38-Tc Δgene :: Cm construire à partir du culot en utilisant un mini-prep kit de plasmide (tableau Materials) et le protocole du fabricant; stocker l'ADN purifié à -20 ° C.
      11. Effectuer un test d'accouplement conjugatif utilisant XK1200 cellules comme le destinataire pour confirmer la perturbation de la conjugaison par KO du gène selon le protocole 3.1.
    2. DY330R pOX38-Tc Δgene :: Cm + pK184 gène
      1. Transformer des cellules DY330R pOX38-Tc Δgene :: cm électrocompétentes avec 300 ng de la construction pK184 gène par électroporation selon les étapes 2.1.4-2.1.7. Tous les milieux sélectifs doivent contenir 20 pg / mL Cm et 50 pg / ml Km. Incuber à 32 ° C. Le plasmide de récupération dans les cellules électroporées va maintenant restaurer la fonction du gène assommé dans le DY330R pOX38-Tc Δgene :: cellules cm.
      2. Préparer un rapport O / N DY330R pOX38-Tc :: cm + Δgene pK184 gènes des cellules recombinées en récoltant une colonie unique distincte des cellules avec une pipette ou une boucle stérile et inoculer un milieu stérile, 20 ml de LB avec 20 ug / ml de Cm et 50 pg / ml de Km. Garder la zone stérile et travailler à proximité d'une flamme. Cultiver les cellules O / N à 32 ° C sous agitation à 200 tours par minute.
      3. Faire 3-5 stocks de glycérol de l'O / N en mélangeant 500 ul de la culture O / N avec 500 ul de 100% de glycerol stérile (50% final v / v) dans des tubes stériles cryoprotecteurs. Conserver à -80 ° C.
      4. Également effectuer le protocole 3.1 pour générer XK1200 pOX38-Tc Δgene :: Cm cellules recombinantes.
    3. XK1200 pOX38-Tc Δgene :: Cm + pK184 gène et Mutants
      1. Préparer les cellules électrocompétentes XK1200 pOX38-Tc Δgene :: cm (de l'étape 2.2.4).
      2. Séparément électroporation 300 ng de pK184 gène ou pK184 gène plasmides mutants dans 50 ul de electrocompetent XK1200 pOX38-Tc Δgene :: Les cellules Cm comme par étapes 2.1.4-2.1.7. Tous les milieux sélectifs doivent contenir de l'acide 10 pg / mL nalidixique (Nal), 20 pg / ml Cm, et 50 pg / ml Km et être incubées à 37 ° C.
      3. Préparer un rapport O / N XK1200 pOX38-Tc Δgene :: cm + pK184 gènes des cellules recombinées en récoltant une colonie unique distincte des cellules avec une pipette ou une boucle stérile et inoculer un milieu de 20 ml stérile LB avec Nal, 20 pg / ml cm et 50 pg / ml de Km. Garder la zone stérile et travailler à proximité d'une flamme. Cultiver les cellules O / N à 37 ° C sous agitation à 200 tours par minute.
      4. Faire 3-5 stocks de glycérol de l'O / N en mélangeant 500 ul de la culture O / N avec 500 ul de 100% de glycerol stérile (50% final v / v) dans des tubes stériles cryoprotecteurs. Conserver à -80 ° C.

    3. conjugatif Mating Assays

    1. Conjugatif Mating pour générer XK1200 pOX38-Tc Δgene :: cm Cellules
      1. Préparer une solution stérile de 20 ml LB O / N culture de DY330R pOX38-Tc Δgene :: cellules Cm + pK184 gène à l'aide d'une pipette ou une boucle stérile pour inoculer un mL stérile LB 20 contenant 20 pg / ml Cm et 50 pg / ml Km avec un stock de glycérol ou d'une colonie unique sur une plaque de gélose. Cultivez à 32 ° C sous agitation à 200 tours par minute. Préparer le même pour XK1200 cellules dans 20 ml stérile LB avec 10 pg / ml Nal, croître à 37 ° C.
      2. Faire des dilutions de 1:70 de chaque culture séparément dans 2 ml de LB stérile ayant le même contenu d'antibiotiques; ajouter du glucose à une concentration finale de 100 mM à toutes les cellules du donneur. Cultiver les cellules à la phase mi-log (DO 600 0,5-0,7) à 37 ° C sous agitation à 200 tours par minute.
      3. Centrifugeuse (4000 xg pendant 5 min à 4 ° C) pour sédimenter les cellules, éliminer le surnageant, laver une fois par le froid LB stérile pour éliminer les antibiotiques, et remettre les cellules dans 2 ml froid LB. stérile
      4. Aliquoter 100 pi de chaque culture dans 800 pi de milieu LB stériles et leur permettre de s'accoupler à 32 ° C pendant 1 h sans agitation.
      5. <li> Vortex les cellules pendant 30 s pour perturber les paires d'accouplement et les placer sur de la glace pendant 10 minutes pour empêcher la reproduction.
      6. Aliquote de 100 ul du mélange de cellules sur une plaque de gélose contenant 10 pg / ml de Nal et 20 pg / ml de Cm pour sélectionner les cellules XK1200 pOX38-Tc Δgene :: cm. Répartir les cellules à l'aide d'un épandeur stérile. Garder la zone stérile et travailler à proximité d'une flamme. Incubé la plaque O / N à 37 ° C à l'envers.
      7. Récolter une seule colonie du gène nouveau XK1200 pOX38-Tc Δ :: Cm souche knockout en utilisant une pipette ou une boucle stérile et croître dans LB stérile avec 20 pg / mL Cm, O / N à 37 ° C sous agitation à 200 tours par minute. Faire 3-5 stocks de glycérol de l'O / N en mélangeant 500 ul de la culture O / N avec 500 ul de 100% de glycerol stérile (50% final v / v) dans des tubes stériles cryoprotecteurs. Conserver à -80 ° C.
        Remarque: Les cellules résultantes peuvent maintenant être compétentes pour la transformation avec les constructions pK184-géniques (protocoles 1.3 et 1.4) pour le culessing le gène et ses mutants sur la capacité à récupérer le transfert conjugatif dans le protocole 3.2.
    2. Conjugatif Mating Assay de XK1200 donateurs aux bénéficiaires de MC4100
      1. Préparer un O / N culture de XK1200 pOX38-Tc Δgene :: Cm + pK184 gène cellules dans 20 ml de LB stérile avec 20 ug / Cm ml, 50 pg / ml Km et MC4100 cellules dans 5 ml LB avec 50 pg / ml de streptomycine (Sm) en utilisant des cellules à partir d'un stock de glycérol ou d'une colonie unique sur une plaque de gélose et stérile une pipette ou d'une boucle. Cultivez cultures à 37 ° C avec 200 rpm agitation.
      2. Effectuer des dilutions 1:70 de chaque culture O / N séparément dans 2 ml de LB stérile avec les mêmes antibiotiques. Ajouter du glucose à une concentration finale de 100 mM à toutes les cellules du donneur. Cultiver les cellules à la phase mi-log (DO 600 0,5-0,7) à 37 ° C sous agitation à 200 tours par minute.
      3. Centrifugeuse (4000 xg pendant 5 min à 4 ° C) pour sédimenter les cellules, éliminer le surnageant, laver une fois par le froid LB stérile pour éliminer antibiotics, et remettre les cellules dans 2 ml de LB. stérile froide
      4. En double, aliquote de 100 pi de chaque culture dans 800 pi de milieu LB stériles et leur permettre de s'accoupler à 37 ° C pendant 1 h sans agitation.
      5. Vortex les cellules pendant 30 s pour perturber les paires d'accouplement et les placer sur la glace pendant 10 min pour empêcher la reproduction.
      6. En utilisant les cultures mi-log de l' étape 3.2.2 et LB frais stérile, préparer 6 dilutions en série des cellules du donneur et du receveur de 10 -2 à 10 -7.
      7. Sur chacune des deux moitiés d'une plaque de gélose contenant 10 pg / ml de Nal, 20 pg / ml de Cm et 50 pg / ml de Km, repérer aliquotes de 10 pi de chaque dilution de XK1200 cellules du donneur, comme le montre la figure 2. Répéter les dilutions des cellules MC4100 receveur sur des plaques de gélose contenant 50 pg / ml Sm. Incuber les plaques O / N à 37 ° C.
      8. En utilisant le mélange de l' étape 3.2.5 tourbillonnement et LB stérile frais, la préparation de 6 dilutions (10 -2 à 10 -7 figure 2. Répétez l'opération pour les deux mélanges en double. Garder la zone stérile et travailler à proximité d'une flamme. Incuber les plaques O / N à 37 ° C.
      9. Déterminer l'efficacité d'accouplement de chaque produit d'assemblage tel que décrit dans le protocole 3.3.
      10. Répétez ce protocole pour tous les plasmides de récupération afin d'évaluer l'effet d'une mutation particulière sur l'efficacité de la conjugaison.
    3. Calcul de l' efficacité Mating
      1. Compter le nombre de colonies de la même spotting de dilution pour chaque donneur, receveur et cellules transconjugants sur leurs plaques respectives.
      2. Compter les colonies de bénéficiaires pour tester toute partialité qui aurait pour résultat d'avoir un plus grand nombre de transconjugants que les bénéficiaires à cette dilution donnée.
      3. Calculez l'efficacité de l'accouplement comme étant le nombre de colonies de transconjugants divisé par le nombre de colonies de donneurs. Multiplier par 100 pour obtenir la valeur d'efficacité pour 100 cellules du donneur.

    Subscription Required. Please recommend JoVE to your librarian.

    Representative Results

    Le procédé de conjugaison bactérienne F induite par le plasmide est un processus coordonné qui implique des protéines de transfert dans la région de tra du F-plasmide qui assemble un T4SS pour faciliter la synthèse du pili et le transfert d'ADN par conjugaison. La protéine TRAF (GenBank # BAA97961; UniProt ID P14497) est nécessaire pour la formation conjugatif F-pili. 10,14,35 - 37 La protéine contient un domaine semblable à la thiorédoxine C-terminale, mais il n'a pas le motif CXXC catalytique. 35,38 Bien qu'il ait été prévu pour interagir avec la protéine Trah par son domaine N-terminal, 39 une région révélée plus dynamique que son domaine C-terminal, 37 pas beaucoup de choses sont connues sur les caractéristiques structurelles de la protéine. Pour évaluer les aspects fonctionnels de la protéine TRAF en conjonction avec des études structurales, nous avons d' abord frappé le gène TRAF sur le pOX38-Tc via homologuerecombinaison, générant le pOX38-Tc :: cm ΔtraF plasmide (tableau 1) dans des cellules de E. coli DY330R. 33,34 également généré était le plasmide pK184-TRAF de TRAF amorces spécifique de (tableau 2) pour fournir la récupération de la conjugaison et permettent de sondage la séquence de la protéine. Le transfert du pOX38-Tc ΔtraF :: Cm plasmide dans XK1200 cellules 40 à partir de cellules DY330R lorsque pK184-TRAF a été fournie en trans (transconjugants cultivé sur 10 pg / mL Nal, 10 pg / mL Tc et 20 pg / ml Cm) indique que (a) le knock - out TRAF dans pOx38-Tc ΔtraF :: cm fournit une cassette en cadre CAT, et (b) que pK184-TRAF peut restaurer la fonction conjugatif.

    Une série de mutants TRAF ont été générés pour l' analyse en utilisant le test d'accouplement conjugatif 37 en utilisant XK1200 pOX38-Tc ΔtraF :: Cm + pK184-TRAF AXles cellules et les cellules MC4100 41 en tant que donateurs et bénéficiaires, respectivement. Un mutant représentatif est TRAF 55-247 (tableau 1), un mutant de délétion N-terminale qui enlève la région de la protéine prédite pour interagir avec trah. Lorsque la pleine longueur de protéine TRAF est fournie aux cellules du donneur, le transfert conjugatif est rétablie (Figure 2), tout en fournissant le plasmide pK184 vide n'a pas (tableau 3). De même, la fonction conjugatif dans les cellules du donneur XK1200 est pas rétablie lorsqu'il est fourni avec le plasmide pK184-TRAF 55-247 (tableau 3). Cela indique que la zone tronquée de la protéine est importante pour la fonction de TRAF dans l'appareil conjugatif, probablement grâce à l'interaction avec trah et fournit une région de la protéine cible à des fins d'analyse mutationnelle.

    Figure 1
    en trans via un plasmide de récupération (pK184 gène). La résultante pOX38-Tc Δgene :: Cm plasmide est transféré dans une souche de XK1200 (étape 2) pour une évaluation plus poussée du gène en utilisant des tests d'accouplement avec un destinataire MC4100 (étape 3). S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

    Figure 2
    Figure 2: Mating test pour évaluer la fonction du gène cible dans la conjugaison. Les cellules donneuses et bénéficiaires étaient E. coli XK1200 pOX38-Tc ΔtraF :: Cm transformé avec pK184-TRAF et MC4100, respectivement. Les transconjugants obtenus (MC4100 pOX38-Tc ΔtraF :: Cm) se développent sur des plaques contenant Sm et Cm, indiquant la récupération réussie de la fonction conjugatif. L'expérience se fait en double sur une plaque de gélose unique, et des dilutions en série sont utilisées pour calculer l'efficacité de l' accouplement des mutants du gène de restauration (tableau 2). S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

    Souche bactérienne / plasmide Caractéristiques pertinentes Marqueur sélective (s) Référence
    souches bactériennes
    DY330R W3110 ΔlacU169 gal490 λc1857 Δ (cro-bioA) RifR rif 33,34
    XK1200 F - lacΔU124 Δ (NADA aroG gal attλ bio gyrA) nal 40
    MC4100 araD139 Δ (argF-lac) U169 rpsL150 relA1 flbB3501 deoC1 ptsF25 rbsR Sm 41
    Vecteurs et Constructs
    pBAD33 Le plasmide d'expression en vertu de P araBAD Cm 32
    pK184 2,4 kb vecteur de clonage, P15A réplicon Km 31
    pK184-TRAF </ Td> F TRAF de pOX38 en pK184 Km 35
    pK184-TRAF 56-247 F TRAF aa 56-247 de pK184-TRAF Km
    Les plasmides conjugatifs
    pOX38-Tc IncFI, Tra +, RepFIA +, fragment HindIII f1 de F, mini-Tn Tc 29,30
    pOX38-Tc ΔtraF :: Cm pOX38-Tc avec CAT inséré dans TRAF Tc cm 35
    † cm, le chloramphénicol; Km, la kanamycine; Nal, l'acide nalidixique; Rif, rifampicine; Sm, à la streptomycine; Tc, la tetracycline
    ‡ Toutes les constructions TRAF contiennent la séquence de tête de 19 résidus pour assurer la localisation dans l'espace périplasmique.

    Tableau 1: souches de E. coli et les plasmides utilisés dans cette étude.

    Construction Apprêt*
    TRAF-Cm-Pour 5'- GATCGAGGCTGGCAGTGGTATAACGAGAAAATAAATCCGAAGGA - CTGTGACG GAAGATCACTTC -3 '
    TRAF-Cm-Rev 5'- TCTTCAGAAACGTTCAGGAACTGTTTTGCCAGGTCGTCCT - CTTATTCAGGCGT AGCACCAG -3 '
    pK184-TRAF Pour 5' - TTTTTT GAATTC TATGAATAAAGCATTACTGCCAC -3 '
    pK184-TRAF-Rev 5' - TTTTTT TAAAAATTGGGTTTAAAATCTTCAGAAA AAGCTT -3 '
    pK184-TRAF 55-247 -Pour 5 'TACG CATATG ATGGCCGCACTGCAGACGG -3'
    pK184-TRAF 55-247 5 'TACG CATATG TCCTGACGCCGGAAAAATAAAGCAGCAGAGTAA -3'
    † Tableau adapté de Lento et al. 2016 35 avec la permission
    * Régions en surplomb TRAF sont en italiques. Les sites de restriction sont soulignés (HindIII: AAGCTT, EcoRI: GAATTC, Ndel: CATATG)

    Tableau 2: Liste des amorces utilisées dans cette étude.

    Plasmide donneur † Recovery plasmide Transconjugants s § (cellules mL - 1) Mating Efficiency§ ||
    pOX38-Tc ΔtraF :: Cm Aucun 0 0
    pOX38-Tc ΔtraF :: Cm pK184 0 0
    pOX38-Tc ΔtraF :: Cm pK184-TRAF 5 x 10 3 0,0167
    pOX38-Tc ΔtraF :: Cm pK184-TRAF 55-247 0 0
    * Tableau adapté de Lento et al. 2016 35 avec la permission
    † Les cellules donneuses étaient E. coli XK1200, avec une concentration moyenne de 3 x 10 7 cellules mL -1
    ‡ cellules bénéficiaires étaient E. coli MC4100. Le nombre de transconjugants pour le contrôle positif est d'une dilution 10-5. 0 indique aucun transconjugants d'une dilution 10-2.
    §An moyenne de deux à quatre expériences d'accouplement ont été effectuées pour chaque construction.
    || Efficacité Mating est défined comme transconjugants par 100 cellules du donneur. 0 indique l'absence de l'accouplement efficacité transconjugants à partir d'une dilution 10-2

    Tableau 3: Abolished efficacité d'accouplement par TRAF constructions de deletion.

    Subscription Required. Please recommend JoVE to your librarian.

    Discussion

    processus de conjugaison bactérienne fournit un moyen par lequel les bactéries peuvent se propager des gènes offrant un avantage évolutif pour la croissance dans des environnements difficiles, tels que la propagation de marqueurs de résistance aux antibiotiques. Étant donné que la plupart des plasmides de conjugaison sont si grandes, 12 des études fonctionnelles sur les protéines impliquées dans l' assemblage du dispositif de transfert par mutation des gènes cibles sur le plasmide conjugatif se sont difficiles à manier. Les protocoles détaillés ici fournissent un moyen par lequel on peut plus facilement évaluer le gène cible d'intérêt par l'utilisation de petits plasmides, plus faciles à gérer d'expression (figure 1). Nous employons le plasmide F dérivé pOX38-Tc (tableau 1) pour étudier F plasmidique conjugaison; d'autres plasmides de conjugaison peuvent être étudiés en utilisant les protocoles détaillés ici et plasmides dérivés appropriés. Les essais d'accouplement décrites ont été adaptées de Frost et ses collègues, 42 avec quelques MODIFICATIons. Dans des études antérieures, 8,33,42 la création du pOX38-Tc :: cm Δgene d' assemblage a été réalisé en clivant le gène d'intérêt avec les enzymes de restriction appropriées et l' insertion de la cassette CAT amplifié dans pOX38-Te. 42 Dans le procédé actuel, nous utilisons une recombinaison homologue dans la recombineering souche de E. coli à 33,34 DY330R knock - out du gène cible et de le remplacer par la cassette CAT. Ceci présente un avantage de permettre à la souche DY330R résultante hébergeant le pOX38-Tc Δgene :: Cm construire pour agir comme un contrôle pour le knock-out spécifique du gène sur F-T4SS médiée transfert conjugatif via la reprise du transfert en utilisant le pK184 gène récupération plasmidique . Bien qu'il puisse être possible de générer des KO en utilisant une méthodologie CRISPER-cas9, 43 nous ne disposons pas à ce moment exploré cette possibilité.

    Le processus commence par la génération d'un knock - out de gène dans le plasmide dérivé F pOX38-Tc (Figure 1). Ceci est réalisé par l' intermédiaire d'une recombinaison homologue dans des cellules DY330R (Tableau 1), d' autres souches présentant des caractéristiques similaires telles que DY329, DY331 et DY378 peuvent également être utilisés. Les amorces sont initialement conçues pour amplifier par PCR la cassette de CAT à partir du plasmide 32 pBAD33 et contiennent en surplomb des bases qui sont spécifiques pour le gène cible (tableau 2); le produit de PCR est ensuite électroporation dans des cellules DY330R hébergeant pOX38-Tc. La recombinaison homologue génère le knock-out plasmide pOX38-Tc :: cm Δgene lorsque la cassette est insérée dans CAT-cadre à l'intérieur du gène cible, ce qui perturbe efficacement T4SS l'assemblage et la conjugaison, tout en offrant une résistance Cm. Dans le même temps, le gène cible est amplifié par PCR à partir pOX38-Te et inséré dans un petit plasmide d'expression; dans ce protocole que nous utilisons pK184 pour l'expression constitutive, cependant on peut choisir un plasmide d'expression inductible du gène cible, si désiré. Le plasmide pK184-gène est ensuite transformédans les cellules DY330R pOX38-Tc Δgene :: cm, et ces cellules sont ensuite utilisés comme donneurs de transférer le pOX38-Tc Δgene :: Cm construire par conjugaison dans XK1200 cellules pour des tests d'accouplement. Dans les essais d'accouplement, les cellules du donneur et du receveur sont XK1200 pOX38-Tc Δgene :: Cm et MC4100, respectivement. Le plasmide de récupération pK184 gène, ainsi que les mutants de la série du gène cible (délétions ou mutations ponctuelles), est fourni aux cellules du donneur afin d' évaluer leur capacité à rétablir l' accouplement, et de déterminer son efficacité, avec des cellules réceptrices de MC4100 (figure 2 ; tableau 3).

    Critique pour la procédure est l'utilisation d' un donneur approprié et souches réceptrices (tableau 1), ainsi que la conception des amorces utilisées. Pour chaque amorce conçue, il y a des orientations générales qui devraient être suivies. Alors que nous essayons de respecter strictement avec 40-60% de teneur en GC, cela peut ne pas être toujours possible. Dans de tels cas, il est la discrétion de l'expérimentateur pour tester une amorce with teneur en GC légèrement au-dessous ou au-dessus de cette plage. La température de fusion (Tm) de l'amorce avant et arrière doit être similaire, et la température de recuit (T a) la valeur doit toujours être inférieure à la Tm de 2-5 ° C pendant la PCR. L'énergie libre disponible pour permettre une épingle à cheveux à développer devrait être beaucoup plus faible que le T a, tandis que l'homo- et hétérosexualité dimérisation T m 's doivent être très faible (moins de -10 kJ et 30 ° C). Les amorces peuvent être conçues pour sonder des deletions, des insertions ou des mutations ponctuelles comme on le souhaite. Il est bien entendu essentiel que la construction de gène résultant est amplifié et ligaturé dans le plasmide de récupération en phase de telle sorte que ce dernier ne soit exprimée. La transformation des cellules compétentes peut être fait par électroporation ou choc thermique en utilisant des cellules électrocompétentes ou chimiquement compétentes, respectivement. Nous constatons que l'électroporation est plus efficace pour les grandes constructions telles que pOX38-Tc et la recombinaison homologue oligonucleçage, tandis que les plasmides d'expression plus petits tels que pK184-TRAF peuvent être facilement transformés dans des cellules en utilisant des procédés de choc thermique. Enfin, il est important de se rappeler qu'il y aura plusieurs antibiotiques utilisés tout au long du protocole, que les deux souches de donateurs et bénéficiaires nécessitent des résistances différentes qui sont différentes de celles employées sur les conjugatifs et de récupération des plasmides.

    Outre les techniques de dosages d'accouplement décrits ici, il existe d'autres méthodes qui sont utilisées pour étudier la conjugaison bactérienne, variant légèrement dans leur approche. transfert horizontal de gène est un procédé dans lequel les bactéries transfèrent un plasmide dans une cellule receveuse, y compris interespèces destinataires. 44 Une étude menée par Dahlberg et ses collègues 44 par exemple utilisé la conjugaison bactérienne pour déterminer l'étendue du interspécifique transfert horizontal de gènes. Ils ont utilisé l'incorporation de la protéine fluorescente verte (GFP) dans un plasmide clone dans des cellules KT2442; chromosomique lac I q gène dans les cellules KT2442 réprime l' expression de GFP. Lorsque le plasmide portant la GFP est transférée à une espèce sans le gène lac I q, la fluorescence est observée. 44 En dépit de sa limitation à assurer une fonction spécifique de la protéine dans diverses espèces, l'expérience interespèces de conjugaison pourrait éventuellement être couplé avec les protocoles présentés ici pour faire des prédictions d' évolution pour les interactions protéine-protéine entre les différentes espèces.

    Subscription Required. Please recommend JoVE to your librarian.

    Disclosures

    Les auteurs déclarent qu'ils ont aucun intérêt financier concurrents.

    Acknowledgments

    Cette recherche a été soutenue par une subvention à la découverte des sciences et en génie du Conseil naturel du Canada (CRSNG).

    Materials

    Name Company Catalog Number Comments
    GeneJet Plasmid Mini-Prep Kit Fisher Scientific K0503
    GeneJet Gel Extraction Kit Fisher Scientific K0692
    GeneJet PCR Purification Kit Fisher Scientific K0702
    Q5 Site-Directed Mutagenesis Kit New England Biolabs E0554S
    Broad Range DNA Ladder New England Biolabs N0303A
    Petri Dishes Fisher Scientific FB0875713
    Electroporator Eppendorf 4309000027
    Electroporation cuvettes Fisher Scientific FB101 Cuvettes have a 1 mm gap.
    Enzymes
    AvaI New England Biolabs R0152S
    EcoRI New England Biolabs R0101S
    HindIII New England Biolabs R0104L
    NdeI New England Biolabs R0111S
    Phusion DNA Polymerase New England Biolabs M0530L
    T4 DNA Ligase New England Biolabs M0202S
    DpnI New England Biolabs R0176S
    Antibiotics Final Concentrations
    Chloramphenicol (Cm) Fisher Scientific BP904-100 20 µg/mL
    Kanamycin (Km) BioBasic Inc. DB0286 50 µg/mL
    Nalidixic acid (Nal) Sigma-Aldrich N8878-25G 10 µg/mL
    Rifampicin (Rif) Calbiochem 557303 20 µg/mL
    Tetracycline (Tc) Fisher Scientific BP912-100 10 µg/mL
    Streptomycin (Sm) Fisher Scientific BP910-50 50 µg/mL

    DOWNLOAD MATERIALS LIST

    References

    1. Dobrindt, U., Hochhut, B., Hentschel, U., Hacker, J. Genomic islands in pathogenic and environmental microorganisms. Nat Rev Microbiol. 2, (5), 414-424 (2004).
    2. Furuya, E. Y., Lowy, F. D. Antimicrobial-resistant bacteria in the community setting. Nat Rev Microbiol. 4, (1), 36-45 (2006).
    3. Griffiths, A., Miller, J., Suzuki, D., Lewontin, R., Gelbart, W. An Introduction to Genetic Analysis, 7th Edition. W.H. Freeman. San Fransisco. (2000).
    4. Cooper, T. F. Recombination Speeds Adaptation by Reducing Competition between Beneficial Mutations in Populations of Escherichia coli. PLoS Biol. Barton, N. H. 5, (9), 225 (2007).
    5. Lujan, S. A., Guogas, L. M., Ragonese, H., Matson, S. W., Redinbo, M. R. Disrupting antibiotic resistance propagation by inhibiting the conjugative DNA relaxase. Proc Natl Acad Sci. 104, (30), 12282-12287 (2007).
    6. Carattoli, A. Plasmids and the spread of resistance. Int J Med Microbiol. 303, (6-7), 298-304 (2013).
    7. Shala, A., Ferraro, M., Audette, G. F. Bacterial Secretion Systems: Nanomachines for Infection and Genetic Diversity. Handbook of Clinical Nanomedicine: Nanoparticles, Imaging, Therapy and Clinical Applications. Bawa, R., Audette, G. F., Rubenstein, I. Pan Sanford Publishing. Singapore. 657-686 (2016).
    8. Tseng, T. T., Tyler, B. M., Setubal, J. C. Protein secretion systems in bacterial-host associations, and their description in the Gene Ontology. BMC Microbiol. 9, (1), Suppl 1 2 (2009).
    9. Alvarez-Martinez, C. E., Christie, P. J. Biological diversity of prokaryotic type IV secretion systems. Microbiol Mol Biol Rev. 73, (4), 775-808 (2009).
    10. Lawley, T. D., Klimke, W. A., Gubbins, M. J., Frost, L. S. F factor conjugation is a true type IV secretion system. FEMS Microbiol Lett. 224, (1), 1-15 (2003).
    11. Lederberg, J., Tatum, E. L. Gene Recombination in Escherichia Coli. Nature. 158, (4016), 558-558 (1946).
    12. Smillie, C., Garcillan-Barcia, M. P., Francia, M. V., Rocha, E. P. C., de la Cruz, F. Mobility of Plasmids. Microbiol Mol Biol Rev. 74, (3), 434-452 (2010).
    13. Willetts, N., Skurray, R. The Conjugation System of F-Like Plasmids. Annu Rev Genet. 14, (1), 41-76 (1980).
    14. Frost, L. S., Ippen-Ihler, K., Skurray, R. A. Analysis of the sequence and gene products of the transfer region of the F sex factor. Microbiol Rev. 58, (2), 162-210 (1994).
    15. Audette, G. F., Manchak, J., Beatty, P., Klimke, W. A., Frost, L. S. Entry exclusion in F-like plasmids requires intact TraG in the donor that recognizes its cognate TraS in the recipient. Microbiology. 153, Pt 2 442-451 (2007).
    16. Christie, P. J., Atmakuri, K., Krishnamoorthy, V., Jakubowski, S., Cascales, E. Biogenesis, Architecture, and Function of Bacterial Type Iv Secretion Systems. Annu Rev Microbiol. 59, (1), 451-485 (2005).
    17. Christie, P. J. Type IV secretion: the Agrobacterium VirB/D4 and related conjugation systems. Biochim Biophys Acta - Mol Cell Res. 1694, (1-3), 219-234 (2004).
    18. Bhatty, M., Laverde Gomez, J. a, Christie, P. J. The expanding bacterial type IV secretion lexicon. Res Microbiol. 164, (6), 620-639 (2013).
    19. Christie, P. J., Cascales, E. Structural and dynamic properties of bacterial Type IV secretion systems (Review). Mol Membr Biol. 22, (1-2), 51-61 (2005).
    20. Christie, P. J. Type IV secretion: Intercellular transfer of macromolecules by systems ancestrally related to conjugation machines. Mol Microbiol. 40, (2), 294-305 (2001).
    21. Christie, P. J., Whitaker, N., González-Rivera, C. Mechanism and structure of the bacterial type IV secretion systems. Biochim Biophys Acta. 1843, (8), 1578-1591 (2014).
    22. Cascales, E. The type VI secretion toolkit. EMBO Rep. 9, 735 (2008).
    23. Silverman, J. M., Brunet, Y. R., Cascales, E., Mougous, J. D. Structure and Regulation of the Type VI Secretion System. Annu Rev Microbiol. 66, (1), 453-472 (2012).
    24. Chandran, V., et al. Structure of the outer membrane complex of a type IV secretion system. Nature. 462, (7276), 1011-1015 (2009).
    25. Rivera-Calzada, A., et al. Structure of a bacterial type IV secretion core complex at subnanometre resolution. EMBO J. 32, (8), 1195-1204 (2013).
    26. Waksman, G., Fronzes, R. Molecular architecture of bacterial type IV secretion systems. Trends Biochem Sci. 35, 691 (2010).
    27. Fronzes, R., Christie, P. J., Waksman, G. The structural biology of type IV secretion systems. Nat Rev Microbiol. 7, (10), 703-714 (2009).
    28. Kaplan, M., et al. Probing a cell-embedded megadalton protein complex by DNP-supported solid-state NMR. Nat Methods. 12, (7), 5-9 (2015).
    29. Guyer, M. S., Reed, R. R., Steitz, J. A., Low, K. B. Identification of a sex-factor-affinity site in E. coli as gamma delta. Cold Spring Harb Symp Quant Biol. 45, Pt 1 135-140 (1981).
    30. Anthony, K. G., Sherburne, C., Sherburne, R., Frost, L. S. The role of the pilus in recipient cell recognition during bacterial conjugation mediated by F-like plasmids. Mol Microbiol. 13, (6), 939-953 (1994).
    31. Jobling, M. G., Holmes, R. K. Construction of vectors with the pl5a replicon, kanamycin resistance, inducible lacZα and pUC18 or pUC19 multiple cloning sites. Nucleic Acids Res. 18, (17), 5315 (1990).
    32. Guzman, L. M., Belin, D., Carson, M. J., Beckwith, J. Tight regulation, modulation, and high-level expression by vectors containing the arabinose P(BAD) promoter. J Bacteriol. 177, (14), 4121-4130 (1995).
    33. Yu, D., et al. An efficient recombination system for chromosome engineering in Escherichia coli. Proc Natl Acad Sci U S A. 97, (11), 5978-5983 (2009).
    34. Lawley, T. D., Gilmour, M. W., Gunton, J. E., Standeven, L. J., Taylor, D. E. Functional and Mutational Analysis of Conjugative Transfer Region 1 (Tra1) from the IncHI1 Plasmid R27. J Bacteriol. 184, (8), 2173-2180 (2002).
    35. Elton, T. C., Holland, S. J., Frost, L. S., Hazes, B. F-Like Type IV Secretion Systems Encode Proteins with Thioredoxin Folds That Are Putative DsbC Homologues. J Bacteriol. 187, (24), 8267-8277 (2005).
    36. Hazes, B., Frost, L. Towards a systems biology approach to study type II/IV secretion systems. Biochim Biophys Acta. 1778, 1839-1850 (2008).
    37. Lento, C., Ferraro, M., Wilson, D., Audette, G. F. HDX-MS and deletion analysis of the type 4 secretion system protein TraF from the Escherichia coli F plasmid. FEBS Lett. Tsolis, R. 590, (3), 376-386 (2016).
    38. Audette, G. F., Van Schaik, E. J., Hazes, B., Irvin, R. T. DNA-binding protein nanotubes: Learning from nature's nanotech examples. Nano Lett. 4, 1897-1902 (2004).
    39. Harris, R. L., Silverman, P. A. Tra proteins characteristic of F-like type IV secretion systems constitute an interaction group by yeast two-hybrid analysis. J Bacteriol. 186, (16), 5480-5485 (2004).
    40. Moore, D., et al. Characterization of the F-Plasmid Conjugative Transfer Gene traU. J Bacteriol. 172, (8), 4263-4270 (1990).
    41. Anthony, K. G., Sherburne, C., Sherburne, R., Frost, L. S. The role of the pilus in recipient cell recognition during bacterial conjugation mediated by F-like plasmids. Mol Microbiol. 13, (6), 939-953 (1994).
    42. Klimke, W. A., Frost, L. S. Genetic analysis of the role of the transfer gene, traN, of the F and R100-1 plasmids in mating pair stabilization during conjugation. J Bacteriol. 180, (16), 4036-4043 (1998).
    43. Jiang, W., Marraffini, L. A. CRISPR-Cas: New Tools for Genetic Manipulations from Bacterial Immunity Systems. Annu Rev Microbiol. 69, (1), 209-228 (2015).
    44. Dahlberg, C., Bergstrom, M., Andreasen, M., Christensen, B. B., Molin, S., Hermansson, M. Interspecies bacterial conjugation by plasmids from marine environments visualized by gfp expression. Mol Biol Evol. 15, (4), 385-390 (1998).

    Comments

    0 Comments


      Post a Question / Comment / Request

      You must be signed in to post a comment. Please or create an account.

      Usage Statistics