Konjugative Mating Assays für sequenzspezifische Analyse der Übertragung beteiligten Proteine ​​in bakteriellen Konjugation

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Erdogan, F., Lento, C., Yaseen, A., Nowroozi-Dayeni, R., Kheyson, S., Audette, G. F. Conjugative Mating Assays for Sequence-specific Analysis of Transfer Proteins Involved in Bacterial Conjugation. J. Vis. Exp. (119), e54854, doi:10.3791/54854 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Die Übertragung von Genen und Proteinen auf der Mikro-Ebene organismal spielt eine zentrale Rolle bei der bakteriellen Überleben und die Entwicklung sowie Infektionsprozessen. Der Austausch von DNA zwischen Bakterien oder zwischen einem Bakterium und einer Zelle kann durch Transformation, Konjugation oder Vektorübertragung erreicht werden. 1,2 Konjugation im Vergleich zur Transformation und Transduktion, daß während der Konjugation zwischen gram-negative Bakterien wie Escherichia coli, der Transfer von DNA tritt in einem Spender gesteuert , wodurch eine komplexe makromolekulare System verbindet Spender- und Empfängerzellen einzigartig ist. Konjugation ist auch die direkte Weise, in der Bakterienzellen mit Wirtszellen interagieren Genen, Proteinen oder Chemikalien in zu Host-Systemen zu injizieren. 3 Oft hat die Übertragung solcher Mittel bemerkenswerte Effekte auf den Wirt, von der Pathogenese und Karzinogenese Entwicklung und Anpassung an den Host. Es hat sich gezeigt konjugativen recombination erhöht die Rate der Anpassung 3fache in Bakterien mit hoher Mutationsraten unter Bedingungen von Umweltstress. Außerdem 4 ist Konjugation mit Abstand die häufigste Weg , durch die Antibiotika - Resistenzgene in Bakterienstämme verteilt sind. 5,6

Mikroorganismen haben spezialisierte Sekretion Systeme entwickelt, um die Übertragung von Makromolekülen durch Zellmembranen zu unterstützen; gibt es derzeit neun Arten von Sekret Systemen (TSS) in Gram-negativen Bakterien, die beschrieben wurden: T1SS, T2SS, T3SS, T4SS, T5SS, T6SS, T7SS sowie die Sec (Sekretion) und Tat (zwei-Arginin-Translokation) Wegen. 7,8 Jede Art von Sekretionssystem ist weiter in verschiedene Subtypen unterteilt, eine Notwendigkeit aufgrund Vielfalt von Proteinen und die Unverwechselbarkeit von Wegen beteiligt sind , in verschiedenen Bakterienstämmen. Beispielsweise in dem Typ IV-Sekretionssystem (T4SS), die Ti und Cag Systeme Effektor Transport während das F-Plasmid zu erleichtern, R27nd pKM101 T4SSs Übertragung eines konjugativen Plasmid erleichtern. 7,9,10 Ein detailliertes Verständnis der Mechanismen , durch die Organismen ihre jeweiligen Sekretionssysteme aus ihren Komponentenproteine montieren und zelluläre Inhalt mit einem Empfänger oder ihrer Umgebung teilen , ist ein wichtiger Faktor bei der Entwicklung von zielgerichteten Strategien pathogene Mikroorganismen und Verfahren zur Bekämpfung von zellulären Infektion.

Nach der anfänglichen Identifizierung bakterielle Konjugation in E. coli von Lederberg & Tatum, 11 eine große Anzahl von mobilen und konjugativen Plasmiden identifiziert und charakterisiert wurden. 12 solche mobilen Plasmide zeigen beträchtlichen Bereich Größe (von 1 bis über 200 Kilobasen (kb)), aber alle Mobil Plasmiden eine relaxase enthalten, die den Ursprung der Übertragung erkennt (oriT) wodurch eine Übertragung des Plasmids. Konjugativen Plasmiden weitere Gene kodieren für die Montage eines funktionellen T4SS sowie eine ArtIV Kopplungsprotein. 12 Zum Beispiel das 100 kb F - Plasmid von E. coli codiert alle konjugativer Gene innerhalb einer 33,3 kB - Transfer (tra) Region. 13 Die Gene im tra Region des F - Plasmid codieren alle Proteine , die Pilus - Bildung zu erleichtern, Paarung Paarbildung (MPF), DNA - Transfer und Ausschlussfunktionen während konjugativer Plasmidtransfers. 10,14,15 Ein bedeutender Körper des Wissens ist für konjugativen T4SSs verfügbar, detaillierte jedoch strukturelle Untersuchungen der konjugierende Proteine und Komplexe werden nur in jüngster Zeit verfügbar werden. 16-28

Um einen umfassenden Überblick über den konjugativen Prozess, eine Kopplung von detaillierte Strukturuntersuchungen zusammen Analysen von konjugativen Transfer Proteine ​​Mutations-erforderlich. Dies kann durch konjugativen Paarungs Assays erreicht werden. Für das F - Plasmid, jedes Protein im tra Region codiert spielt eine Rolle in der F-vermittelte conjugation; Daher wird die knockout / Löschung eines Gens , das das Übertragungs konjugativen Kapazität der Zelle (1) aufzuheben. Während kleinere mobile Plasmiden zuträglicher Standardlöschverfahren sind für größere konjugativen Plasmiden wie F, Gen-Knockout more werden leicht durch homologe Rekombination erreicht wobei das Zielgen mit einer Förder eine deutliche antibiotische Resistenzgen ersetzt. In der aktuellen Protokoll verwenden wir eine homologe Rekombination einen Transfer Gen von Interesse mit Chloramphenicolacetyltransferase (CAT) in der 55-kb-F-Plasmid-Derivat pOX38-Tc zu ersetzen; 29,30 Die sich ergebende Plasmid knockout, pOX38-Tc Δgene :: Cm erleichtert Widerstand gegen die Anwesenheit von Chloramphenicol (Cm) in den Wachstumsmedien. Spenderzellen pOX38-Tc Δgene :: Cm Beherbergung sind nicht in der Lage konjugativen DNA-Transfer / Paarung zu beeinflussen, wie durch die Verwendung eines Gegen Assay beobachtet; die Gegenwirkungsgrad eines pOX38-Tc Δgene :: Cm Spenderzelle und einer normalen recipient wird abnehmen oder, häufiger, abgeschafft werden. Konjugativen Transfer des pOX38-Tc Δgene :: Cm Plasmid kann über eine kleine Erholung Plasmid wiederhergestellt werden, um den gezielten Transfer Gen beherbergt. Diese Erholung Plasmid kann eine sein , die eine konstitutive Expression, wie Plasmid pK184 (pK184-Gen), 31 oder einer bereitstellt , die so lange induzierbare Expression bietet wie das Plasmid richtig , das Gen an die richtige Stelle innerhalb der Zelle (Zytoplasma oder Periplasma) zum Ziel hat . Folglich ist in Paarungs Assays zwischen dieser neuen Spender (Beherbergung pOX38-Tc Δgene :: Cm + pK184-Gen-Plasmide) und eine Empfängerzelle ist die Paarungseffizienz zu erwarten nahezu die eines normalen Spender-Empfänger-Paarung Assay wiederherzustellen. Dieses System ermöglicht es, die Funktion des ausgeknockt Gens durch die Erzeugung einer Reihe von pK184-Genkonstrukte (Deletionen oder Punktmutationen) zu sondieren und jedes Konstrukt Fähigkeit Testen der Paarungsfähigkeit des pOX38-Tc Δgene :: Cm Beherbergen wiederherzustellen Spenderzelles.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Erzeugung von DNA-Konstrukten

  1. Entwerfen Oligomers für die homologe Rekombination des Zielgens
    1. Entwerfen Sie ein einzelnes 55-72 bp vorwärts Oligomer wie folgt: (a) wählen Sie eine 19-32 bp lange Nukleotidsequenz, die zu einer DNA-Sequenz in der Region 10-100 bp homolog ist stromaufwärts des 5'-Startstelle des Chloramphenicolacetyltransferasegen im Gewerbe pBAD33 Plasmid, 32 und (b) wählen Sie eine 36-54 bp lange Nukleotidsequenz homolog zu einer Region 10-150 bp stromabwärts der Startstelle des Zielgens '5 von Interesse.
      1. Schließen Sie sich dem "Ende der Nukleotidsequenz aufgenommen in (b) an das 5'-3'-Ende der Nukleotidsequenz aufgenommen in (a), so dass ein einzelnes 55-72 lang nach vorn Oligomer zu geben.
    2. Entwerfen Sie ein einzelnes 55-72 bp Reverse-Oligomeren wie folgt: (a) wählen Sie eine 19-32 bp lange Nukleotidsequenz, die zu einer DNA-Sequenz in der Region 10-100 bp homolog ist stromabwärtsdes 3'-Endes des Chloramphenicol-Gens in der kommerziellen pBAD33 Plasmid und (b) Wählen 36-54 bp lange Nukleotidsequenz, die homolog zu einer Region innerhalb von 10-150 bp stromaufwärts von dem 3'-Ende Stelle des Zielgens von Interesse .
      1. Schließen Sie sich dem "Ende der Nukleotidsequenz aufgenommen in (b) an das 5'-3'-Ende der Nukleotidsequenz in gepflückt (a) zu machen, ein einzelnes Oligomer.
      2. Kopieren Sie dieses Oligomer in jede verfügbare Bioinformatik-Software und konvertieren Sequenz in seine reverse Komplement. Dies wird eine 55-72 bp lange Reverse Oligomer geben.
    3. Mit allen verfügbaren Oligo-Analyzer - Programm überprüfen, ob die Rekombination Oligomere GC - Gehalt zwischen 40-60%, niedriger Haarnadel Schmelztemperatur (T m), geringe Selbst- und Hetero Dimerisierung T m 's haben. Bestellen Sie die Primer für die Synthese und den Versand von jeder bevorzugten Biotechnologie-Unternehmen.
  2. Die Amplifikation der CAT - Kassette von pBAD33 (Cm R
  3. Wachsen eine über Nacht (O / N, 16-18 h) Kultur von DH5a Zellen das Plasmid pBAD33 in sterilem LB-Medium beherbergt (LB) mit 20 ug / ml Chloramphenicol (Cm) mit bei 200 Upm Schütteln und 37 ° C.
  4. Zentrifuge 6-8 ml des O / N-Kultur bei Raumtemperatur 5.000 xg für 3 min. Den Überstand abgießen und extrahieren Sie die pBAD33 Plasmid aus dem Pellet mit einem Plasmid - Mini-Prep - Kit (Werkstoff - Tabelle) und Protokoll des Herstellers verwendet wird .
  5. Führen Sie eine Digest des pBAD33 Plasmid - DNA durch die folgende in ein steriles Röhrchen in der Reihenfolge Zugabe gegeben: geeigneten Volumen doppelt destilliertem Wasser (ddH 2 O) bis zu einem Endvolumen von 50 & mgr; l, 1 & mgr; g Volumen von pBAD33 Plasmid, 5 ul 10fach Enzymreaktionspuffer und 0,5 ul Restriktionsenzym AvaI (RE). Vorsichtig mischen durch Pipettieren und ließ die Reaktion 1 h bei 37 ° C ablaufen. Wärme inaktivieren die Reaktion 20 min (min) bei 80° C. Proben bei -20 ° C für nicht länger als 24 h sticky-end-Abbau zu minimieren.
  6. Vorbereiten eines 1,2% igen Agarosegel Abtrennen von 1,2 g Agarose mit 100 ml 1x TAE Mischen (40 mM Tris, pH 8,5; 20 mM Essigsäure; 1 mM EDTA) -Puffer in einem 250 ml Erlenmeyerkolben. Hitze und wirbeln, um vollständig in der Mikrowelle auflösen. Stoppen Sie sofort erhitzt, wenn die Flüssigkeit den Kolben zu kochen und schwenken beginnt.
    1. Man kühlt die Flüssigkeit Agarose für 3 min bei Raumtemperatur während wirbeln, fügen Sie 2 ul 10 mg / ml Ethidiumbromid und wirbeln zu mischen. Gießen Sie die Agarose in einem Gelträger mit einem gut kämmen und lassen Sie es für 1 h bei Raumtemperatur zu verfestigen. Store-Gelen bei 4 ° C für bis zu 2 Tage in 1x TAE-Puffer.
  7. Mischen Sie jede RE verdauen aus 1.2.3 mit 0,2 Volumen von DNA-Ladungsfarbstoff (10 & mgr; l Farbstoff pro 50 & mgr; l-Reaktion) durch Pipettieren. Last 5 ul 500 ug / ml DNA-Leiter in die erste Vertiefung und alle der RE digest-Farbstoffmischung in eine andere gut auf der agarose Gel. Verwenden 2-3 Vertiefungen gesamte Reaktionsvolumen auf das Gel geladen werden.
    1. Führen Sie das Gel kaum unter Wasser in 1x TAE-Puffer und den Betrieb bei 45-50 V (4,5-5 V / cm) für 65 min in einer Gel-Elektrophorese-Gerät.
  8. Verwendung eines UV Schrank und ein steriles Rasiermesser geschnitten schnell die 2,8 kb-Bande, die aus dem Gel auf die CAT-Sequenz entspricht UV Belichtung von DNA minimieren. Extrahieren Sie die DNA aus dem Cut-out Gelschnitte ein Gel - Extraktions - Kits (Werkstoff - Tabelle) gemäß dem Protokoll des Herstellers verwendet wird .
    Hinweis: Achten Sie darauf, nicht die Haut direkt unter UV zu entlarven und den Rasierer mit Sorgfalt zu behandeln.
  9. Amplifizieren der CAT-Kassette aus 1.2.6 durch Polymerasekettenreaktion (PCR) extrahiert unter Verwendung der in 1.1 entworfen Primern, die Auskragungen homolog zu der Gensequenz enthalten, die für die homologe Rekombination zu ermöglichen. PCR - Reaktionen werden auf Eis mit den Herstellerrichtlinien (Werkstoff - Tabelle) in der folgenden Reihenfolge ein:
    1. In einsterile PCR - Röhrchen wurde ein geeignetes Volumen von ddH 2 O auf ein Endvolumen von 50 & mgr; l, gefolgt von 10 & mgr; l PCR - Puffer, 1 ul 10 mM dNTPs, 2,5 ul 10 uM Vorwärtsprimer, 2,5 ul 10 uM reverse - Primer hinzuzufügen , , 1-25 ng Matrizen-DNA aus 1.2.6 und 0,5 & mgr; l von 100 Einheiten / & mgr; l DNA-Polymerase.
    2. Stellen Sie eine negative Kontrolle, die dieselben Komponenten wie 1.2.7.1 trägt, aber mit Ausnahme der Template-DNA. Verwenden Sie ein geeignetes Volumen von ddH 2 O anstelle von Template - DNA. Richten Sie eine positive Kontrolle unter Verwendung von Template-DNA und Primer, die nachgewiesen worden sind, in einer PCR-Reaktion zu arbeiten, wie sie als positive Kontrolle durch den Hersteller zur Verfügung gestellt.
    3. Mischen Sie alle Reaktionsinhalt sanft durch Pipettieren.
    4. Amplifizierung mittels PCR mit den folgenden Einstellungen: Initiale Denaturierung für 30 s bei 98 ° C, 30 Zyklen Denaturierung für 10 s bei 98 ° C, Primer-Annealing für 20 s, Verlängerung für 20 s pro Kilobase von Amplicon bei 72 ° C und einer Flosseal Verlängerung für 10 min bei 72 ° C. Proben bei -20 ° C.
  10. Bestätigen Sie die richtige Größe der Verstärkung über Agarose-Gelelektrophorese (siehe 1.2.4-1.2.5) von nur 5 ul jeder Reaktion verwendet wird. Reinige den PCR-Amplikon eine PCR-Reinigungskits und Protokoll des Herstellers verwendet wird. Shop-DNA bei -20 ° C gereinigt.
  • Das pK184-Gen Recovery - Plasmid
    1. Entwerfen Sie ein Forward-Primer, beginnend von seinem 5'-Ende und geht in Richtung 3'-Ende in der folgenden Reihenfolge: (a) Pick 4 zufällige Nukleotide (eine Kombination aus Adenin, Thymin, Guanin und Cytosin) für Spaltungseffizienz, die an (b) die EcoRI-Restriktionsenzym (RE) Schnittstellensequenz (GAATTC), gefolgt von (c) eine 21-25 bp langen Nukleotidsequenz, die an das 5'-Ende des Gens von Interesse, einschließlich des Startcodons homolog ist. Wenn das Ziel-Gen eine EcoRI-Stelle enthält, wählen Sie einen anderen geeigneten RE aus dem pK184 Mehrfachklonierungsstelle.
    2. Im Fall von Genen, die periplasmatische Proteine ​​umfassen eine zusätzliche Leadersequenz zwischen dem RE-Stelle und dem Startcodon auf dem Vorwärtsprimer.
    3. Mit allen verfügbaren Oligo-Analyzer, überprüfen Sie, dass die Primer GC - Gehalt zwischen 40-60%, niedrige haarnadel T m, niedrige Selbst- und Hetero Dimerisierung T m 's haben. Bestellen Sie die Primer für die Synthese.
    4. Wachsen ein O / N-Kultur von DY330R pOX38-Tc-Zellen in sterile LB 10 ug / ml Tetracyclin (Tc) enthält, bei 32 ºC und 200 Upm unter Schütteln. Zentrifuge 6-8 ml des O / N-Kultur bei Raumtemperatur 5.000 xg für 3 min. umfüllenÜberstand und extrahieren die Plasmid - DNA aus dem Pellet mit einem Plasmid - Mini-Prep - Kit (Werkstoff - Tabelle) und Protokoll des Herstellers verwendet wird .
    5. Amplify das gesamte Gen von Interesse mit den Primern von 1.3.1-1.3.5 mit pOX38-Tc als Vorlage (siehe 1.2.7.1-1.2.7.3).
    6. Bestätigen Sie die richtige Größe der Verstärkung über Agarose-Gelelektrophorese (siehe 1.2.4-1.2.5) von nur 5 ul jeder Reaktion verwendet wird. Reinige die amplifizierte DNA ein PCR Purification Kit und Herstellerprotokoll verwendet. Store DNA bei -20 ° C gereinigt.
    7. Haben eine doppelte Spaltung von sowohl dem im Handel erhältlichen pK184 Plasmid - DNA und dem verstärkten Gen (von 1.3.7.), Indem Sie das folgende in einem sterilen Röhrchen in der Reihenfolge Zugabe gegeben: entsprechende Volumen von ddH 2 O auf ein Endvolumen von 50 & mgr; l 1 & mgr; g Plasmid pK184 Volumen von 5 ul 10x Enzymreaktionspuffer und 1 ul jeder EcoRI und HindIII.
      1. Vorsichtig mischen durch Pipettieren und ließ die Reaktion 1 h fortbewegenbei 37 ºC. Wärme inaktivieren die Reaktion 20 min bei 80 ºC. Proben bei -20 ° C für nicht länger als 24 h sticky-end-Abbau zu minimieren.
        Hinweis: Die Art der Restriktionsnuclease hier verwendet wird, hängt von der Restriktionsnuclease Website, die in die Primer in den Schritten 1.3.1 und 1.3.2 entwickelt wurde.
      2. Als positive Kontrolle, stellen einzelne Digests des pK184 Plasmid, indem sie die gleiche Reaktion wie in 1.3.8 Vorbereitung mit Ausnahme nur eines der REs in ein Reaktionsgefäß hinzu. Tun Sie dies separat mit beiden REs.
    8. Führen Sie die Verdaue auf einem 1,2% Agarose-Gel-Protokolle 1.2.4-1.2.5 die DNA extrahieren Doppel Fragmente von sowohl pK184 und das Gen verdauen nach Interessen 1.2.6 zu treten.
    9. Ligieren der Gen-Insert in den pK184 Vektor von Komponenten in einem sterilen Röhrchen in folgender Reihenfolge Zugabe: 2 ul 10fach T4 DNA Ligasepuffer, insgesamt 100 ng DNA, bestehend aus einem 1: 3-Vektor: ein (pK184: Gen) Verhältnis, ddH 2 O bis zu einemGesamtvolumen von 20 ul und 1 ul T4 DNA-Ligase. Als Negativkontrolle, stellen eine ähnliche Reaktion unter Verwendung von 100 ng Vektor ohne Insert-Gen auf.
      1. Sanft alle 30 min bei 25 ° C unter Verwendung einer Mikroreaktionsinhalt mischen und inkubieren. Wärme-Inaktivierung die Ligationsreaktion 10 min bei 65 ° C und dann auf Eis stellen.
    10. Während auf dem Eis, fügen Sie 15 ul der pK184-Gen Ligierungsreaktion von Schritt 1.3.10 bis 100 & mgr; l chemisch kompetente DH5a-Zellen in einem sterilen 1,5 ml-Röhrchen. Sanft durch Pipettieren gemischt und 10 Minuten auf Eis inkubiert. Machen Sie dasselbe für die negative Kontrollprobe. Für eine positive Kontrolle verwenden, 20-100 ng eines Plasmids wie pBAD33 und wandeln sie in 50 & mgr; l DHα Zellen.
    11. Direkt übertragen die Proben von Eis in einem 42 ° C Wasserbad und für 90 Sekunden inkubiert. Dies bietet die Zellen einen Hitzeschock und ermöglicht es ihnen, die Plasmid-DNA-Aufnahme.
    12. Platz Zellen wieder auf Eis für eine andere5 min, und fügen Sie dann 900 ul sterilem LB. Bei 37 ° C für 1 h, während bei 125 rpm schütteln.
    13. Aliquotieren eine 100 & mgr; l Volumen der Probe von jeder Ligationsreaktion in 1.3.13 auf eine Agarplatte, enthaltend 50 ug / ml Kanamycin (Km) und die Ausbreitung der Zellen eine sterile Spreizer verwendet wird. Die positive Kontrolle Platte sollten geeignete Antibiotika haben. Halten Sie den Bereich steril und arbeiten in der Nähe einer Flamme. Die Platte den Kopf bei 37 ° C über Nacht.
    14. Mit einer sterilen Pipette oder Schleife, ernten eine einzige deutliche Kolonie von Zellen und impfen eine 20 ml sterile LB mit 50 ug / ml Km. Halten Sie den Bereich steril und arbeiten in der Nähe einer Flamme. Wachsen die Zellen O / N bei 37 ° C mit 200 Umdrehungen pro Minute schütteln.
    15. Machen 3-5 Glycerinstamm der transformierten DH5a Zellen durch Mischen von 500 & mgr; l des O / N-Kultur mit 500 & mgr; l sterilem 100% Glycerol (letzten 50% v / v) in sterile Kryo-Röhrchen. Bei -80 ° C.
    16. Auch Zentrifuge 6-8 ml der O / N-Kultur bei Raumtemperatur 5,000 × g für 3 min. Den Überstand abgießen und extrahieren Sie die pK184-Gen Recovery - Plasmid aus dem Pellet mit einem Plasmid - Mini-Prep - Kit (Werkstoff - Tabelle) und Protokoll des Herstellers verwendet wird .
  • pK184 - Gen Mutants
    Hinweis: Die Primer entworfen für Deletionen, Insertionen und / oder Punktmutationen leicht erzeugt werden können Hersteller online verfügbar Tools.
    1. Entwurf jeder Vorwärtsprimer durch eine 18-32 bp lange Nukleotidsequenz Kommissionierung, die an das 5'-Ende des Gens von Interesse homolog ist, einschließlich der Start-Codon. Design-Primern, so dass jedes Vorwärtsprimer annealt 30-180 bp stromabwärts von dem vorhergehenden, was zu Deletionsmutanten N-terminale Peptidfragmente von geeigneter Länge fehlt.
    2. Entwerfen Sie einen Reverse-Primer durch eine 18-32 bp lange Nukleotidsequenz Kommissionierung, die an das 3'-Ende des Gens von Interesse, einschließlich dem Stop-Codon homolog ist. Kopieren Sie diesen Primer in einny verfügbar Bioinformatik-Programm und die Sequenz in seine Umkehrkomplement konvertieren. Dies ist der Rückwärts-Primer.
      1. Im Fall von Genen, die periplasmatische Proteine, entwerfen die reversen Primer, die das reverse Komplement des 3'-Endes einer Leader-Sequenz, die das 5-Flanken 'ist-Ende des Gens und ist für die korrekte Lokalisierung des Proteinprodukt im Periplasma notwendig.
    3. Mit allen verfügbaren Oligo-Analyzer - Programm überprüfen, ob die Löschung Primer GC - Gehalt zwischen 40-60%, niedriger Haarnadel Schmelztemperatur (T m), geringe Selbst- und Hetero Dimerisierung T m 's haben. Bestellen Sie die Primer für die Synthese und den Versand von jedem verfügbaren Biotechnologie-Unternehmen.
    4. Mit dem pK184-Gen - Konstrukt erhalten in Protokoll 1.3 als Vorlage und die Richtlinien in 1.2.7-1.2.8, verstärken PCR die Lösch Konstrukte mit den entworfenen Primer in den Schritten 1.4.1-1.4.3 pK184-Gen & Delta; X Amplikons zu erzeugen . Shop amplifizierte DNA eint -20 ° C.
    5. Ligieren das verstärkte Konstrukt alle verfügbaren Mutagenese - Kit (Werkstoff - Tabelle).
    6. Verwandeln Sie jedes der pK184-Gen & Delta; X Ligaten getrennt in chemisch kompetente DH5a Zellen ein Standardhitzeschockprotokoll (siehe 1.3.11-1.3.13).
    7. Aliquotieren eine 100 & mgr; l Volumen der Probe von jeder Ligationsreaktion in 1.4.12 auf einer Agarplatte 50 ug / ml Km enthält, und die Zellen verteilt eine sterile Spreizer verwendet wird. Halten Sie den Bereich steril und arbeiten in der Nähe einer Flamme. Die Platte den Kopf bei 37 ° C über Nacht.
    8. Unter Verwendung einer sterilen Pipette oder eine Schleife, ernten eine einzige deutliche Kolonie von Zellen und Beimpfen einer 20 ml-sterile LB-Medium mit 50 ug / ml Km. Halten Sie den Bereich steril und arbeiten in der Nähe einer Flamme. Wachsen die Zellen O / N bei 37 ° C mit 200 Umdrehungen pro Minute schütteln.
    9. Machen 3-5 Glycerinstamm der transformierten DH5a Zellen durch Mischen von 500 & mgr; l des O / N-Kultur mit 500 & mgr; l sterilem 100% Glycerol (final 50% v / v) in sterile Kryo-Röhrchen. Bei -80 ° C.
    10. Zentrifuge 6-8 ml des O / N-Kultur bei Raumtemperatur 5.000 xg für 3 min. Unter Verwendung eines Plasmid - Mini-Prep - Kit (Werkstoff - Tabelle) und Protokoll des Herstellers Den Überstand abgießen und extrahieren das pK184 Gen & Delta; X - Plasmid aus dem Pellet konstruieren. Store DNA bei -20 ° C.
  • 2. Erzeugung von pOX38-Tc Δgene :: Cm Dehnungen

    1. DY330R pOX38-Tc Δgene :: Cm Vorprägungen
      1. Vorbereiten eines O / N-Kultur von DY330R pOX38-Tc-Zellen in 10 ml sterile LB, enthaltend 10 ug / ml Tc. Wachsen Kultur O / N bei 32 ° C und 200 Umdrehungen pro Minute.
      2. Machen Sie eine 1:70 Verdünnung der O / N-Kultur in 20 ml frischem sterilen LB. Wachsen die Zellen bei 32 ° C bis zur mid-log - Phase (OD 600 nm 0,4-0,6) Wachstum.
      3. Transfer von 10 ml Kultur in einen sterilen Kolben und Inkubation für 15 min bei 150 rpm in einem Schüttelwasserbad ba bei 42 ° Cth. Dadurch wird die Expression von Rekombinations-spezifischen Proteinen in DY330R induzieren.
      4. Kühlen Sie die Kultur in einem Eis-Wasserbad für 10 min. Bereiten Sie elektrokompetete Zellen wie folgt.
        1. Übertragen Sie die gekühlten Zellen in vorgekühlte konische Röhrchen und Zentrifuge bei 4000 × g für 7 min bei 4 ºC. Alle Röhrchen und Pipetten in den nächsten Schritten verwendet werden, sollten bei 4 ° C oder auf Eis abkühlen platziert werden.
        2. Entfernen Sie den Überstand und resuspendiert die Zellen vorsichtig in 1 ml eiskaltem ddH 2 O weiteren hinzufügen 30 ml eiskaltem ddH 2 O.
        3. Zentrifugieren Sie die Zellen (4000 × g, 7 min, 4 ° C), den Überstand verwerfen und vorsichtig resuspendiert die Zellen in 1 ml eiskaltem ddH 2 O.
        4. Übertragen die resuspendierten Zellen in vorgekühlte 1,5 ml Mikrozentrifugenröhrchen und zentrifugiere bei 15.000 × g für 1 min bei 4 ºC.
        5. Sanft resuspendiert das Pellet in 200 ul eiskaltem ddH 2 O und aliquoten in 50 & mgr; l Volumen. Electrocompetent Zellen können bei -80 ° C gelagert werden
      5. In 300 ng des verstärkten CAT-Kassette von 1,2 in 50 & mgr; l elektro DY330R pOX38-Tc-Zellen, während auf Eis Mischen sanft durch Pipettieren auf und ab. Wiederholen Sie diesen Schritt unter Verwendung von unmodifizierten pBAD33 Plasmid als eine positive Kontrolle.
      6. Übertragen, um die Zellen zu einer vorgekühlten (-20 ° C) 1 mm Elektroporationsküvette. Elektroporation der Zellen bei 1,8 kV mit einer Zeitkonstante von 5,5 ms, eine Elektroporator verwenden. Unmittelbar nach dem Puls der Anwendung der Zellen mit 1 ml SOC-Medium verdünnt und in ein frisches Mikrozentrifugenröhrchen übertragen. Inkubieren der Zellen bei 32 ° C für 2 h.
      7. Aliquot 100 ul jeder Probe auf Agar-Platten, die 10 ug / ml Tc und 20 ug / ml Cm und verbreiten einen sterilen Spreizer. Halten Sie den Bereich steril und arbeiten in der Nähe einer Flamme. Die Platte den Kopf bei 32 ° C über Nacht für den erfolgreichen Rekombinanten auszuwählen. Die CAT-Kassette in die Zelle eingeführt wird homologe re unterzogenKombination mit dem Gen von Interesse und das DY330R pOX38-Tc Δgene :: Cm (Rif R, Tc R, Cm R) Klon erstellen.
        Hinweis: Es ist wichtig, DY330R Zellen bei 32 ° C, mit Ausnahme der 15 min Induktion bei 42 ° C von Schritt 2.1.3 vor dem Erzeugen elektrokompetenten Zellen, als verlängertes Wachstum bei erhöhten Temperaturen Risiken Zelltod aufgrund der Produktion wachsen toxischer Produkte aus dem p L - Operon verantwortlich für die Rekombination Funktionen in DY330R. 33,34
      8. Bereiten Sie eine O / N von DY330R pOX38-Tc Δgene :: Cm Zellen durch eine einzige deutliche Kolonie von Zellen mit einer sterilen Pipette oder Schleife Ernte und eine 20 ml sterile LB-Medium mit 10 ug / ml Tc Impfen und 20 ug / ml Cm. Halten Sie den Bereich steril und arbeiten in der Nähe einer Flamme. Wachsen die Zellen O / N bei 32 ° C mit 200 Umdrehungen pro Minute schütteln.
      9. Machen 3-5 Glycerinstamm vom O / N durch Mischen von 500 & mgr; l des O / N-Kultur mit 500 & mgr; l sterilem 100% glycerol (final 50% v / v) in sterile Kryo-Röhrchen. Bei -80 ° C.
      10. Zentrifuge 6-8 ml des O / N-Kultur bei Raumtemperatur 5.000 xg für 3 min. Den Überstand abgießen und extrahieren die pOX38-Tc Δgene :: Cm Konstrukt aus dem Pellet mit einem Plasmid - Mini-Prep - Kit (Werkstoff - Tabelle) und Protokoll des Herstellers verwendet wird ; Speichern von gereinigter DNA bei -20 ° C.
      11. Führen Sie einen konjugativen Paarungs Assay XK1200 Zellen als Empfänger mit Unterbrechung der Konjugation laut Protokoll 3.1 von Gen-Knockout zu bestätigen.
    2. DY330R pOX38-Tc Δgene :: Cm + pK184-Gen
      1. Trans elektrokompetete DY330R pOX38-Tc Δgene :: Cm-Zellen mit 300 ng des pK184-Genkonstrukt mittels Elektroporation gemäß Schritt 2.1.4-2.1.7. Alle selektiven Medien müssen 20 ug / ml Cm enthalten und 50 ug / ml Km. Inkubieren bei 32 ° C. Die Erholung Plasmid in den elektroporierten Zellen wird nun die Funktion des ausgeknockt-Gen in der D wiederherstellenY330R pOX38-Tc Δgene :: Cm Zellen.
      2. Vorbereiten eines O / N von DY330R pOX38-Tc Δgene :: Cm + pK184-Gen-rekombinante Zellen, die durch eine einzige deutliche Kolonie der Zellen mit einer sterilen Pipette oder Schleife Ernte und Inokulieren einer 20 ml steriles LB-Medium mit 20 ug / ml Cm und 50 ug / ml Km. Halten Sie den Bereich steril und arbeiten in der Nähe einer Flamme. Wachsen die Zellen O / N bei 32 ° C mit 200 Umdrehungen pro Minute schütteln.
      3. Machen 3-5 Glycerinstamm vom O / N durch Mischen von 500 & mgr; l des O / N-Kultur mit 500 & mgr; l sterilem 100% Glycerol (letzten 50% v / v) in sterile Kryo-Röhrchen. Bei -80 ° C.
      4. Führen Sie außerdem Protokoll 3.1 bis XK1200 pOX38-Tc Δgene :: Cm rekombinanten Zellen erzeugen.
    3. XK1200 pOX38-Tc Δgene :: Cm + pK184-Gen und Mutants
      1. Bereiten Sie elektrokompetete XK1200 pOX38-Tc Δgene :: Cm Zellen (aus Schritt 2.2.4).
      2. Elektroporation Getrennt 300 ng pK184-Gen oder pK184-Gen-Mutante Plasmide in 50 ul electrocompetent XK1200 pOX38-Tc Δgene :: Cm Zellen gemäß Schritt 2.1.4-2.1.7. Alle selektiven Medien sollten 10 ug / ml Nalidixinsäure (Nal), 20 ug / ml Cm und 50 ug / ml Km enthält und bei 37 ° C inkubiert werden.
      3. Vorbereiten eines O / N von XK1200 pOX38-Tc Δgene :: Cm + pK184-Gen-rekombinante Zellen, die durch eine einzige deutliche Kolonie der Zellen mit einer sterilen Pipette oder Schleife Ernte und ein 20 ml steriles LB-Medium mit Nal Beimpfen, 20 ug / ml cm und 50 & mgr; g / ml Km. Halten Sie den Bereich steril und arbeiten in der Nähe einer Flamme. Wachsen die Zellen O / N bei 37 ° C mit 200 Umdrehungen pro Minute schütteln.
      4. Machen 3-5 Glycerinstamm vom O / N durch Mischen von 500 & mgr; l des O / N-Kultur mit 500 & mgr; l sterilem 100% Glycerol (letzten 50% v / v) in sterile Kryo-Röhrchen. Bei -80 ° C.

    3. Konjugative Mating Assays

    1. Konjugative Mating zu generieren XK1200 pOX38-Tc Δgene :: Cm Zellen
      1. Bereiten Sie eine 20 ml sterile LB O / N cultur von DY330R pOX38-Tc Δgene :: Cm + pK184-Gen-Zellen durch eine sterile Pipette oder einer Schleife unter Verwendung einer 20 ml sterile LB, das 20 ug / ml Cm und 50 ug / ml Km mit einem Glycerin-Stamm oder einzelne Kolonie auf ein zu impfen Agar-Platte. Wachsen bei 32 ° C mit 200 Umdrehungen pro Minute schütteln. Bereiten Sie die gleiche für XK1200 Zellen in 20 ml sterile LB mit 10 & mgr; g / mL Nal, bei 37 ° C wachsen.
      2. Machen 1:70 Verdünnungen von jeder Kultur getrennt in 2 ml sterilem LB mit gleichem antibiotischen Inhalt; Glucose zu einer Endkonzentration von 100 mM zu allen Spenderzellen hinzuzufügen. Wachsen Zellen bis zur mittleren logarithmischen Phase (OD 600 0,5-0,7) bei 37 ° C mit Schütteln bei 200 Upm.
      3. Zentrifuge (4000 g für 5 min bei 4 ° C) Zellen zu pelletieren, Überstand verwerfen, waschen Sie einmal mit kaltem sterilen LB Antibiotika zu entfernen, und resuspendieren Zellen in 2 ml kaltem sterilen LB.
      4. Aliquot von 100 & mgr; l jeder Kultur in 800 ul sterilem LB-Medium und lassen sie für 1 h bei 32 ° C zu paaren ohne Schütteln.
      5. <li> Vortex die Zellen für 30 s für 10 min die Paarung Paare und legen sie auf Eis zu stören weitere Paarung zu verhindern.
      6. Aliquot 100 ul der Zellmischung auf einer Agar-Platte, die 10 ug / ml Nal und 20 ug / ml Cm für XK1200 pOX38-Tc Δgene :: Cm Zellen auszuwählen. Verteilen Sie die Zellen mit einer sterilen Spreizer. Halten Sie den Bereich steril und arbeiten in der Nähe einer Flamme. die Platte O / N bei 37 ° C upside-down bebrütet.
      7. Ernten Sie eine einzelne Kolonie des neuen XK1200 pOX38-Tc Δ Gen :: Cm Knockout-Stamm einer sterilen Pipette oder einer Schleife und wachsen in sterilen LB mit 20 ug / ml Cm, O / N unter Verwendung von 37 ° C mit 200 Umdrehungen pro Minute schütteln. Machen 3-5 Glycerinstamm vom O / N durch Mischen von 500 & mgr; l des O / N-Kultur mit 500 & mgr; l sterilem 100% Glycerol (letzten 50% v / v) in sterile Kryo-Röhrchen. Bei -80 ° C.
        Hinweis: Die resultierenden Zellen nun in der Lage sind, für kompetent gemacht werden Transformation mit den pK184-Genkonstrukte (Protokolle 1.3 und 1.4) für EselEssing das Gen und seine Mutanten auf die Fähigkeit konjugativen Transfer in Protokoll 3.2 zu erholen.
    2. Konjugative Mating Assay von XK1200 Spender zu MC4100 Empfänger
      1. Bereiten Sie eine O / N-Kultur von XK1200 pOX38-Tc Δgene :: Cm + pK184-Gen Zellen in 20 ml sterilem LB mit 20 ug / ml Cm, 50 ug / ml Km und MC4100-Zellen in 5 ml LB mit 50 & mgr; g / mL Streptomycin (Sm) unter Verwendung von Zellen aus einer Glycerin-Stamm oder einzelne Kolonie auf einer Agarplatte und steril Pipette oder Schleife. Wachsen Kulturen 37 ° C mit 200 Umdrehungen pro Minute schütteln.
      2. Machen 1:70 Verdünnungen von jedem O / N-Kultur getrennt in 2 ml sterilem LB mit den gleichen Antibiotika. Hinzufügen Glucose zu einer Endkonzentration von 100 mM zu allen Spenderzellen. Wachsen Zellen bis zur mittleren logarithmischen Phase (OD 600 0,5-0,7) bei 37 ° C mit Schütteln bei 200 Upm.
      3. Zentrifuge (4000 g für 5 min bei 4 ° C) Zellen zu pelletieren, Überstand verwerfen, waschen Sie einmal mit kaltem sterilen LB antibio zu entfernenTics, und resuspendieren Zellen in 2 ml kaltem sterilen LB.
      4. In doppelter Ausfertigung Aliquot 100 ul jeder Kultur in 800 ul sterilem LB-Medium und lassen sie bei 37 ° C für 1 h ohne Schütteln zu paaren.
      5. Vortex die Zellen für 30 s die Paarung Paare zu stören und sie auf Eis für 10 min weitere Paarung zu verhindern.
      6. Unter Verwendung der mittleren log - Kulturen aus Schritt 3.2.2 und frische sterile LB, bereiten 6 serielle Verdünnungen der Geber- und Empfängerzellen von 10 -2 bis 10 -7.
      7. Auf jeder der zwei Hälften einer Agarplatte 10 ug / ml Nal, 20 ug / ml Cm und 50 ug / ml Km enthält, Spot 10 ul Aliquots jeder Verdünnung von XK1200 Donorzellen, wie in Abbildung 2 dargestellt. Wiederholen Sie dies für die Verdünnungen der Empfänger MC4100 Zellen auf Agar-Platten, die 50 ug / ml Sm. Die Platten O / N bei 37 ° C.
      8. Mit der verwirbelten Mischung aus Schritt 3.2.5 und frische sterile LB, bereiten 6 Verdünnungen (10 -2 bis 10 -7 2. Wiederholen Sie dies für beide doppelte Mischungen. Halten Sie den Bereich steril und arbeiten in der Nähe einer Flamme. Die Platten O / N bei 37 ° C.
      9. Bestimmen Sie die Paarungseffizienz jedes Konstrukt wie in Protokoll 3.3 beschrieben.
      10. Wiederholen dieses Protokoll für alle Wiederherstellungs Plasmiden, die Wirkung einer bestimmten Mutation auf die Effizienz der Konjugation zu bewerten.
    3. Die Berechnung der Paarungseffizienz
      1. Zählen Sie die Anzahl der Kolonien, die aus der gleichen Verdünnung Spek für jeden Spender, Empfänger und Transkonjuganten Zellen auf ihren jeweiligen Platten.
      2. Zählen Empfängerkolonien jede Tendenz zu testen, die aus mit einer größeren Anzahl von Transkonjuganten als Empfänger bei dieser gegebenen Verdünnung führen würde.
      3. Calculate die Gegenwirkungsgrad als die Anzahl von Transkonjuganten-Kolonien nach der Anzahl der Spender Kolonien geteilt. Mit 100 multiplizieren, um die Effizienz Wert pro 100 Spenderzellen erhalten.

    Subscription Required. Please recommend JoVE to your librarian.

    Representative Results

    Der Prozess des F - Plasmid-driven bakterielle Konjugation ist ein koordinierter Prozess, der Transferproteine innerhalb des tra Region des F-Plasmids umfasst , das eine T4SS assembliert Pilus - Synthese und DNA konjugativen Transfer zu erleichtern. Das Protein TRAF (GenBank accession # BAA97961; UniProt ID P14497) für die konjugierende F-Pilus Bildung erforderlich. 10,14,35 - 37 Das Protein enthält eine C-terminale Thioredoxin-ähnliche Domäne, obwohl es nicht die katalytische CXXC - Motiv hat. 35,38 Obwohl es vorhergesagt wurde mit dem trah Protein durch seine N-terminale Domäne zu interagieren, 39 ein Bereich als seine C-terminale Domäne sein dynamischer gezeigt, 37 nicht viel mehr über das Protein die Strukturmerkmalen bekannt. Die funktionellen Aspekte des TRAF - Proteins in Verbindung mit Strukturstudien bewerten wir geklopft first out die TRAF - Gen auf dem pOX38-Tc über homologeRekombination, die pOX38-Tc ΔtraF :: Cm Plasmid (Tabelle 1) in E. coli - Zellen DY330R erzeugen. 33,34 war auch -spezifische Primer (Tabelle 2) die pK184-TRAF - Plasmid von TRAF erzeugt Erholung der Konjugation zu bieten und ermöglichen die Sequenz des Proteins Sondieren. Die Übertragung des pOX38-Tc ΔtraF :: Cm Plasmid in XK1200 Zellen 40 aus DY330R Zellen , wenn pK184-TRAF in trans bereitgestellt wurde (Transkonjuganten auf 10 ug / mL Nal gezüchtet, 10 ug / ml Tc und 20 ug / ml Cm) zeigt dass (a) die TRAF Knockout in pOx38-Tc ΔtraF :: Cm stellt ein in-Frame - CAT - Kassette, und (b) dass pK184-TRAF kann konjugativer Funktion wiederherzustellen.

    Eine Reihe von TRAF - Mutanten wurden für die Analyse erzeugt , um den konjugativen Paarungs Assay 37 mit XK1200 pOX38-Tc ΔtraF :: Cm + pK184-TRAF & Delta; X mitZellen und MC4100 - Zellen 41 als Spender und Empfänger sind. Ein Vertreter Mutante ist TRAF 55-247 (Tabelle 1), eine N-terminale Deletionsmutante, der die Region des Proteins entfernt mit trah zusammenzuwirken vorhergesagt. Wenn die in voller Länge TRAF - Protein an die Spenderzellen zur Verfügung gestellt wird, wird konjugativen Transfer (Abbildung 2) wiederhergestellt, während die leeren Plasmid pK184 Bereitstellung nicht (Tabelle 3). In ähnlicher Weise wird konjugativen Funktion in den XK1200 Spenderzellen nicht , wenn mit dem Plasmid pK184-TRAF 55-247 (Tabelle 3) vorgesehen wiederhergestellt. Dies zeigt, daß der abgeschnittene Bereich des Proteins für TRAF die Funktion innerhalb des konjugativen Vorrichtung wichtig ist, wahrscheinlich durch Interaktion mit trah und stellt eine Region des Proteins für die weitere Mutationsanalyse abzuzielen.

    Abbildung 1
    in trans über eine Recovery - Plasmid (pK184-Gen) vorgesehen ist. Die resultierende pOX38-Tc Δgene :: Cm Plasmid wird für die weitere Beurteilung des Gens unter Verwendung von Paarungs Assays mit einem MC4100 Empfänger (Schritt 3) zu einem XK1200 Stamm (Schritt 2) übertragen. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

    Figur 2
    Abbildung 2: Mating Assay das Zielgen der Funktion in Verbindung zu beurteilen. Spender und Empfänger - Zellen wurden E. coli XK1200 pOX38-Tc ΔtraF :: Cm mit pK184-TRAF und MC4100 transformiert sind. Die erhaltenen Transkonjuganten (MC4100 pOX38-Tc ΔtraF :: Cm) wachsen auf Platten , die Sm und Cm, was auf eine erfolgreiche Wiederherstellung von konjugativen Funktion. Das Experiment wird in zweifacher Ausfertigung auf einem einzigen Agarplatte getan, und Reihenverdünnungen werden, um die Berechnung der Paarungseffizienz der opfer Gen - Mutanten (Tabelle 2) verwendet wird . Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

    Bakterienstamm / Plasmid Relevante Merkmale Selektive Marker (s) Referenz
    Bakterienstämme
    DY330R W3110 ΔlacU169 gal490 λc1857 Δ (cro-bioA) Rif® Rif 33,34
    XK1200 F - lacΔU124 Δ (NADA aroG- gal attλ bio gyrA) Nal 40
    MC4100 araD139 Δ (argF-lac) U169 rpsL150 relA1 flbB3501 deoC1 ptsF25 rbsR Sm 41
    Vektoren und Konstrukten
    pBAD33 Das Plasmid für die Expression unter einem Druck von P araBAD Cm 32
    pK184 2,4 kb Klonierungsvektor, p15A-Replikon Km 31
    pK184-TRAF </ Td> F TRAF aus pOX38 in pK184 Km 35
    pK184-TRAF 56-247 F TRAF aa 56-247 von pK184-TRAF Km
    konjugative Plasmide
    pOX38-Tc IncFI, Tra +, RepFIA +, f1 HindIII-Fragment von F, Mini-Tn Tc 29,30
    pOX38-Tc ΔtraF :: Cm pOX38-Tc mit CAT in TRAF eingefügt Tc Cm 35
    † Cm, Chloramphenicol; Km, Kanamycin; Nal, Nalidixinsäure; Rif, Rifampicin; Sm, Streptomycin; Tc, Tetracyclin
    ‡ Alle TRAF-Konstrukte enthalten die 19-Reste-Leadersequenz Lokalisation in den periplasmatischen Raum zu gewährleisten.

    Tabelle 1: Stämme und Plasmide , die in dieser Studie verwendet.

    Bauen Grundierung*
    Traf-Cm-For CTGTGACG GAAGATCACTTC -3 '- 5' GATCGAGGCTGGCAGTGGTATAACGAGAAAATAAATCCGAAGGA
    Traf-Cm-Rev 5 'TCTTCAGAAACGTTCAGGAACTGTTTTGCCAGGTCGTCCT - CTTATTCAGGCGT AGCACCAG -3'
    pK184-TRAF-For 5 'TTTTTT GAATTC TATGAATAAAGCATTACTGCCAC -3'
    pK184-TRAF-Rev 5 'TTTTTT AAGCTT TAAAAATTGGGTTTAAAATCTTCAGAAA -3'
    pK184-TRAF 55-247 -Für 5 'TACG CATATG ATGGCCGCACTGCAGACGG -3'
    pK184-TRAF 55-247 5 'TACG CATATG TCCTGACGCCGGAAAAATAAAGCAGCAGAGTAA -3'
    † Tabelle von Lento angepasst et al. 2016 35 mit Genehmigung
    * TRAF überhängende Regionen sind kursiv gesetzt. Restriktionsenzymstellen sind unterstrichen (HindIII: AAGCTT, EcoRI: GAATTC, NdeI: CATATG)

    Tabelle 2: Eine Liste von Primern in dieser Studie verwendet.

    Donor - Plasmid † Recovery - Plasmid Transkonjuganten ‡ § (Zellen ml -1) Mating Efficiency§ ||
    pOX38-Tc ΔtraF :: Cm Keiner 0 0
    pOX38-Tc ΔtraF :: Cm pK184 0 0
    pOX38-Tc ΔtraF :: Cm pK184-TRAF 5 x 10 3 0,0167
    pOX38-Tc ΔtraF :: Cm pK184-TRAF 55-247 0 0
    * Tabelle von Lento angepasst et al. 2016 35 mit Genehmigung
    † Donor - Zellen wurden E. coli XK1200, mit einer durchschnittlichen Konzentration von 3 x 10 7 Zellen ml -1
    ‡ Empfängerzellen waren E. coli MC4100. Die Anzahl der Transkonjuganten für die Positivkontrolle ist aus einer 10-5 Verdünnung. 0 zeigt keine Transkonjuganten aus einer 10-2 Verdünnung.
    §An Durchschnitt von zwei bis vier Paarungsversuche wurden für jedes Konstrukt durchgeführt.
    || Paarungseffizienz ist defined als Transkonjuganten pro 100 Spenderzellen. 0 Paarungseffizienz gibt keine Transkonjuganten aus einer 10-2 Verdünnung

    Tabelle 3: Abgeschafft Paarungseffizienz durch TRAF Deletionskonstrukte.

    Subscription Required. Please recommend JoVE to your librarian.

    Discussion

    Bakterielle Konjugation Verfahren liefert ein Mittel, mit dem Bakterien-Gene bietet einen evolutionären Vorteil für das Wachstum in anspruchsvollen Umgebungen, wie die Ausbreitung von Antibiotika-Resistenzmarker ausbreiten kann. Da viele der konjugativen Plasmiden so groß sind, 12 funktionelle Studien über die beteiligten Proteine in der Montage der Übertragungsvorrichtung durch Mutation von Zielgenen auf dem konjugativen Plasmid selbst sind unhandlich. Die detaillierten Protokolle hierin ein Mittel bereitzustellen , mit dem man das Zielgen von Interesse durch die Verwendung von kleineren, besser handhabbare Expressionsplasmide (Abbildung 1) leichter zu beurteilen. Wir verwenden das F - Plasmid - Derivat pOX38-Tc (Tabelle 1) F - Plasmid-vermittelte Konjugation zu untersuchen; andere konjugierende Plasmide können mit Hilfe der detaillierten Protokolle hier und entsprechende Derivat Plasmide untersucht werden. Die Paarung Assays skizziert wurden von Frost und Kollegen angepasst, 42 mit einigen modifications. In früheren Studien, 8,33,42 die Schaffung des pOX38-Tc Δgene :: Cm Konstrukt wurde durch Spaltung des Gens von Interesse mit den geeigneten Restriktionsenzymen und Einführen des amplifizierten CAT - Kassette in pOX38-Tc erreicht. 42 In der aktuellen Methode verwenden wir eine homologe Rekombination in der Recombineering E. coli - Stamm DY330R 33,34 das Zielgen KO und es mit dem CAT - Kassette ersetzen. Dies hat den Vorteil, daß die resultierende DY330R Belastung ermöglicht die pOX38-Tc Δgene :: Cm konstruieren, um als Kontrolle für die Gen-spezifischen Knockout Beherbergung aus F-T4SS konjugativen Transfer über die Wiederherstellung der Übertragung unter Verwendung des pK184-Gen Recovery-Plasmid vermittelte . Während es möglich sein kann , Vorprägungen mit einem CRISPER-Cas9 Methodik zu generieren, 43 haben wir nicht an dieser , diese Möglichkeit erforscht Zeit.

    Der Prozess beginnt mit der Erzeugung eines Gen - Knockout in dem F - Plasmid - Derivat pOX38-Tc (Figure 1). Dies wird durch homologe Rekombination in DY330R Zellen (Tabelle 1) erreicht, andere Stämme mit ähnlichen Funktionen wie DY329, DY331 und DY378 können ebenfalls verwendet werden. Primer werden zunächst PCR entworfen , um die CAT - Kassette aus dem Plasmid pBAD33 32 verstärken und überhängenden Basen enthalten, die für das Zielgen spezifisch sind (Tabelle 2); das PCR-Produkt wird dann durch Elektroporation in Zellen beherbergen DY330R pOX38-Tc. Die homologe Rekombination erzeugt die Knock-out-Plasmid pOX38-Tc Δgene :: Cm wo die CAT-Kassette in-Rahmen innerhalb des Zielgens eingesetzt wird, effektiv T4SS Montage und Konjugation zu stören, während Cm Widerstand bereitstellt. Zur gleichen Zeit, das Zielgen PCR wird aus pOX38-Tc verstärkt und in einen kleinen Expressionsplasmid eingeführt ist; in diesem Protokoll verwenden wir pK184 für konstitutive Expression, jedoch könnte man ein Plasmid mit induzierbare Expression des Zielgens gewählt, falls gewünscht. Das pK184-Gen Plasmid wird dann umgewandeltin die DY330R pOX38-Tc Δgene :: Cm Zellen, und werden diese Zellen dann als Spender verwendet die pOX38-Tc Δgene :: Cm über Konjugation in XK1200 Zellen für die Paarung Assays zu übertragen konstruieren. In den zusammenpassenden Assays werden die Donor- und Empfängerzellen XK1200 pOX38-Tc Δgene :: Cm und MC4100, respectively. Die pK184-Gen Rückgewinnungs Plasmid sowie die Serie Mutanten des Zielgens (Deletionen oder Punktmutationen), wird an die Spenderzellen bereitgestellt ihre Fähigkeit zu bewerten Paarungs wiederherzustellen und seine Effizienz zu bestimmen, mit MC4100 Empfängerzellen (Abbildung 2 ; Tabelle 3).

    Entscheidend für das Verfahren ist die Verwendung entsprechender Donor- und Rezipientenstämme (Tabelle 1), und die Konstruktion der verwendeten Primer. Für jeden Primer, gibt es allgemeine Richtlinien, die befolgt werden sollten. Während wir streng mit 40-60% GC-Gehalt zu halten versuchen, dies nicht immer möglich sein kann. In solchen Fällen ist es im Ermessen des Experimentators eine Grundierung zu testen with GC-Gehalt leicht unterhalb oder oberhalb dieses Bereichs. Die Schmelztemperatur (T m) des Vorwärts- und Rückwärts - Primer muß ähnlich sein, und die Wärmebehandlungstemperatur (T a) Wert sollte immer kleiner sein als die T m um 2-5 ° C für die PCR. Die freie Energie zur Verfügung , um einem haarnadel sollte viel niedriger als die T a zu entwickeln, während die Homo- und Hetero- Dimerisierung T m 's sehr niedrig sein muss (weniger als -10 kJ und 30 ° C). Primer können so entworfen werden, Deletionen, Insertionen oder Punktmutationen zu untersuchen, wie gewünscht. Es ist natürlich wichtig, dass die resultierende Genkonstrukt amplifiziert und in den Rückgewinnungs Plasmid ligiert werden, in-frame, so daß es richtig exprimiert wird. Die Transformation von kompetenten Zellen können mittels Elektroporation oder Hitzeschock unter Verwendung elektro oder chemisch kompetente Zellen bzw. durchgeführt werden. Wir finden, dass die Elektroporation für größere Konstruktionen effizienter ist, wie pOX38-Tc und die homologe Rekombination oligonucleotide, während die kleineren Expressionsplasmide wie pK184-TRAF kann leicht in die Zellen unter Verwendung von Methoden Hitzeschock umgewandelt werden. Schließlich ist es wichtig, sich daran zu erinnern, dass es im ganzen Protokoll mehrere Antibiotika im Einsatz sein wird, da beide Spender und Empfänger-Stämme unterschiedliche Widerstände erfordern, die von den Angaben in den konjugativen und Recovery-Plasmide verwendet unterschiedlich sind.

    Abgesehen von den zusammenpassenden Assays Techniken, die hier beschrieben ist, gibt es andere Verfahren, die verwendet werden bakterielle Konjugation zu studieren, leicht in ihrem Ansatz variiert. Horizontaler Gentransfer ist ein Prozess, bei dem Bakterien ein Plasmid zu einer Empfängerzelle übertragen, Interspezies-Empfänger einschließlich. 44 Eine Studie von Dahlberg und Kollegen 44 zum Beispiel bakterielle Konjugation verwendet , um das Ausmaß der Inter horizontalen Gentransfers bestimmen. Sie verwendet, um die Inkorporation des grün fluoreszierenden Proteins (GFP) in ein Plasmid in KT2442 Zellen geklont; die chromosomale lac I q Gen in den KT2442 - Zellen unterdrücken die GFP - Expression. Wenn das Plasmid tragen GFP in eine Spezies überführt wird , ohne die q - Gen lac I wird die Fluoreszenz beobachtet. 44 Trotz der Einschränkung möglicherweise mit den hier vorgestellten Protokolle gekoppelt werden könnten Protein spezifische Funktion in verschiedenen Arten, die Interspezies Konjugationsversuch bereitzustellen Evolutionsvorhersagen für Protein-Protein - Wechselwirkungen zwischen verschiedenen Spezies zu machen.

    Subscription Required. Please recommend JoVE to your librarian.

    Disclosures

    Die Autoren erklären, dass sie keine finanziellen Interessen haben.

    Acknowledgments

    Diese Forschung wurde von einem Discovery-Stipendium der Naturwissenschaften & Engineering Council of Canada (NSERC) unterstützt.

    Materials

    Name Company Catalog Number Comments
    GeneJet Plasmid Mini-Prep Kit Fisher Scientific K0503
    GeneJet Gel Extraction Kit Fisher Scientific K0692
    GeneJet PCR Purification Kit Fisher Scientific K0702
    Q5 Site-Directed Mutagenesis Kit New England Biolabs E0554S
    Broad Range DNA Ladder New England Biolabs N0303A
    Petri Dishes Fisher Scientific FB0875713
    Electroporator Eppendorf 4309000027
    Electroporation cuvettes Fisher Scientific FB101 Cuvettes have a 1 mm gap.
    Enzymes
    AvaI New England Biolabs R0152S
    EcoRI New England Biolabs R0101S
    HindIII New England Biolabs R0104L
    NdeI New England Biolabs R0111S
    Phusion DNA Polymerase New England Biolabs M0530L
    T4 DNA Ligase New England Biolabs M0202S
    DpnI New England Biolabs R0176S
    Antibiotics Final Concentrations
    Chloramphenicol (Cm) Fisher Scientific BP904-100 20 µg/mL
    Kanamycin (Km) BioBasic Inc. DB0286 50 µg/mL
    Nalidixic acid (Nal) Sigma-Aldrich N8878-25G 10 µg/mL
    Rifampicin (Rif) Calbiochem 557303 20 µg/mL
    Tetracycline (Tc) Fisher Scientific BP912-100 10 µg/mL
    Streptomycin (Sm) Fisher Scientific BP910-50 50 µg/mL

    DOWNLOAD MATERIALS LIST

    References

    1. Dobrindt, U., Hochhut, B., Hentschel, U., Hacker, J. Genomic islands in pathogenic and environmental microorganisms. Nat Rev Microbiol. 2, (5), 414-424 (2004).
    2. Furuya, E. Y., Lowy, F. D. Antimicrobial-resistant bacteria in the community setting. Nat Rev Microbiol. 4, (1), 36-45 (2006).
    3. Griffiths, A., Miller, J., Suzuki, D., Lewontin, R., Gelbart, W. An Introduction to Genetic Analysis, 7th Edition. W.H. Freeman. San Fransisco. (2000).
    4. Cooper, T. F. Recombination Speeds Adaptation by Reducing Competition between Beneficial Mutations in Populations of Escherichia coli. PLoS Biol. Barton, N. H. 5, (9), 225 (2007).
    5. Lujan, S. A., Guogas, L. M., Ragonese, H., Matson, S. W., Redinbo, M. R. Disrupting antibiotic resistance propagation by inhibiting the conjugative DNA relaxase. Proc Natl Acad Sci. 104, (30), 12282-12287 (2007).
    6. Carattoli, A. Plasmids and the spread of resistance. Int J Med Microbiol. 303, (6-7), 298-304 (2013).
    7. Shala, A., Ferraro, M., Audette, G. F. Bacterial Secretion Systems: Nanomachines for Infection and Genetic Diversity. Handbook of Clinical Nanomedicine: Nanoparticles, Imaging, Therapy and Clinical Applications. Bawa, R., Audette, G. F., Rubenstein, I. Pan Sanford Publishing. Singapore. 657-686 (2016).
    8. Tseng, T. T., Tyler, B. M., Setubal, J. C. Protein secretion systems in bacterial-host associations, and their description in the Gene Ontology. BMC Microbiol. 9, (1), Suppl 1 2 (2009).
    9. Alvarez-Martinez, C. E., Christie, P. J. Biological diversity of prokaryotic type IV secretion systems. Microbiol Mol Biol Rev. 73, (4), 775-808 (2009).
    10. Lawley, T. D., Klimke, W. A., Gubbins, M. J., Frost, L. S. F factor conjugation is a true type IV secretion system. FEMS Microbiol Lett. 224, (1), 1-15 (2003).
    11. Lederberg, J., Tatum, E. L. Gene Recombination in Escherichia Coli. Nature. 158, (4016), 558-558 (1946).
    12. Smillie, C., Garcillan-Barcia, M. P., Francia, M. V., Rocha, E. P. C., de la Cruz, F. Mobility of Plasmids. Microbiol Mol Biol Rev. 74, (3), 434-452 (2010).
    13. Willetts, N., Skurray, R. The Conjugation System of F-Like Plasmids. Annu Rev Genet. 14, (1), 41-76 (1980).
    14. Frost, L. S., Ippen-Ihler, K., Skurray, R. A. Analysis of the sequence and gene products of the transfer region of the F sex factor. Microbiol Rev. 58, (2), 162-210 (1994).
    15. Audette, G. F., Manchak, J., Beatty, P., Klimke, W. A., Frost, L. S. Entry exclusion in F-like plasmids requires intact TraG in the donor that recognizes its cognate TraS in the recipient. Microbiology. 153, Pt 2 442-451 (2007).
    16. Christie, P. J., Atmakuri, K., Krishnamoorthy, V., Jakubowski, S., Cascales, E. Biogenesis, Architecture, and Function of Bacterial Type Iv Secretion Systems. Annu Rev Microbiol. 59, (1), 451-485 (2005).
    17. Christie, P. J. Type IV secretion: the Agrobacterium VirB/D4 and related conjugation systems. Biochim Biophys Acta - Mol Cell Res. 1694, (1-3), 219-234 (2004).
    18. Bhatty, M., Laverde Gomez, J. a, Christie, P. J. The expanding bacterial type IV secretion lexicon. Res Microbiol. 164, (6), 620-639 (2013).
    19. Christie, P. J., Cascales, E. Structural and dynamic properties of bacterial Type IV secretion systems (Review). Mol Membr Biol. 22, (1-2), 51-61 (2005).
    20. Christie, P. J. Type IV secretion: Intercellular transfer of macromolecules by systems ancestrally related to conjugation machines. Mol Microbiol. 40, (2), 294-305 (2001).
    21. Christie, P. J., Whitaker, N., González-Rivera, C. Mechanism and structure of the bacterial type IV secretion systems. Biochim Biophys Acta. 1843, (8), 1578-1591 (2014).
    22. Cascales, E. The type VI secretion toolkit. EMBO Rep. 9, 735 (2008).
    23. Silverman, J. M., Brunet, Y. R., Cascales, E., Mougous, J. D. Structure and Regulation of the Type VI Secretion System. Annu Rev Microbiol. 66, (1), 453-472 (2012).
    24. Chandran, V., et al. Structure of the outer membrane complex of a type IV secretion system. Nature. 462, (7276), 1011-1015 (2009).
    25. Rivera-Calzada, A., et al. Structure of a bacterial type IV secretion core complex at subnanometre resolution. EMBO J. 32, (8), 1195-1204 (2013).
    26. Waksman, G., Fronzes, R. Molecular architecture of bacterial type IV secretion systems. Trends Biochem Sci. 35, 691 (2010).
    27. Fronzes, R., Christie, P. J., Waksman, G. The structural biology of type IV secretion systems. Nat Rev Microbiol. 7, (10), 703-714 (2009).
    28. Kaplan, M., et al. Probing a cell-embedded megadalton protein complex by DNP-supported solid-state NMR. Nat Methods. 12, (7), 5-9 (2015).
    29. Guyer, M. S., Reed, R. R., Steitz, J. A., Low, K. B. Identification of a sex-factor-affinity site in E. coli as gamma delta. Cold Spring Harb Symp Quant Biol. 45, Pt 1 135-140 (1981).
    30. Anthony, K. G., Sherburne, C., Sherburne, R., Frost, L. S. The role of the pilus in recipient cell recognition during bacterial conjugation mediated by F-like plasmids. Mol Microbiol. 13, (6), 939-953 (1994).
    31. Jobling, M. G., Holmes, R. K. Construction of vectors with the pl5a replicon, kanamycin resistance, inducible lacZα and pUC18 or pUC19 multiple cloning sites. Nucleic Acids Res. 18, (17), 5315 (1990).
    32. Guzman, L. M., Belin, D., Carson, M. J., Beckwith, J. Tight regulation, modulation, and high-level expression by vectors containing the arabinose P(BAD) promoter. J Bacteriol. 177, (14), 4121-4130 (1995).
    33. Yu, D., et al. An efficient recombination system for chromosome engineering in Escherichia coli. Proc Natl Acad Sci U S A. 97, (11), 5978-5983 (2009).
    34. Lawley, T. D., Gilmour, M. W., Gunton, J. E., Standeven, L. J., Taylor, D. E. Functional and Mutational Analysis of Conjugative Transfer Region 1 (Tra1) from the IncHI1 Plasmid R27. J Bacteriol. 184, (8), 2173-2180 (2002).
    35. Elton, T. C., Holland, S. J., Frost, L. S., Hazes, B. F-Like Type IV Secretion Systems Encode Proteins with Thioredoxin Folds That Are Putative DsbC Homologues. J Bacteriol. 187, (24), 8267-8277 (2005).
    36. Hazes, B., Frost, L. Towards a systems biology approach to study type II/IV secretion systems. Biochim Biophys Acta. 1778, 1839-1850 (2008).
    37. Lento, C., Ferraro, M., Wilson, D., Audette, G. F. HDX-MS and deletion analysis of the type 4 secretion system protein TraF from the Escherichia coli F plasmid. FEBS Lett. Tsolis, R. 590, (3), 376-386 (2016).
    38. Audette, G. F., Van Schaik, E. J., Hazes, B., Irvin, R. T. DNA-binding protein nanotubes: Learning from nature's nanotech examples. Nano Lett. 4, 1897-1902 (2004).
    39. Harris, R. L., Silverman, P. A. Tra proteins characteristic of F-like type IV secretion systems constitute an interaction group by yeast two-hybrid analysis. J Bacteriol. 186, (16), 5480-5485 (2004).
    40. Moore, D., et al. Characterization of the F-Plasmid Conjugative Transfer Gene traU. J Bacteriol. 172, (8), 4263-4270 (1990).
    41. Anthony, K. G., Sherburne, C., Sherburne, R., Frost, L. S. The role of the pilus in recipient cell recognition during bacterial conjugation mediated by F-like plasmids. Mol Microbiol. 13, (6), 939-953 (1994).
    42. Klimke, W. A., Frost, L. S. Genetic analysis of the role of the transfer gene, traN, of the F and R100-1 plasmids in mating pair stabilization during conjugation. J Bacteriol. 180, (16), 4036-4043 (1998).
    43. Jiang, W., Marraffini, L. A. CRISPR-Cas: New Tools for Genetic Manipulations from Bacterial Immunity Systems. Annu Rev Microbiol. 69, (1), 209-228 (2015).
    44. Dahlberg, C., Bergstrom, M., Andreasen, M., Christensen, B. B., Molin, S., Hermansson, M. Interspecies bacterial conjugation by plasmids from marine environments visualized by gfp expression. Mol Biol Evol. 15, (4), 385-390 (1998).

    Comments

    0 Comments


      Post a Question / Comment / Request

      You must be signed in to post a comment. Please or create an account.

      Usage Statistics