Conjugative Mating Testen voor sequentie-specifieke analyse van Transfer eiwitten die betrokken zijn in bacterieconjugatie

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Erdogan, F., Lento, C., Yaseen, A., Nowroozi-Dayeni, R., Kheyson, S., Audette, G. F. Conjugative Mating Assays for Sequence-specific Analysis of Transfer Proteins Involved in Bacterial Conjugation. J. Vis. Exp. (119), e54854, doi:10.3791/54854 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

De overdracht van genen en eiwitten op micro-niveau organismaal speelt een centrale rol in bacteriële overleving en ontwikkeling en ontstekingsprocessen. De uitwisseling van DNA tussen bacteriën of tussen een bacterie en een cel kan worden bereikt door transformatie, conjugatie of transductie vector. 1,2 Conjugatie is uniek in vergelijking met transformatie en transductie dat tijdens conjugatie tussen gram-negatieve bacteriën zoals Escherichia coli, de overdracht van DNA optreedt in een donor-gecontroleerde wijze waardoor een complexe macromoleculaire verbindt donor en ontvangende cellen. Conjugatie is de meest directe manier waarop bacteriële cellen interageren met gastheercellen genen, eiwitten of chemicaliën te injecteren om gastheersystemen. 3 Heel vaak, de overdracht van dergelijke middelen heeft opmerkelijke effect op de host, variërend van pathogenese en carcinogenese aan de evolutie en adaptatie te organiseren. Het is aangetoond dat conjugatie recombination verhoogt de snelheid van de aanpassing 3-voudig in bacteriën met een hoge mutatie tarieven onder de omstandigheden van het milieu stress. 4 Bovendien conjugatie is veruit de meest voorkomende waarlangs antibiotische resistentiegenen in bacteriële stammen worden verspreid. 5,6

Micro-organismen hebben gespecialiseerde secretie systemen ontwikkeld om de overdracht van macromoleculen over cellulaire membranen te ondersteunen; Er zijn 9 typen secretie systemen (TSSS) in gramnegatieve bacteriën die zijn beschreven T1SS, T2SS, T3SS, T4SS, T5SS, T6SS, T7SS, evenals de Sec (secretie) en Tat (twee-arginine translocatie) trajecten. 7,8 Elk type secretie systeem is verder onderverdeeld in verschillende subtypen, noodzakelijk vanwege de diversiteit van eiwitten en het onderscheidend vermogen van paden betrokken bij verschillende bacteriële stammen. Bijvoorbeeld in de type IV secretie systeem (T4SS), de Ti en Cag systemen effector transport dat het F-plasmide te vergemakkelijken, R27 eennd pKM101 T4SSs vergemakkelijken overdracht van een conjugatie plasmide. 7,9,10 Een gedetailleerd inzicht in de mechanismen die organismen assembleren hun afscheiding systemen uit hun component eiwitten en deel cellulaire inhoud met een ontvanger of hun omgeving is een belangrijke factor in de ontwikkeling van gerichte strategieën om pathogene micro-organismen en de processen van de bestrijding cellulaire infectie.

Na de initiële identificatie bacterieconjugatie in E. coli door Lederberg & Tatum, 11 een groot aantal mobiele en conjugatie plasmiden geïdentificeerd en gekarakteriseerd. 12 Dergelijke mobiele plasmiden vertonen grote bereik grootte (van 1 tot meer dan 200 kilobasen (kb)), maar alle mobiele plasmiden bevatten relaxase, die de oorsprong van overdracht (oriT) waardoor het mogelijk overdracht van het plasmide herkent. Conjugatie plasmiden verdere genen coderen voor de assemblage van een functioneel T4SS en een soortIV koppeling eiwit. 12 Bijvoorbeeld de 100 kb F-plasmide van E. coli codeert alle conjugative genen binnen een 33,3 kB overdracht (TRA) regio. 13 De genen in de tra regio van het F plasmide coderen alle eiwitten die pilus vorming te vergemakkelijken, paring vorming pair (MPF), DNA-overdracht en uitsluiting functies tijdens conjugatie plasmide-overdracht. 10,14,15 Een aanzienlijke hoeveelheid kennis is beschikbaar voor conjugative T4SSs echter gedetailleerde structurele studies van het conjugative eiwitten en complexen worden alleen maar meer recent beschikbaar komen. 16-28

Om een ​​uitgebreid overzicht van de conjugatie proces samen te stellen, wordt een koppeling van gedetailleerde structurele studies naar analyses van conjugative overdracht eiwitten mutatie nodig. Dit kan worden bereikt door conjugatie paring assays. Voor de F-plasmide, elk eiwit gecodeerd in de tra regio speelt een rol in de F-gemedieerde conjugation; daarom zal de knockout / verwijdering van een genoverdracht de conjugatie capaciteit van de cel (figuur 1) af te schaffen. Terwijl kleinere mobiele plasmiden meer bijdragen standaard verwijderingsprocedures, voor groter conjugatie plasmiden zoals F, zijn gen knockouts gemakkelijker bereikt via homologe recombinatie waarbij het doelgen vervangen met één transporteren van een afzonderlijk antibioticumresistentiegen. In het huidige protocol, maken we gebruik van homologe recombinatie op een overdracht gen van belang met chlooramfenicol acetyltransferase (CAT) in de 55 kb F plasmide afgeleide pOX38-Tc vervangen; 29,30 de resulterende knockout plasmide pOX38-Tc Δgene :: Cm vergemakkelijkt weerstand tegen chlooramfenicol (Cm) in het kweekmedium. Donor cellen die pOX38-Tc Δgene :: Cm niet kunnen conjugatie DNA-overdracht / paring zoals waargenomen door middel van een paring test beïnvloeden; de paring efficiëntie van een pOX38-Tc Δgene :: Cm donor cel en een normale recipseerde zal afnemen of, vaker, worden afgeschaft. Conjugatie overdracht van de pOX38-Tc Δgene :: Cm plasmide kan worden hersteld via een klein herstel plasmide de gerichte overdracht gen. Dit herstel plasmide kan één zijn die constitutieve expressie verschaft, zoals plasmide pK184 (pK184-gen), 31 of een die induceerbare expressie bepaalt dat zolang de plasmide goed richt het gen naar de juiste locatie in de cel (cytoplasma of periplasma). Bijgevolg is in de paring assays tussen deze nieuwe donor (herbergen pOX38-Tc Δgene :: Cm + pK184-gen plasmiden) en een ontvangende cel, het koppelen efficiëntie verwacht te herstellen tot bijna die van een normale donor-ontvanger paring test. Dit systeem maakt het mogelijk om de functie van de knock-out gen sonde door het genereren van een reeks pK184-genconstructen (deleties of puntmutaties) en testen het vermogen van elke construct om de dekking capaciteit van de pOX38-Tc Δgene :: Cm herbergen herstellen donor cels.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Generatie van DNA constructen

  1. Ontwerpen oligomeren voor homologe recombinatie van het doelwitgen
    1. Ontwerp een 55-72 bp uit oligomeer als volgt: (a) kies een 19-32 bp lange nucleotide sequentie die homoloog is aan een DNA-sequentie in het gebied 10-100 bp stroomopwaarts van de 5 'startplaats van het chloramfenicol acetyltransferase gen in de commerciële pBAD33 plasmide, 32 en (b) selecteer een 36-54 bp lange nucleotide sequentie homoloog is met een gebied 10-150 bp stroomafwaarts van de 5 'startplaats van het doelwitgen van belang.
      1. Bij de 3 'uiteinde van de nucleotidesequentie afgehaald (b) aan het 5' uiteinde van de nucleotidesequentie geplukt in (a), waardoor een lange 55-72 voorwaarts oligomeer.
    2. Ontwerp een 55-72 bp omgekeerde oligomeer als volgt: (a) kies een 19-32 bp lange nucleotide sequentie die homoloog is aan een DNA-sequentie in het gebied 10-100 bp stroomafwaartsvan het 3 'uiteinde van het gen chlooramfenicol in de commerciële plasmide pBAD33, en (b) selecteer een 36-54 bp lange nucleotide sequentie homoloog is met een gebied in 10-150 bp stroomopwaarts van het 3' uiteinde plaats van het doelgen plaats .
      1. Bij de 3 'uiteinde van de nucleotidesequentie afgehaald (b) aan het 5' uiteinde van de nucleotidesequentie geplukt in (a) het één oligomeer.
      2. Kopieer deze oligomeer in een beschikbare bioinformatica software en omzetten sequentie in de omgekeerde complement. Dit zal een 55-72 bp lang omgekeerde oligomeer geven.
    3. Het gebruik van beschikbare oligo-analyzer programma, controleer dan of de recombinatie oligomeren hebben GC-gehalte tussen 40-60%, lage haarspeld smelttemperatuur (T m), lage zelf- en hetero-dimerisatie Tm 's. Bestel de primers voor synthese en verzending van iedere gewenste biotechnologiebedrijf.
  2. Amplificatie van het CAT-cassette uit pBAD33 (Cm R
  3. Kweek een nacht (O / N, 16-18 h) kweek van DH5a-cellen die het plasmide pBAD33 lysogenie in steriele bouillon (LB) met 20 ug / ml chlooramfenicol (Cm) onder schudden bij 200 rpm en 37 ° C.
  4. Centrifuge 6-8 ml O / N kweek bij kamertemperatuur 5000 g gedurende 3 minuten. Giet het supernatant en haal de pBAD33 plasmide uit de pellet met behulp van een plasmide mini-prep kit (Materialen Table) en het protocol van de fabrikant.
  5. Doe een samenvatting van de pBAD33 plasmide-DNA door toevoeging van een steriele buis in de gegeven volgorde: bijpassende hoeveelheid dubbel gedestilleerd water (DDH 2 O) tot een eindvolume van 50 ui, 1 ug volume pBAD33 plasmide, 5 pi 10x enzymreactie buffer en 0,5 ul van Aval restrictie-enzymen (RE). Meng door pipetteren en laat de reactie verlopen gedurende 1 uur bij 37 ° C. Warmte inactiveren de reactie gedurende 20 minuten (min) bij 80° C. WINKEL monsters bij -20 ° C gedurende maximaal 24 uur bij klevende uiteinden degradatie te minimaliseren.
  6. Bereid een 1,2% agarose gel scheiden door mengen van 1,2 g agarose met 100 ml 1 x TAE (40 mM Tris, pH 8,5; 20 mM azijnzuur, 1 mM EDTA) buffer in een 250 ml Erlenmeyer kolf. Warmte en zwenk om volledig op te lossen in een magnetron. Stop het verwarmen van zodra de vloeistof begint te koken en schud de kolf.
    1. Koel de vloeistof agarose gedurende 3 minuten bij kamertemperatuur onder wervelen, voeg 2 pl van 10 mg / ml ethidiumbromide en werveling te mengen. Giet de agarose gel in een bak met een goed kam en laat het stollen gedurende 1 uur bij kamertemperatuur geroerd. WINKEL gels bij 4 ° C gedurende maximaal 2 dagen in 1 x TAE buffer.
  7. Meng elke RE verteren van 1.2.3 met 0,2 volume van DNA ladingskleurstof (10 pi kleurstof per 50 pi reactie) door pipetteren. Belasting 5 pi van 500 ug / ml DNA ladder in het eerste putje en alle RE digestie-kleurstofmengsel in een andere put op eengarose gel. Gebruik 2-3 putten alle reactievolume laden op het gel.
    1. Voer de elektroforese nauwelijks ondergedompeld in 1 x TAE buffer en werkend met 45-50 V (4,5-5 V / cm) gedurende 65 min in een gel elektroforese-inrichting.
  8. Met UV kast en een steriel scheermes snel stuurde de 2,8 kb band die overeenkomt met de CAT sequentie uit de gel aan UV blootstelling van DNA minimaliseren. Extract het DNA uit de gel uitgesneden segment onder toepassing van een gel extractie kit (Materials Table) volgens het protocol van de fabrikant.
    Let op: Zorg ervoor dat u de huid bloot direct onder UV en omgaan met de scheerapparaat met zorg.
  9. Versterken de CAT cassette onttrokken 1.2.6 door polymerasekettingreactie (PCR) met behulp van primers ontworpen 1,1 overhangen die homoloog zijn aan de gensequentie om homologe recombinatie bevatten. PCR reacties worden opgezet op het ijs met behulp van de richtlijnen van de fabrikant (Materials Table) in de volgende volgorde:
    1. In eensteriele PCR-buis, voeg een zodanige hoeveelheid van DDH 2 O tot een eindvolume van 50 pl, gevolgd door 10 gl PCR buffer, 1 pl 10 mM dNTP's, 2,5 pl 10 pM forward primer, 2,5 pl 10 uM reverse primer , 1-25 ng matrijs DNA uit 1.2.6 en 0,5 pi van 100 eenheden / ul DNA polymerase.
    2. Opzetten van een negatieve controle die dezelfde componenten draagt ​​als 1.2.7.1, maar met uitzondering van matrijs DNA. Gebruik een geschikt volume van DDH 2 O in plaats van matrijs DNA. Stel een positieve controle gebruikt matrijs-DNA en primers die zijn bewezen te werken in een PCR-reactie, zoals die als positieve controles door de fabrikant.
    3. Meng alle inhoud reactie voorzichtig door pipetteren.
    4. Amplify via PCR met de volgende instellingen: Initiële denaturatie gedurende 30 seconden bij 98 ° C, 30 cycli van denaturatie gedurende 10 s bij 98 ° C, primer annealing gedurende 20 s, verlenging 20 s per kilobase amplicon bij 72 ° C en een vinal verlenging van 10 min bij 72 ° C. Store monsters bij -20 ºC.
  10. Bevestig de juiste grootte van de versterking via agarosegelelektroforese (zie 1.2.4-1.2.5) met behulp van slechts 5 pi van elke reactie. Zuiver het PCR amplicon met behulp van een PCR zuivering kit en protocol van de fabrikant. WINKEL gezuiverd DNA bij -20 ° C.
  • De pK184-gen Recovery Plasmid
    1. Ontwerp een voorwaartse primer beginnend bij het 5 'uiteinde en gaat naar het 3'-uiteinde in deze volgorde: (a) kies 4 willekeurige nucleotiden (een combinatie van adenine, thymine, guanine en cytosine) voor splitsing efficiëntie, gehecht aan (b) de EcoRI restrictie-enzym (RE) gesneden ter sequentie (GAATTC), gevolgd door (c) een 21-25 bp lange nucleotide sequentie die homoloog is aan het 5 'uiteinde van het gen van belang, waaronder het startcodon. Als het doel-gen bevat een EcoRI-plaats, kies dan een andere geschikte RE uit de pK184 meervoudige kloneringsplaats.
    2. In het geval van genen coderend periplasmatische eiwitten bevatten een additionele leadersequentie tussen de RI plaats en het startcodon van de voorwaartse primer.
    3. Het gebruik van beschikbare oligo-analyzer, controleer dan of de primers hebben GC-gehalte tussen 40-60%, lage haarspeld T m, lage zelf- en hetero-dimerisatie Tm 's. Bestel de primers voor de synthese.
    4. Kweek een O / N kweek van DY330R pOX38 Tc-cellen in steriel LB met 10 ug / ml tetracycline (Tc) onder schudden bij 32 ° C en 200 rpm. Centrifuge 6-8 ml O / N kweek bij kamertemperatuur 5000 g gedurende 3 minuten. Schenk desupernatant en pak het plasmide DNA van de pellet met behulp van een plasmide mini-prep kit (Materialen Table) en het protocol van de fabrikant.
    5. Versterken het volledige gen van belang met de primers van 1.3.1-1.3.5 gebruik pOX38-Tc als de sjabloon (zie 1.2.7.1-1.2.7.3).
    6. Bevestig de juiste grootte van de versterking via agarosegelelektroforese (zie 1.2.4-1.2.5) met behulp van slechts 5 pi van elke reactie. Zuiver het geamplificeerde DNA met behulp van een PCR zuivering kit en protocol van de fabrikant. WINKEL gezuiverd DNA bij -20 ° C.
    7. Een dubbel digest van zowel het commercieel verkrijgbare plasmide pK184 DNA en het geamplificeerde gen (van 1.3.7.), Door toevoeging van een steriele buis in de gegeven volgorde: geschikt volume DDH 2 O tot een eindvolume van 50 ul , 1 ug plasmide pK184 volume, 5 pi 10x reactiebuffer enzym en 1 pi van elke EcoRI en HindIII.
      1. Meng door pipetteren en laat de reactie verlopen gedurende 1 uurbij 37 ° C. Warmte inactiveren de reactie gedurende 20 minuten bij 80 ° C. WINKEL monsters bij -20 ° C gedurende maximaal 24 uur bij klevende uiteinden degradatie te minimaliseren.
        Opmerking: Het type restrictienuclease hier hangt af van de restrictie nuclease plaats die is gemanipuleerd in de primers in stappen 1.3.1 en 1.3.2.
      2. Als een positieve controle, en Single digesten van het plasmide pK184 door het bereiden van dezelfde reactie als in 1.3.8, behalve voeg slechts een van de RI een reactiebuis. Doe dit apart met beide Res.
    8. Draaien de monsters op een 1,2% agarosegel met behulp van protocollen 1.2.4-1.2.5 Pak de dubbele DNA-digest fragmenten van zowel pK184 en het gen van belang volgens stap 1.2.6.
    9. Ligeren het gen insert in de vector pK184 door het toevoegen van componenten in een steriel buisje in de volgende volgorde: 2 ui 10X T4 DNA-ligasebuffer in totaal 100 ng DNA uit een 1: 3 vector: insert (pK184: gen) ratio, DDH 2 O tot eentotaal volume van 20 ul en 1 pi T4 DNA ligase. Als negatieve controle werd een soortgelijk reactiemengsel met 100 ng vector zonder insert gen.
      1. Meng alle inhoud reactie onder toepassing van een micropipet en incubeer gedurende 30 minuten bij 25 ° C. Hitte-inactiveren de ligatiereactie gedurende 10 minuten bij 65 ° C en plaats op ijs.
    10. Terwijl op ijs, voeg 15 pi van de pK184-gen ligatiereactie uit stap 1.3.10 tot 100 ul van chemisch competente DH5a cellen in een steriele 1,5 mL buis. Meng door pipetteren en incubeer op ijs gedurende 10 min. Doe hetzelfde voor de negatieve controle monster. Voor een positieve controle gebruikt 20-100 ng van een plasmide zoals pBAD33 en omzetten in 50 uL DHα cellen.
    11. Direct de monsters overbrengen van ijs in een 42 ° C waterbad en incubeer gedurende 90 seconden. Dit verschaft de cellen een heat shock en kunnen zij het plasmide-DNA opname.
    12. Plaats cellen terug op ijs andere5 min en voeg dan 900 ul van steriel LB. Incubeer bij 37 ° C gedurende 1 uur onder schudden bij 125 rpm.
    13. Aliquot een 100 pi hoeveelheid monster van de ligatiereactie in 1.3.13 op een agarplaat met 50 ug / ml kanamycine (Km) en verdeel de cellen met een steriele spreader. De positieve controle plaat dienen geschikte antibiotica. Houd de ruimte steriel en werken in de buurt van een vlam. Incubeer de plaat op zijn kop bij 37 ° C gedurende de nacht.
    14. Met een steriele pipet of lus, oogst een afzonderlijke kolonie van cellen en inoculeren een 20 ml steriel LB met 50 ug / ml Km. Houd de ruimte steriel en werken in de buurt van een vlam. Groeien de cellen O / N bij 37 ° C onder schudden bij 200 rpm.
    15. Voeg 3-5 glycerolvoorraden van de getransformeerde DH5a cellen door het mengen van 500 ui van de O / N kweek met 500 pl steriel 100% glycerol (v / v uiteindelijke 50%) in steriele cryo-buizen. Bewaar bij -80 ° C.
    16. Ook centrifuge 6-8 ml O / N kweek bij kamertemperatuur 5,000 g gedurende 3 min. Giet het supernatant en haal de pK184-gen herstel plasmide uit de pellet met behulp van een plasmide mini-prep kit (Materialen Table) en het protocol van de fabrikant.
  • pK184 - gen Mutants
    Opmerking: Primers ontworpen voor deleties, inserties en / of puntmutaties kunnen eenvoudig worden gegenereerd met behulp van online beschikbare tools fabrikanten.
    1. Ontwerp iedere voorwaartse primer door het oppakken van een 18-32 bp lange nucleotide sequentie die homoloog is aan het 5 'uiteinde van het gen van belang, waaronder het startcodon. Ontwerp primers zodat elke voorwaartse primer hybridiseert 30-180 bp stroomafwaarts van het voorgaande, waardoor deletiemutanten ontbreekt N-terminale peptidefragmenten van geschikte lengte.
    2. Ontwerp een reverse primer door het plukken van een 18-32 bp lange nucleotide sequentie die homoloog is aan het 3 'uiteinde van het gen van belang waaronder het stopcodon. Kopieer deze primer in eenny beschikbare bioinformatica programma en zetten de sequentie in de omgekeerde complement. Dit is de omgekeerde primer.
      1. In het geval van genen coderend periplasmatische eiwitten, het ontwerp van de reverse primer die het omgekeerde complement van het 3'- uiteinde van een leadersequentie die de 5 flanken uiteinde van het gen en is vereist voor een goede localisatie van het eiwitproduct in het periplasma.
    3. Het gebruik van beschikbare oligo-analyzer programma, controleer dan of het schrappen primers hebben GC-gehalte tussen 40-60%, lage haarspeld smelttemperatuur (T m), lage zelf- en hetero-dimerisatie Tm 's. Bestel de primers voor synthese en verzending van alle beschikbare biotechnologiebedrijf.
    4. Met behulp van de pK184-gen-construct verkregen in Protocol 1.3 als de matrijs en de richtlijnen in 1.2.7-1.2.8, PCR versterken de verwijdering constructen met de primers ontworpen in de stappen 1.4.1-1.4.3 naar pK184-gen AX amplicons te genereren . Store versterkt DNA eent -20 ° C.
    5. Afbinden de versterkte constructie met behulp van alle beschikbare mutagenese kit (Materials tabel).
    6. Transformeer elk van de pK184-gen AX ligeert afzonderlijk in chemisch competente DH5a cellen met behulp van een standaard heat shock-protocol (zie 1.3.11-1.3.13).
    7. Aliquot een 100 pi hoeveelheid monster van de ligatiereactie in 1.4.12 op een agarplaat met 50 ug / ml Km en verspreiden de cellen met een steriele spreader. Houd de ruimte steriel en werken in de buurt van een vlam. Incubeer de plaat op zijn kop bij 37 ° C gedurende de nacht.
    8. Met een steriele pipet of lus, oogst een afzonderlijke kolonie van cellen en inoculeren een 20 ml steriel LB-medium met 50 ug / ml Km. Houd de ruimte steriel en werken in de buurt van een vlam. Groeien de cellen O / N bij 37 ° C onder schudden bij 200 rpm.
    9. Voeg 3-5 glycerolvoorraden van de getransformeerde DH5a cellen door het mengen van 500 ui van de O / N kweek met 500 pl steriel 100% glycerol (fspronkelijke 50% v / v) steriele cryo-buizen. Bewaar bij -80 ° C.
    10. Centrifuge 6-8 ml O / N kweek bij kamertemperatuur 5000 g gedurende 3 minuten. Giet het supernatant en haal de pK184 gen AX plasmide te construeren uit de pellet met behulp van een plasmide mini-prep kit (Materialen Table) en het protocol van de fabrikant. WINKEL DNA bij -20 ° C.
  • 2. Genereren van pOX38-Tc Δgene :: Cm Stammen

    1. DY330R pOX38-Tc Δgene :: Cm knockouts
      1. Bereid een O / N kweek van DY330R pOX38 Tc-cellen in 10 ml steriele LB met 10 ug / ml Tc. Cultuur groeien O / N bij 32 ° C en 200 rpm.
      2. Voeg een 1:70 verdunning van de O / N kweek in 20 ml vers steriel LB. Groeien de cellen bij 32 ° C tot mid-log fase (OD 600 nm 0,4-0,6) groei.
      3. Breng 10 ml kweek in een steriele kolf en geïncubeerd bij 42 ° C gedurende 15 minuten bij 150 rpm in een schuddend water- baTh. Dit zal de expressie van recombinatie eiwitten induceren in DY330R.
      4. Koel de kweek in een ijs-waterbad gedurende 10 minuten. Bereid elektrocompetente cellen als volgt.
        1. Breng de gekoelde cellen in voorgekoeld conische buizen en centrifugeer bij 4000 xg gedurende 7 minuten bij 4 ° C. Alle buizen en pipetten voor gebruik in de eerstvolgende stappen moeten bij 4 ° C worden gebracht of op ijs te koelen.
        2. Verwijder de supernatant en voorzichtig geresuspendeerd de cellen in 1 ml ijskoude DDH 2 O. Voeg nog 30 ml ijskoude DDH 2 O.
        3. Centrifugeer de cellen (4000 xg, 7 min, 4 ° C), Giet de bovenstaande vloeistof voorzichtig geresuspendeerd de cellen in 1 ml ijskoude DDH 2 O.
        4. Breng de geresuspendeerde cellen in voorgekoeld 1,5 ml microfuge buizen en centrifugeer bij 15.000 xg gedurende 1 min bij 4 ° C.
        5. Voorzichtig geresuspendeerd de pellet in 200 pl ijskoude DDH 2 O en aliquot in 50 pl volumes. Electrocompetent cellen kunnen worden opgeslagen bij -80 ° C
      5. Voeg 300 ng van het geamplificeerde CAT cassette van 1,2 tot 50 pl elektrocompetente DY330R pOX38 Tc-cellen onder mengen op ijs, voorzichtig door en neer te pipetteren. Herhaal deze stap gebruikt ongemodificeerde pBAD33 plasmide als een positieve controle.
      6. Overdracht van de cellen aan een voorgekoelde (-20 ° C) 1 mm elektroporatie cuvet. Electroporate de cellen bij 1,8 kV met een tijdconstante van 5,5 ms, met een electroporator. Onmiddellijk na het aanbrengen van de puls Verdun de cellen met 1 ml SOC-media en overbrengen naar een nieuwe microfugebuis. Incubeer de cellen bij 32 ° C gedurende 2 uur.
      7. Aliquot 100 pi van elk monster op agarplaten die 10 ug / ml Tc en 20 ug / ml Cm en verspreid met een steriele spreader. Houd de ruimte steriel en werken in de buurt van een vlam. Incubeer de plaat op zijn kop bij 32 ° C gedurende de nacht om te kiezen voor de succesvolle recombinanten. De CAT-cassette ingebracht in de cel zal homologe re ondergaancombinatie met het gen van interesse en maak de DY330R pOX38-Tc Δgene :: Cm (Rif R, TcR, Cm R) kloon.
        Opmerking: Het is belangrijk DY330R cellen groeien bij 32 ° C, met uitzondering van de 15 min inductie bij 42 ° C uit stap 2.1.3 uit te genereren elektrocompetente cellen, verlengde groei bij verhoogde temperaturen risico celdood door de productie van toxische producten uit de PL operon belast recombinatie functies DY330R. 33,34
      8. Bereid een O / N van DY330R pOX38-Tc Δgene :: Cm cellen door het oogsten van een afzonderlijke kolonie van cellen met een steriele pipet of lus, en inoculeren een 20 ml steriel LB-medium met 10 ug / ml Tc en 20 ug / ml Cm. Houd de ruimte steriel en werken in de buurt van een vlam. Groeien de cellen O / N bij 32 ° C onder schudden bij 200 rpm.
      9. Voeg 3-5 glycerolvoorraden van de O / N door het mengen van 500 ui van de O / N kweek met 500 pl steriel 100% glycerol (/ v uiteindelijke 50% v) steriele cryo-buizen. Bewaar bij -80 ° C.
      10. Centrifuge 6-8 ml O / N kweek bij kamertemperatuur 5000 g gedurende 3 minuten. Giet het supernatant en haal de pOX38-Tc Δgene :: Cm construeren van de pellet met behulp van een plasmide mini-prep kit (Materialen Table) en het protocol van de fabrikant; opslaan gezuiverd DNA bij -20 ° C.
      11. Voer een conjugative paring test met behulp van XK1200 cellen als de ontvanger tot een verstoring van de vervoeging van gen knock-out te bevestigen volgens het protocol 3.1.
    2. DY330R pOX38-Tc Δgene :: Cm + pK184-gen
      1. Transformeer elektrocompetente DY330R pOX38-Tc Δgene :: Cm cellen met 300 ng van het pK184-genconstruct via elektroporatie als per stappen 2.1.4-2.1.7. Alle selectieve media moeten 20 ug / ml Cm en 50 pg / ml Km bevat. Incubeer bij 32 ° C. Het herstel plasmide in de geëlektroporeerde cellen zal nu opnieuw de functie van de knock-out gen in de DY330R pOX38-Tc Δgene :: Cm cellen.
      2. Bereid een O / N van DY330R pOX38-Tc Δgene :: Cm + pK184 gen recombinante cellen door het oogsten van een afzonderlijke kolonie van de cellen met een steriele pipet of lus, en inoculeren een 20 ml steriel LB-medium met 20 ug / ml Cm en 50 ug / ml Km. Houd de ruimte steriel en werken in de buurt van een vlam. Groeien de cellen O / N bij 32 ° C onder schudden bij 200 rpm.
      3. Voeg 3-5 glycerolvoorraden van de O / N door het mengen van 500 ui van de O / N kweek met 500 pl steriel 100% glycerol (v / v uiteindelijke 50%) in steriele cryo-buizen. Bewaar bij -80 ° C.
      4. Ook voeren protocol 3.1 tot XK1200 pOX38-Tc Δgene :: Cm genereren van recombinante cellen.
    3. XK1200 pOX38-Tc Δgene :: Cm + pK184-gen en mutanten
      1. Bereid elektrocompetente XK1200 pOX38-Tc Δgene :: Cm cellen (uit stap 2.2.4).
      2. Afzonderlijk electroporate 300 ng pK184-gen of pK184-gen mutant plasmiden in 50 ul van electrocompetent XK1200 pOX38-Tc Δgene :: Cm cellen als per stappen 2.1.4-2.1.7. Alle selectieve media moeten 10 ug / ml nalidixinezuur (Nal), 20 ug / ml Cm en 50 pg / ml Km bevat en geïncubeerd bij 37 ° C.
      3. Bereid een O / N van XK1200 pOX38-Tc Δgene :: Cm + pK184 gen recombinante cellen door het oogsten van een afzonderlijke kolonie van de cellen met een steriele pipet of lus, en inoculeren een 20 ml steriel LB-medium met Nal, 20 ug / mL cm en 50 ug / ml Km. Houd de ruimte steriel en werken in de buurt van een vlam. Groeien de cellen O / N bij 37 ° C onder schudden bij 200 rpm.
      4. Voeg 3-5 glycerolvoorraden van de O / N door het mengen van 500 ui van de O / N kweek met 500 pl steriel 100% glycerol (v / v uiteindelijke 50%) in steriele cryo-buizen. Bewaar bij -80 ° C.

    3. Conjugatieve Mating Testen

    1. Conjugative Mating naar XK1200 pOX38-Tc Δgene :: Cm Cells Genereer
      1. Bereid een 20 ml steriel LB O / N cultuur van DY330R pOX38-Tc Δgene :: Cm + pK184-gen cellen met een steriele pipet of lus voor het enten van een 20 ml steriele LB met 20 ug / ml Cm en 50 pg / ml Km met een glycerol stock of enkele kolonie op agar plaat. Groeien bij 32 ° C onder schudden bij 200 rpm. Bereid hetzelfde voor XK1200 cellen in 20 ml steriel LB met 10 ug / ml Nal, groeit bij 37 ° C.
      2. Voeg 1:70 verdunningen van elke kweek afzonderlijk in 2 ml steriel LB met dezelfde aan antibiotica; voeg glucose tot een uiteindelijke concentratie van 100 mM tot alle donorcellen. Groeien cellen tot mid-log fase (OD600 0,5-0,7) bij 37 ° C onder schudden bij 200 rpm.
      3. Centrifuge (4000 xg gedurende 5 minuten bij 4 ° C) om cellen te pelleteren, gooi supernatant, eenmaal wassen met koud steriel LB antibiotica en resuspendeer cellen te verwijderen in 2 ml koud steriel LB.
      4. Aliquot 100 pi van elke cultuur in 800 pi steriel LB-medium en laten paren bij 32 ° C gedurende 1 uur zonder schudden.
      5. <li> Vortex de cellen gedurende 30 s op de bijpassende paren verstoren en plaats ze op ijs gedurende 10 minuten verder paring voorkomen.
      6. Aliquot 100 pi van het celmengsel op een agarplaat met 10 ug / ml Nal en 20 ug / ml Cm te selecteren op XK1200 pOX38-Tc Δgene :: Cm cellen. Spreid de cellen met behulp van een steriele spreader. Houd de ruimte steriel en werken in de buurt van een vlam. Bebroede de plaat O / N bij 37 ° C ondersteboven.
      7. Oogst een enkele kolonie van de nieuwe XK1200 pOX38-Tc Δ gen :: Cm knockout stam met een steriele pipet of lus en groeien in steriel LB met 20 ug / ml Cm, O / N bij 37 ° C onder schudden bij 200 rpm. Voeg 3-5 glycerolvoorraden van de O / N door het mengen van 500 ui van de O / N kweek met 500 pl steriel 100% glycerol (v / v uiteindelijke 50%) in steriele cryo-buizen. Bewaar bij -80 ° C.
        Opmerking: De resulterende cellen zijn nu in staat competent te worden gemaakt voor transformatie met de pK184-genconstructen (protocollen 1.3 en 1.4) voor assessing het gen en zijn mutanten op het vermogen om conjugatie-overdracht in protocol 3.2 te herstellen.
    2. Conjugative Mating Assay van XK1200 donoren MC4100 Ontvangers
      1. Bereid een O / N kweek van XK1200 pOX38-Tc Δgene :: Cm + pK184-gen cellen in 20 ml steriel LB met 20 ug / ml Cm, 50 ug / ml Km en MC4100 cellen in 5 ml LB met 50 ug / ml streptomycine (Sm) waarbij cellen van een glycerol stock of afzonderlijke kolonie op een agarplaat en steriele pipet of lus. Grow culturen bij 37 ° C met 200 rpm schudden.
      2. Voeg 1:70 verdunningen van elkaar O / N kweek afzonderlijk in 2 ml steriel LB met dezelfde antibiotica. glucose aan een uiteindelijke concentratie van 100 mM tot alle donorcellen. Groeien cellen tot mid-log fase (OD600 0,5-0,7) bij 37 ° C onder schudden bij 200 rpm.
      3. Centrifuge (4000 xg gedurende 5 minuten bij 4 ° C) om cellen te pelleteren, gooi supernatant, eenmaal wassen met koud steriel LB te verwijderen antibiotics en resuspendeer cellen in 2 ml koud steriel LB.
      4. In tweevoud hoeveelheid 100 pl van elke kweek in 800 pi steriel LB-medium en laten paren bij 37 ° C gedurende 1 uur zonder schudden.
      5. Vortex de cellen gedurende 30 s op de bijpassende paren verstoren en plaats ze op ijs gedurende 10 minuten verder paring voorkomen.
      6. Met de mid-log culturen uit stap 3.2.2 en verse steriele LB Bereid 6 seriële verdunningen van de donor en ontvangende cellen van 10 -2 tot 10 -7.
      7. Op elk van de twee helften van een agarplaat met 10 ug / ml Nal, 20 ug / ml Cm en 50 pg / ml Km, spot 10 pi aliquots van elke verdunning van XK1200 donorcellen, zie figuur 2. Herhaal de verdunningen van de ontvangende MC4100 cellen op agarplaten die 50 ug / ml Sm. Incubeer de platen O / N bij 37 ° C.
      8. Met behulp van de gewerveld mengsel van stap 3.2.5 en verse steriele LB, voor te bereiden 6 verdunningen (10 -2 tot 10 -7 figuur 2. Herhaal dit voor beide dubbele mengsels. Houd de ruimte steriel en werken in de buurt van een vlam. Incubeer de platen O / N bij 37 ° C.
      9. Bepaal de paring efficiëntie van elk construct zoals beschreven in protocol 3,3.
      10. Herhaal dit protocol voor alle terugwinnings- plasmiden om het effect van een bepaalde mutatie van de efficiëntie van conjugatie evalueren.
    3. Berekening van het Koppelen Efficiency
      1. Tel het aantal kolonies van dezelfde verdunning spotting per donorrecipiënte en transconjugant cellen op hun respectievelijke platen.
      2. Tellen ontvanger kolonies eventuele afwijking die zou resulteren uit een groter aantal transconjuganten dan ontvangers die gegeven verdunning getest.
      3. Calculate de paring efficiency als het aantal transconjugant kolonies gedeeld door het aantal donor kolonies. Vermenigvuldig met 100 om de efficiëntie per 100 donor cellen te verkrijgen.

    Subscription Required. Please recommend JoVE to your librarian.

    Representative Results

    Werkwijze F-plasmide aangedreven bacterieconjugatie een gecoördineerd proces dat transporterende eiwitten omvat in de tra regio van het F-plasmide dat een T4SS voor pilus synthese en conjugatie DNA te vergemakkelijken assembleert. Het eiwit TRAF (GenBank toegangsnummer # BAA97961; UniProt ID P14497) vereist is voor conjugatie-F-pilus formatie. 10,14,35 - 37 Het eiwit bevat een C-terminale thioredoxine-achtige domein, hoewel het niet de katalytische CXXC motief hebben. 35,38 Hoewel het is voorspeld om met de trah eiwit via zijn N-terminale domein, een gebied 39 getoond dynamischer dan het C-terminale domein, 37 niet veel anders bekend structurele eigenschappen van het eiwit zijn. De functionele aspecten van het TRAF-eiwit in combinatie met structurele studies evalueren we eerst uitgeschakeld TRAF gen op het pOX38-Tc via homologerecombinatie, genereren de pOX38-Tc ΔtraF :: Cm plasmide (Tabel 1) in E. coli DY330R cellen. 33,34 Ook gegenereerd was de pK184-TRAF plasmide uit TRAF-specifieke primers (tabel 2) om het herstel van de vervoeging bieden waarin indringende sequentie van het eiwit. De overdracht van de pOX38-Tc ΔtraF :: Cm XK1200 plasmide in cellen van 40 cellen DY330R wanneer pK184 TRAF werd in trans (transconjuganten gekweekt op 10 ug / ml Nal, 10 ug / ml Tc en 20 ug / ml Cm) aangeeft dat (a) de TRAF knockout in pOx38-Tc ΔtraF :: Cm bevat een in-frame CAT cassette, en (b) pK184 TRAF kan conjugatie te herstellen.

    Een reeks van TRAF mutanten werden gegenereerd voor analyse met behulp van conjugatie paring test 37 met behulp van XK1200 pOX38-Tc ΔtraF :: Cm + pK184-TRAF AXcellen en MC4100 cellen 41 als donoren en ontvangers, respectievelijk. Een vertegenwoordiger mutant TRAF 55-247 (tabel 1), een N-terminale deletiemutant die verwijdert het gebied van het eiwit voorspeld om met trah. Wanneer de volledige lengte TRAF-eiwit aan de donorcellen aanwezig is, wordt conjugatie-overdracht hersteld (figuur 2), terwijl het lege plasmide pK184 niet (Tabel 3). Evenzo wordt conjugatie functie in de XK1200 donorcellen niet hersteld wanneer voorzien van plasmide pK184 TRAF 55-247 (tabel 3). Dit geeft aan dat de afgeknotte gebied van het eiwit belangrijk is voor de functie TRAF binnen de conjugatie inrichting, waarschijnlijk door interactie met trah en verschaft een gebied van het eiwit te richten voor verdere mutatieanalyse.

    Figuur 1
    in trans geleverd via een recovery plasmide (pK184-gen). De resulterende pOX38-Tc Δgene :: Cm plasmide wordt overgebracht naar een XK1200 stam (Stap 2) voor verdere beoordeling van het gen met behulp van passende assays met een MC4100 ontvanger (stap 3). Klik hier om een grotere versie van deze figuur te bekijken.

    Figuur 2
    Figuur 2: Mating test om de functie van het doelwitgen in conjugatie beoordelen. Donor en ontvanger cellen werden E. coli XK1200 pOX38-Tc ΔtraF :: Cm getransformeerd met pK184-TRAF en MC4100, respectievelijk. De verkregen transconjuganten (MC4100 pOX38-Tc ΔtraF :: Cm) groeien op platen die Sm en Cm, met vermelding van een succesvol herstel van conjugative functie. Het experiment werd in tweevoud uitgevoerd op een agar plaat, en seriële verdunningen worden gebruikt om de berekening van de passende efficiëntie van restauratieve gen mutanten (Tabel 2). Klik hier om een grotere versie van deze figuur te bekijken.

    Bacteriestam / Plasmid relevante kenmerken Selectieve Marker (s) Referentie
    bacteriestammen
    DY330R W3110 ΔlacU169 gal490 λc1857 Δ (cro-bioA) Rif R Rif 33,34
    XK1200 F - lacΔU124 Δ (NADA aroG gal attλ bio gyrA) Nal 40
    MC4100 araD139 Δ (argF-lac) U169 rpsL150 relA1 flbB3501 deoC1 ptsF25 rbsR Sm 41
    Vectoren en constructen
    pBAD33 Plasmide voor expressie onder in P araBAD Cm 32
    pK184 2,4 kb kloneringsvector, p15A replicon km 31
    pK184-Traf </ Td> F Traf van pOX38 in pK184 km 35
    pK184-Traf 56-247 F Traf aa 56-247 van pK184-TRAF km
    conjugatie plasmiden
    pOX38-Tc IncFI, Tra +, RepFIA +, f1 HindIII fragment van F, mini-Tn Tc 29,30
    pOX38-Tc ΔtraF :: Cm pOX38-Tc met CAT ingebracht in Traf Tc Cm 35
    † Cm, chlooramfenicol; Km, kanamycine; Nal, nalidixinezuur; Rif, rifampicine; Sm, streptomycine; Tc, tetracycline
    ‡ Alle Traf constructen bevatten de 19-residu leadersequentie om de lokalisatie van de periplasmatische ruimte te waarborgen.

    Tafel 1: stammen en plasmiden gebruikt in deze studie.

    construeren primer *
    Traf-Cm-For 5'GATCGAGGCTGGCAGTGGTATAACGAGAAAATAAATCCGAAGGA - CTGTGACG GAAGATCACTTC -3 '
    Traf-Cm-Rev 5'TCTTCAGAAACGTTCAGGAACTGTTTTGCCAGGTCGTCCT - CTTATTCAGGCGT AGCACCAG -3 '
    pK184-Traf-For 5'TTTTTT GAATTC TATGAATAAAGCATTACTGCCAC -3 '
    pK184-Traf-Rev 5'TTTTTT AAGCTT TAAAAATTGGGTTTAAAATCTTCAGAAA -3 '
    pK184-Traf 55-247 -Voor 5'TACG CATATG ATGGCCGCACTGCAGACGG -3 '
    pK184-Traf 55-247 5'TACG CATATG TCCTGACGCCGGAAAAATAAAGCAGCAGAGTAA -3 '
    † Tabel aangepast van Lento et al. 2016 35 met toestemming
    * Traf overhangende gebieden zijn cursief. Restrictie-enzymplaatsen zijn onderstreept (HindIII: AAGCTT, EcoRI: GAATTC, Ndel: CATATG)

    Tabel 2: Een lijst van primers die in deze studie.

    Donorplasmide † Recovery Plasmid Transconjuganten ‡ § (cellen ml-1) Mating Efficiency§ ||
    pOX38-Tc ΔtraF :: Cm Geen 0 0
    pOX38-Tc ΔtraF :: Cm pK184 0 0
    pOX38-Tc ΔtraF :: Cm pK184-Traf 5 x 10 3 0,0167
    pOX38-Tc ΔtraF :: Cm pK184-Traf 55-247 0 0
    * Tabel aangepast van Lento et al. 2016 35 met toestemming
    † Donor cellen werden E. coli XK1200, met een gemiddelde concentratie van 3 x 10 7 cellen mL -1
    ‡ Ontvanger cellen werden E. coli MC4100. Het aantal transconjuganten voor de positieve controle is van een 10-5 verdunning. 0 geeft aan dat geen transconjuganten van een 10-2 verdunning.
    §An gemiddeld 3:58 paring experimenten werden uitgevoerd voor elk construct.
    || Het koppelen efficiëntie is Defined als transconjuganten per 100 donorcellen. 0 paring efficiency geeft geen transconjuganten uit een 10-2 verdunning

    Tabel 3: Abolished paring efficiency door Traf deletieconstructen.

    Subscription Required. Please recommend JoVE to your librarian.

    Discussion

    Bacterieconjugatie werkwijze een middel waarmee bacteriën genen kunnen verspreiden verschaffen van een evolutionair voordeel voor groei in veeleisende omgevingen, zoals de verspreiding van antibioticaresistentie markers. Omdat veel van de conjugatie plasmiden zijn zo groot, 12 functionele studies op het betrokken bij assemblage van de overbrenginrichting door mutatie van doelgenen de conjugatie plasmide zelf eiwitten onhandig. De protocollen die hierin beschreven een middel waarmee men gemakkelijker het doelgen plaats kan bepalen door het gebruik van kleinere, expressieplasmiden (figuur 1). We maken gebruik van de F plasmide afgeleide pOX38-Tc (tabel 1) tot en met F-plasmide gemedieerde vervoeging te bestuderen; andere conjugatie plasmiden kan worden bestudeerd met behulp van de protocollen hier beschreven en passende afgeleide plasmiden. De paring assays geschetste zijn aangepast van Frost en collega's, 42 met wat gewijzigd engineeringons. In vorige studies, 8,33,42 het creëren van de pOX38-Tc Δgene :: Cm construct werd verkregen door splitsing van het gen van belang met de geschikte restrictie-enzymen en invoegen van het geamplificeerde CAT cassette in pOX38-Tc. 42 In de huidige werkwijze, maken we homologe recombinatie in E. coli stam recombineering DY330R 33,34 aan het doelgen knock-out en vervangen door het CAT cassette. Dit heeft een voordeel dat de resulterende DY330R stam die de pOX38-Tc Δgene :: Cm bouwen om op te treden als een controle voor de gen-specifieke knockout out F-T4SS gemedieerde conjugatie-overdracht via het herstel van de overdracht met behulp van de pK184-gen herstel plasmide . Hoewel het mogelijk is om met een scherper knockouts-Cas9 methodologie 43 genereren we op dit moment niet onderzocht deze mogelijkheid.

    Het proces begint met het genereren van een gen knock-out in de F afgeleide plasmide pOX38-Tc (Figure 1). Dit wordt bereikt via homologe recombinatie in DY330R cellen (Tabel 1), kunnen andere stammen met gelijke functies als DY329, DY331 DY378 en worden gebruikt. Primers worden initieel ontworpen om PCR amplificeren van het CAT cassette uit de plasmide pBAD33 32 en bevatten overhangende basen die specifiek zijn voor het doelwitgen (tabel 2) zijn; het PCR-product wordt vervolgens geëlektroporeerd in cellen die DY330R pOX38-Tc. Homologe recombinatie genereert de knock-out-plasmide pOX38-Tc Δgene :: Cm waar de CAT cassette in-frame is geplaatst binnen de target-gen, effectief te verstoren T4SS assemblage en vervoeging terwijl Cm weerstand. Tegelijkertijd wordt het doelgen PCR geamplificeerd uit pOX38-Tc en een kleine expressieplasmide ingebracht; In dit protocol gebruiken we pK184 voor constitutieve expressie, maar kan men een plasmide gekozen met induceerbare expressie van het doelwitgen indien gewenst. De pK184-gen plasmide wordt vervolgensin de DY330R pOX38-Tc Δgene :: Cm cellen en deze cellen worden daarna gebruikt als donor voor de overdracht pOX38-Tc Δgene :: Cm construct via conjugatie in XK1200 cellen te paren assays. In de paring tests, de donor en ontvanger cellen zijn XK1200 pOX38-Tc Δgene :: Cm en MC4100, respectievelijk. De pK184 gen terugwinning plasmide, alsmede de reeks mutanten van het doelgen (deleties of puntmutaties), wordt aan de donor cellen op hun vermogen om paring herstellen, en bepalen de doeltreffendheid ervan, met MC4100 ontvangende cellen (Figuur 2 ; Tabel 3).

    Kritisch voor de werkwijze is het gebruik van geschikte donor en ontvangende stammen (Tabel 1), en het ontwerp van de primers toegepast. Voor elke primer ontworpen, zijn er algemene richtlijnen die moeten worden gevolgd. Terwijl we strikt proberen te houden met 40-60% GC-gehalte, kan dit niet altijd mogelijk. In dergelijke gevallen is het oordeel van de onderzoeker om een ​​primer te testen wi-GC-gehalte iets onder of boven deze range. De smelttemperatuur (Tm) van de voorwaartse en omgekeerde primer moet gelijk zijn, en de annealing temperatuur (Ta) waarde moet altijd lager zijn dan de Tm op 2-5 ° C gedurende PCR zijn. De vrije energie voor het toestaan van een haarspeld te ontwikkelen moet veel lager zijn dan de Ta, terwijl de homo- en hetero-dimerisatie Tm's moet zeer laag zijn (minder dan -10 kJ en 30 ° C). Primers kunnen worden ontworpen om deleties, inserties of puntmutaties probe zoals gewenst. Het is natuurlijk essentieel dat de resulterende genconstruct worden geamplificeerd en geligeerd in het plasmide herstel in-frame zodanig dat het goed uitgedrukt. Transformatie van competente cellen kan via elektroporatie of hitteschok behulp elektrocompetente of chemisch competente cellen. We zien dat elektroporatie is efficiënter voor grote constructies zoals pOX38-Tc en de homologe recombinatie oligonucleotide, terwijl de kleinere expressieplasmiden zoals pK184 TRAF gemakkelijk kan worden omgezet in cellen middels hitteschok werkwijzen. Ten slotte is het belangrijk om te onthouden dat er nog meerdere antibiotica in gebruik in de hele protocol, als donor en ontvanger stammen vereisen verschillende weerstanden die verschillen van degene die werkzaam zijn op de conjugatie en herstel plasmiden zijn.

    Naast de dekking assays technieken die hier beschreven zijn er andere methoden die worden gebruikt om bacteriële conjugatie bestuderen enigszins variëren in hun benadering. Horizontale genoverdracht is een proces waarbij bacteriën overbrengen van een plasmide naar een ontvangende cel, inclusief interspecies ontvangers. 44 Een studie van Dahlberg en collega's 44 bijvoorbeeld gebruikt bacterieconjugatie het bepalen van de omvang van de interspecies horizontale genoverdracht. Ze gebruikt de incorporatie van groen fluorescerend eiwit (GFP) in een plasmide gekloneerd in KT2442 cellen; het chromosomale lac ik q-gen in de KT2442 cellen onderdrukken GFP expressie. Wanneer het plasmide dat GFP wordt naar een soort zonder lac Iq gen, wordt fluorescentie waargenomen. 44 Ondanks de beperking tot eiwit specifieke functie te geven in verschillende soorten, kan de interspecies conjugatie experiment eventueel in combinatie met de hier gepresenteerde evolutionaire voorspellingen voor eiwit-eiwit interacties tussen verschillende soorten te protocols.

    Subscription Required. Please recommend JoVE to your librarian.

    Disclosures

    De auteurs verklaren dat ze geen concurrerende financiële belangen.

    Acknowledgments

    Dit onderzoek werd gesteund door een Discovery Grant van de Raad Natuurwetenschappen & Engineering van Canada (NSERC).

    Materials

    Name Company Catalog Number Comments
    GeneJet Plasmid Mini-Prep Kit Fisher Scientific K0503
    GeneJet Gel Extraction Kit Fisher Scientific K0692
    GeneJet PCR Purification Kit Fisher Scientific K0702
    Q5 Site-Directed Mutagenesis Kit New England Biolabs E0554S
    Broad Range DNA Ladder New England Biolabs N0303A
    Petri Dishes Fisher Scientific FB0875713
    Electroporator Eppendorf 4309000027
    Electroporation cuvettes Fisher Scientific FB101 Cuvettes have a 1 mm gap.
    Enzymes
    AvaI New England Biolabs R0152S
    EcoRI New England Biolabs R0101S
    HindIII New England Biolabs R0104L
    NdeI New England Biolabs R0111S
    Phusion DNA Polymerase New England Biolabs M0530L
    T4 DNA Ligase New England Biolabs M0202S
    DpnI New England Biolabs R0176S
    Antibiotics Final Concentrations
    Chloramphenicol (Cm) Fisher Scientific BP904-100 20 µg/mL
    Kanamycin (Km) BioBasic Inc. DB0286 50 µg/mL
    Nalidixic acid (Nal) Sigma-Aldrich N8878-25G 10 µg/mL
    Rifampicin (Rif) Calbiochem 557303 20 µg/mL
    Tetracycline (Tc) Fisher Scientific BP912-100 10 µg/mL
    Streptomycin (Sm) Fisher Scientific BP910-50 50 µg/mL

    DOWNLOAD MATERIALS LIST

    References

    1. Dobrindt, U., Hochhut, B., Hentschel, U., Hacker, J. Genomic islands in pathogenic and environmental microorganisms. Nat Rev Microbiol. 2, (5), 414-424 (2004).
    2. Furuya, E. Y., Lowy, F. D. Antimicrobial-resistant bacteria in the community setting. Nat Rev Microbiol. 4, (1), 36-45 (2006).
    3. Griffiths, A., Miller, J., Suzuki, D., Lewontin, R., Gelbart, W. An Introduction to Genetic Analysis, 7th Edition. W.H. Freeman. San Fransisco. (2000).
    4. Cooper, T. F. Recombination Speeds Adaptation by Reducing Competition between Beneficial Mutations in Populations of Escherichia coli. PLoS Biol. Barton, N. H. 5, (9), 225 (2007).
    5. Lujan, S. A., Guogas, L. M., Ragonese, H., Matson, S. W., Redinbo, M. R. Disrupting antibiotic resistance propagation by inhibiting the conjugative DNA relaxase. Proc Natl Acad Sci. 104, (30), 12282-12287 (2007).
    6. Carattoli, A. Plasmids and the spread of resistance. Int J Med Microbiol. 303, (6-7), 298-304 (2013).
    7. Shala, A., Ferraro, M., Audette, G. F. Bacterial Secretion Systems: Nanomachines for Infection and Genetic Diversity. Handbook of Clinical Nanomedicine: Nanoparticles, Imaging, Therapy and Clinical Applications. Bawa, R., Audette, G. F., Rubenstein, I. Pan Sanford Publishing. Singapore. 657-686 (2016).
    8. Tseng, T. T., Tyler, B. M., Setubal, J. C. Protein secretion systems in bacterial-host associations, and their description in the Gene Ontology. BMC Microbiol. 9, (1), Suppl 1 2 (2009).
    9. Alvarez-Martinez, C. E., Christie, P. J. Biological diversity of prokaryotic type IV secretion systems. Microbiol Mol Biol Rev. 73, (4), 775-808 (2009).
    10. Lawley, T. D., Klimke, W. A., Gubbins, M. J., Frost, L. S. F factor conjugation is a true type IV secretion system. FEMS Microbiol Lett. 224, (1), 1-15 (2003).
    11. Lederberg, J., Tatum, E. L. Gene Recombination in Escherichia Coli. Nature. 158, (4016), 558-558 (1946).
    12. Smillie, C., Garcillan-Barcia, M. P., Francia, M. V., Rocha, E. P. C., de la Cruz, F. Mobility of Plasmids. Microbiol Mol Biol Rev. 74, (3), 434-452 (2010).
    13. Willetts, N., Skurray, R. The Conjugation System of F-Like Plasmids. Annu Rev Genet. 14, (1), 41-76 (1980).
    14. Frost, L. S., Ippen-Ihler, K., Skurray, R. A. Analysis of the sequence and gene products of the transfer region of the F sex factor. Microbiol Rev. 58, (2), 162-210 (1994).
    15. Audette, G. F., Manchak, J., Beatty, P., Klimke, W. A., Frost, L. S. Entry exclusion in F-like plasmids requires intact TraG in the donor that recognizes its cognate TraS in the recipient. Microbiology. 153, Pt 2 442-451 (2007).
    16. Christie, P. J., Atmakuri, K., Krishnamoorthy, V., Jakubowski, S., Cascales, E. Biogenesis, Architecture, and Function of Bacterial Type Iv Secretion Systems. Annu Rev Microbiol. 59, (1), 451-485 (2005).
    17. Christie, P. J. Type IV secretion: the Agrobacterium VirB/D4 and related conjugation systems. Biochim Biophys Acta - Mol Cell Res. 1694, (1-3), 219-234 (2004).
    18. Bhatty, M., Laverde Gomez, J. a, Christie, P. J. The expanding bacterial type IV secretion lexicon. Res Microbiol. 164, (6), 620-639 (2013).
    19. Christie, P. J., Cascales, E. Structural and dynamic properties of bacterial Type IV secretion systems (Review). Mol Membr Biol. 22, (1-2), 51-61 (2005).
    20. Christie, P. J. Type IV secretion: Intercellular transfer of macromolecules by systems ancestrally related to conjugation machines. Mol Microbiol. 40, (2), 294-305 (2001).
    21. Christie, P. J., Whitaker, N., González-Rivera, C. Mechanism and structure of the bacterial type IV secretion systems. Biochim Biophys Acta. 1843, (8), 1578-1591 (2014).
    22. Cascales, E. The type VI secretion toolkit. EMBO Rep. 9, 735 (2008).
    23. Silverman, J. M., Brunet, Y. R., Cascales, E., Mougous, J. D. Structure and Regulation of the Type VI Secretion System. Annu Rev Microbiol. 66, (1), 453-472 (2012).
    24. Chandran, V., et al. Structure of the outer membrane complex of a type IV secretion system. Nature. 462, (7276), 1011-1015 (2009).
    25. Rivera-Calzada, A., et al. Structure of a bacterial type IV secretion core complex at subnanometre resolution. EMBO J. 32, (8), 1195-1204 (2013).
    26. Waksman, G., Fronzes, R. Molecular architecture of bacterial type IV secretion systems. Trends Biochem Sci. 35, 691 (2010).
    27. Fronzes, R., Christie, P. J., Waksman, G. The structural biology of type IV secretion systems. Nat Rev Microbiol. 7, (10), 703-714 (2009).
    28. Kaplan, M., et al. Probing a cell-embedded megadalton protein complex by DNP-supported solid-state NMR. Nat Methods. 12, (7), 5-9 (2015).
    29. Guyer, M. S., Reed, R. R., Steitz, J. A., Low, K. B. Identification of a sex-factor-affinity site in E. coli as gamma delta. Cold Spring Harb Symp Quant Biol. 45, Pt 1 135-140 (1981).
    30. Anthony, K. G., Sherburne, C., Sherburne, R., Frost, L. S. The role of the pilus in recipient cell recognition during bacterial conjugation mediated by F-like plasmids. Mol Microbiol. 13, (6), 939-953 (1994).
    31. Jobling, M. G., Holmes, R. K. Construction of vectors with the pl5a replicon, kanamycin resistance, inducible lacZα and pUC18 or pUC19 multiple cloning sites. Nucleic Acids Res. 18, (17), 5315 (1990).
    32. Guzman, L. M., Belin, D., Carson, M. J., Beckwith, J. Tight regulation, modulation, and high-level expression by vectors containing the arabinose P(BAD) promoter. J Bacteriol. 177, (14), 4121-4130 (1995).
    33. Yu, D., et al. An efficient recombination system for chromosome engineering in Escherichia coli. Proc Natl Acad Sci U S A. 97, (11), 5978-5983 (2009).
    34. Lawley, T. D., Gilmour, M. W., Gunton, J. E., Standeven, L. J., Taylor, D. E. Functional and Mutational Analysis of Conjugative Transfer Region 1 (Tra1) from the IncHI1 Plasmid R27. J Bacteriol. 184, (8), 2173-2180 (2002).
    35. Elton, T. C., Holland, S. J., Frost, L. S., Hazes, B. F-Like Type IV Secretion Systems Encode Proteins with Thioredoxin Folds That Are Putative DsbC Homologues. J Bacteriol. 187, (24), 8267-8277 (2005).
    36. Hazes, B., Frost, L. Towards a systems biology approach to study type II/IV secretion systems. Biochim Biophys Acta. 1778, 1839-1850 (2008).
    37. Lento, C., Ferraro, M., Wilson, D., Audette, G. F. HDX-MS and deletion analysis of the type 4 secretion system protein TraF from the Escherichia coli F plasmid. FEBS Lett. Tsolis, R. 590, (3), 376-386 (2016).
    38. Audette, G. F., Van Schaik, E. J., Hazes, B., Irvin, R. T. DNA-binding protein nanotubes: Learning from nature's nanotech examples. Nano Lett. 4, 1897-1902 (2004).
    39. Harris, R. L., Silverman, P. A. Tra proteins characteristic of F-like type IV secretion systems constitute an interaction group by yeast two-hybrid analysis. J Bacteriol. 186, (16), 5480-5485 (2004).
    40. Moore, D., et al. Characterization of the F-Plasmid Conjugative Transfer Gene traU. J Bacteriol. 172, (8), 4263-4270 (1990).
    41. Anthony, K. G., Sherburne, C., Sherburne, R., Frost, L. S. The role of the pilus in recipient cell recognition during bacterial conjugation mediated by F-like plasmids. Mol Microbiol. 13, (6), 939-953 (1994).
    42. Klimke, W. A., Frost, L. S. Genetic analysis of the role of the transfer gene, traN, of the F and R100-1 plasmids in mating pair stabilization during conjugation. J Bacteriol. 180, (16), 4036-4043 (1998).
    43. Jiang, W., Marraffini, L. A. CRISPR-Cas: New Tools for Genetic Manipulations from Bacterial Immunity Systems. Annu Rev Microbiol. 69, (1), 209-228 (2015).
    44. Dahlberg, C., Bergstrom, M., Andreasen, M., Christensen, B. B., Molin, S., Hermansson, M. Interspecies bacterial conjugation by plasmids from marine environments visualized by gfp expression. Mol Biol Evol. 15, (4), 385-390 (1998).

    Comments

    0 Comments


      Post a Question / Comment / Request

      You must be signed in to post a comment. Please or create an account.

      Usage Statistics