יחיד תא RNA-Seq של קבוצות מוגדרות של תאים גנגליון רשתית

Neuroscience

Your institution must subscribe to JoVE's Neuroscience section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

כאן, אנו מציגים גישה קומבינטורית לסיווג סוגי תאים נוירונים לפני הבידוד ועל אפיון לאחר מכן של transcriptomes תא בודד. פרוטוקול זה מייעל את ההכנה של דגימות עבור רצף RNA מוצלח (RNA-Seq) ומתאר מתודולוגיה שתוכננה במיוחד עבור הבנה משופרת של מגוון הסלולר.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Laboissonniere, L. A., Sonoda, T., Lee, S. K., Trimarchi, J. M., Schmidt, T. M. Single-cell RNA-Seq of Defined Subsets of Retinal Ganglion Cells. J. Vis. Exp. (123), e55229, doi:10.3791/55229 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

גילוי של סמנים ספציפיים סוג תא יכול לספק תובנה לתפקוד הסלולר ואת מקורות ההטרוגניות הסלולרית. עם דחיפה לאחרונה לשיפור ההבנה של המגוון העצבתי, חשוב לזהות גנים אשר הביטוי שלהם מגדיר subpopulations שונים של תאים. הרשתית משמשת מודל מצוין לחקר המגוון של מערכת העצבים המרכזית, שכן היא מורכבת מסוגי תאים רבים. המחקר של כל סוג גדול של תאים הניב סמנים גנטיים המאפשרים זיהוי של אוכלוסיות אלה. עם זאת, תת סוגים מרובים של תאים קיימים בתוך כל אחד אלה הגדולות הכיתות תא הרשתית, ומעטים אלה subtypes יש ידוע סמנים גנטיים, אם כי רבים התאפיינו מורפולוגיה או פונקציה. ידע של סמנים גנטיים עבור תת סוגים ספציפיים ברשתית יאפשר מחקר ומיפוי של מטרות המוח הקשורות פונקציות ויזואליות ספציפיות עשוי גם להשאיל תובנה רשתות הגן כילשמור על מגוון הסלולר. אפיקים עכשוויים המשמשים לזיהוי סמנים גנטיים של תת סוגים יש חסרונות, כגון סיווג של סוגי תאים הבאים רצף. זה מציג אתגר לניתוח נתונים ודורש שיטות אימות קפדניות על מנת להבטיח אשכולות מכילים תאים של אותה פונקציה. אנו מציעים טכניקה לזיהוי מורפולוגיה ופונקציונליות של התא לפני בידוד ורצף, אשר יאפשר זיהוי קל של סמנים ספציפיים משנה. טכניקה זו עשויה להיות מורחבת סוגי תאים שאינם עצביים, כמו גם לאוכלוסיות נדירות של תאים עם וריאציות קלות. פרוטוקול זה מניב נתונים באיכות מעולה, כמו רבים של הספריות סיפקו לקרוא מעמקים גדולים יותר מ 20 מיליון קורא עבור תאים בודדים. מתודולוגיה זו מתגבר על רבים של המכשולים המוצגים על ידי תא יחיד RNA-Seq ועשויים להתאים לחוקרים שמטרתם פרופיל סוגי תאים בצורה פשוטה ויעילה.

Introduction

המגוון העצבתי הוא ציין בכל מערכת העצבים המרכזית, במיוחד הרשתית החולייתיים, רקמה מיוחדת מאוד המורכבת של 1 סוגי גלייה ו 6 תאים עצביים הנובעים מאוכלוסייה אחת של תאים אב רשתית 1 , 2 , 3 . תת סוגים רבים של תאים ניתן לסווג מבחינה תפקודית, מורפולוגית, גנטית. מטרת פרוטוקול זה היא לקשור את השונות הגנטית של סוגי תאים למאפיינים פונקציונליים ו / או מורפולוגיים הניתנים לזיהוי שלהם. מספר גנים זוהו עבור סיווג של תאים, אבל תת סוגים רבים ממשיכים ללכת uncharacterized, כפי שהם מייצגים חלק קטן מכלל האוכלוסייה. זיהוי הגנים בתוך תת-סוגים ספציפיים אלה יאפשר הבנה טובה יותר של המגוון העצבתי בתוך הרשתית ויכול גם לשפוך אור על גיוון של תאים עצביים במקומות אחרים. פוRthermore, תא בודד מאפשר לחשיפת סוגי תאים חדשים, אשר אולי היו overlooked בשל ייצוג נמוך שלהם בקרב האוכלוסייה הכוללת 4 , 5 , 6 , 7 .

אחד היתרונות של transcriptomics תא בודד הוא כי סמנים ייחודיים או שילובים של סמנים המגדירים תת סוג מסוים ניתן לגלות. אלה יכולים לשמש כדי לקבל גישה גנטית לסוג התא עבור מניפולציות שונות. לדוגמה, אנו משתמשים בפרוטוקול זה כדי לאפיין את סוג התא ספציפי גנים של קבוצת משנה של תאים גנגליון ברשתית המבטאים melanopsin photopigment. השימוש בסמן פלואורסצנטי בתאי גנגליון ברשתית מלנופסין מאפשר לחקור את התאים הללו, מכיוון שהם מקובצים יחד בשל הביטוי שלהם לגן ידוע. מעניין, ישנם חמישה subtypes ידוע של תא זה popuLation ברשתית העכבר 8 . לכן, על מנת לבודד RNA מתאי כל סוג, השתמשנו סיווגים מורפולוגיים הוקמה בתוך המודל המהונדס לזהות כל תת סוג לפני בידוד התא. טכניקה זו מאפשרת אפיון של תאים, כמו גם עבור בידוד שלהם ישירות הרשתית, ללא צורך רקמות דיסוציאציה, אשר עלול לגרום לתגובה מתח בתוך תאים זיהום עקב דנדריטים כרותים 9 .

שפע של טכניקות חדשות יש אור לאור בשנים האחרונות כמו שיטת RNA-Seq ממשיכה להתפתח. כלים אלה מאפשרים רכישת תאים מקסימלית ויעילות עלות גבוהה יותר כאשר מתקרבים לשאלה הנדונה 4 , 7 , 10 , 11 , 12 , 13 . עם זאת, בעודטכניקות אלה היו אבני דריכה מעולה, יש מספר משוכות עדיין נתקל כי פרוטוקול זה הוא מסוגל לטפל. ראשית, רבים מהנהלים הנוכחיים מבודדים תאים מרקמות מנותקות ומנסים להשתמש בניתוח רכיבים ראשי או באשכולות הירארכיים פוסט-הוק לקביעת סיווג התא. ההסתמכות על כלים אלה כדי לסווג תת-סוגים לא תניב תוצאות אמינות ותיאלץ למצוא דרכים חדשות לאימות נתונים אלה עבור המתאם של סמן גנטי לסוג פונקציונלי של תאים. הדרישה לדיסוציאציה בפרוטוקולים אחרים עלולה לעיתים לגרום לנזק לרקמות, ועלולה לגרום לנתק תהליכים עצביים, וכתוצאה מכך לאובדן פוטנציאלי של mRNA. יתר על כן, בהכנות התא ניתק, התגובות הלחץ עשוי להתחיל להשפיע על transcriptomes של תאים אלה 14 . פרוטוקול זה מתגבר על אתגרים אלה על ידי קביעת סוג התא פונקציונלי לפני הבידוד, וזה טוב יותר שומרת על חשל התאים על ידי שמירה על רקמת הרשתית ללא פגע.

טכניקה אחת הוצגה בשנת 2014 וכללה ניתוח in vivo של transcriptome של תאים חיים 15 . בעוד טכניקה זו מאפשרת בדיקה של transcriptome עם הפרעה מכנית מינימלית לרקמה, היא חסרה את היכולת לסווג סוגי תאים ספציפיים בתוך הרקמה לפני בחינת transcriptomes שלהם ללא שימוש בעכבר הספציפי מאוד. הפרוטוקול שלנו אינו דורש כתב ספציפי, כפי שאנו לנצל תא מילוי electrophysiology לאפיין תאים לפני הבידוד שלהם. הגבלה נוספת של פרוטוקול זה הקודם היא כי זה דורש אורך גל מסוים כדי לעורר את היסוד photoactivatable, בעוד פרוטוקול שלנו מאפשר שימוש של כתב ניאון וצבע ניאון, אשר זמינים או ניתן לבחור על ידי כל מעבדה בנפרד. עם זאת, מעבדות אחרות יש נשוי שתי שיטות של electrאופיסיולוגיה וטרנסריפטומיקס לחקר המגוון הסלולרי. השימוש של הקלטות מהדק תיקון לאפיין את הפונקציה של התא לפני בידוד שלה בוצעה על נוירונים מנותקים 16 , ובמקרים מסוימים, היא קדמה לשימוש של ניתוח microarray 17 עבור מחקרים אלה. סיבוכים אותו נתקלים גישות אלה, כפי שהם דורשים דיסוציאציה רקמות או שימוש בטכנולוגיה microarray, אשר מסתמך על הכלאה של דגימות בדיקות זמינות. אחד ההתקדמות האחרונה היתה פיתוח של תיקון- Seq, טכניקה המשלבת את השימוש של הקלטות מהדק תיקון וטכנולוגיה RNA-Seq כדי להבין תאים מכל פרוסות המוח כולו 18 . בעוד טכניקה זו יש דמיון שלה לפרוטוקול המוצג כאן, זה שוב חשוב לציין כי הגישה שלנו מאפשרת רקמה להישאר שלמים לבריאות התאים. כאן, אנו מציגים פרוטוקול האופטימיזציהיון של הברית הזאת, אשר מייצר באיכות גבוהה, תא בודד ספריות לשימוש RNA-Seq להשיג עומק קריאה גבוהה כיסוי המיפוי.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

כל הנהלים אושרו על ידי טיפול בבעלי חיים מוסדיים ועדת שימוש (IACUC) באוניברסיטת נורת 'ווסטרן.

1. הכנת פתרונות אלקטרופיזיולוגיה (4 שעות)

  1. בצע 0.1% DEPC שטופלו H 2 O על ידי הוספת 1 מ"ל של diyyl pyrocarbonate (DEPC) ל 999 מ"ל של אוסמוזה הפוכה מטוהרים H 2 O. מערבבים היטב ולתת את הדגירה תערובת במשך שעה 1 בטמפרטורת החדר (RT). ואז, החיטוי DEPC מעורבב H 2 O במשך 15 דקות על מחזור נוזלי. תן DEPC שטופלו H 2 O מגניב ב RT.
  2. הפוך את הפתרון תאיים על ידי ערבוב בקבוק אחד של בינוני אמס ו 1.9 גרם (23 מ"מ) של סודיום ביקרבונט לתוך 1 L של H 2 O. בועה הפתרון תאיים
    95% O 2 /5% CO 2 ולשמור אותו ב pH של 7.3-7.4.
  3. יצירת פתרון תאיים על ידי שילוב של 125 מ"מ K-gluconate, 2 מ"מ MgCl 2 , 10 מ"מ EGTA, 10 מ"מ HEPES, 0.1% DEPC שטופלו H2 O. לאחסן אותו 1 aliquots מ"ל ב -20 מעלות צלזיוס. הוסף 10 מיקרומטר של נותב ניאון בתחילת כל ניסוי.
  4. הפוך פתרון האנזים על ידי הוספת 10,000 יחידות של collagenase ו 83 מ"ג של hyaluronidase ל 4.15 מ"ל של פתרון תאיים. הפתרון האנזים צריך להיות מאוחסן 50 aliquots μL ב -20 מעלות צלזיוס.

2. הכנת רקמת הרשתית (2 שעות)

הערה: יש לבצע את כל ההליכים בסעיף זה תחת תאורה אדומה עמומה

  1. כהה להתאים חיות לפחות 1 שעות לפני לנתיחה. בצע את כל ההליכים תחת תאורה אדומה עמום.
  2. להרדים את החיות על ידי CO 2 asphyxiation ו enucleate את העין לתוך צלחת פטרי עם פתרון תאיים מחומצן בעבר.
  3. לדחוף את הקרנית עם מחט לחתוך אותו על ידי חיתוך עם מספריים עיניים על גבול הקרנית ו sclera 19 .
  4. הסר את העדשה באמצעות# 5 מלקחיים. בעדינות להפוך דמעה ב sclera עם מלקחיים לנתק את עצב הראייה שבו הרשתית ו sclera להיפגש. בזהירות לסיים את הסרת sclera מן הרשתית.
  5. הסר את הזגוגית שקוף באמצעות # 5 מלקחיים; לאחר הסרת, זגוגית מופיע כחומר ג'לטין תקוע המלקחיים. פורסים את הרשתית לחצי (כך שיש 4 חתיכות / בעלי חיים) ולאחסן אותם בתמיסה חוץ-חמצונית מחוממת ב- RT עד לשימוש.
  6. כאשר מוכן לעלות את הרקמה בתא ההקלטה, במקום פיסת רשתית לדגור בפתרון אנזים מדולל μL 500 של פתרון תאיים מחומצן. לדגור בצלחת פטרי עבור 2 דקות ב RT על שייקר.
    1. שטפו את פיסת הרשתית בתמיסה תאיים מחומצן ומניחים את הרקמה בתא הקלטה זכוכית התחתונה; השתמש פיפטה העברת פלסטיק עם קצה לחתוך כדי לאפשר הרשתית יועברו ללא גרימת נזק לרקמה.
  7. לשימושCeps בזהירות לשטח את הרקמה עם שכבת photoreceptor כלפי מטה. הסר נוזל עודף באמצעות פיפטה. עוגן הרקמה באמצעות טבעת פלטינה עם רשת ניילון.
    הערה: שיטה זו יכולה לשמש גם כדי להכין את הרקמה לבידוד של רנ"א מ שכותרתו amacrine ותאים דו קוטבית.
  8. ממלאים את החדר עם פתרון תאיים חמצון ולהעלות אותו על הבמה מיקרוסקופ. רקמות perfuse עם פתרון תאיים חמצון ב 2-4 מ"ל / דקות.

3. ויזואליזציה ומיקוד של GFP + תאים ברשתית גנגליון (10 דקות)

הערה: יש לבצע את כל ההליכים בסעיף זה תחת תאורה אדומה עמומה

  1. לפני תחילת, למשוך micropipettes זכוכית (OD: 1.2 מ"מ, מזהה: 0.69 מ"מ) עבור הקלטות אלקטרו באמצעות משגר micropipette. השתמש בפרוטוקול הבא עבור האלקטרודות (שים לב כי הפרמטרים צריך להיות מותאם בהתאם להשיג את ההתנגדות הרצויה יהיהלהשתנות על פני משיכים עם זכוכית שונים): חום: כבש +10; משוך: 0; Vel: 23; עיכוב: 1; לחץ: 500; תוכנית לולאה: 5 פעמים. ודא כי הטיפים הם ~ 1 מיקרומטר בקוטר, עם ההתנגדות של 2-4 MΩ עבור מיקוד תאים גדולים של 5-7 MΩ למיקוד תאים קטנים יותר.
  2. לבחון את שכבת התא גנגליון באמצעות הפרעות אינפרא אדום הפרעה ניגודיות (IR-DIC) אופטיקה ( איור 1 א ). זיהוי GFP + תאים גנגליון רשתית (RGCs) באמצעות epifluorescence (~ 480 ננומטר) ( איור 1 ב ).
  3. אתר פיפטה מלא פתרון תאיים ב- DIC. החלת לחץ חיובי קל ואפס כל מתח קיזוז על מגבר.
  4. לחץ על micropipette זכוכית כנגד תא GFP + וליישם לחץ שלילי כדי ליצור חותם GΩ בין פיפטה לבין קרום התא. החל בדיקה של שלבי המבחן ( למשל, 5 mV) כדי לפקח על עמידות החותם. לאחר יצירת חותמת יציבה, לקרוע את הממברנה על ידי הפעלת פעימות קצרות של nלחץ אקטיבי כדי לקבל גישה לתא שלם.
  5. המתן 1-2 דקות עבור הדנדריטים של התא למלא נותב פלואורסצנטי.
    הערה: התא ניתן להקליד מורפולוגית על ידי בחינת מורפולוגיה ב epifluorescence ( איור 1C ). במקרה של melanopsin- ביטוי RGCs, ריבוד דנדריטי בשכבה plexiform הפנימי הוא דמיינו על ידי בחינת הדנדריטים מלאים נותב ניאון תחת תאורה epifluorescent וקביעת אם הם stratify רחוק סומה ב sublamina OFF (M1 ipRGCs), ליד הגנגליון (M2 & M4 ipRGCs), או שניהם (M3 ipRGCs). תצפית זו, בשילוב עם גודל soma (M4s יש somas גדול באופן מובהק לעומת כל תת סוגים אחרים ipRGC), מאפשרים זיהוי של סוג התא 20 , 21 , 22 . לכן, טכניקה זו מאפשרת זיהוי של סוג התא במבחנה לפני RNA ISOLation. שיטה זו יכולה להיות שונה עבור סוג אחר התא זיהוי פרוטוקולים מעורבים או מורפולוגיה dendritic או פיזיולוגיה הסלולר.

4. בידוד תא (2 דקות)

  1. לפני תחילת, להגדיר את microcentrifuge השולחן עד 2,000 x גרם. הכן מדגם expelling על ידי חיבור צינור (OD: 3/32 ב, מזהה: 1/32 ב) עם מזרק 1 סמ"ק.
  2. מקום 0.2 צינורות מ"ל PCR המכיל 10 μL של חיץ תמוגה ו 1% β-mercaptoethanol על הקרח. הכן מזרק 1 cc המכיל DEPC שטופלו H 2 O לשטוף את טיפים פיפטה. הכן מכולה של קרח יבש להקפיא את המאגר תמוגה לאחר איסוף המדגם.
  3. בזהירות לחלץ את התוכן cytoplasmic של פיפטה התא על ידי הפעלת לחץ שלילי באמצעות מזרק 10 מ"ל; כל תוכן cytoplasmic, כולל האברונים, יש לחלץ אם אפשר.
    1. לפקח על החילוץ ב- DIC ידי הדמיה של גוף התא יורדת בגודל. לאחר החילוץ את התוכן cytoplasmic, להרים את פיפטה בזהירות את הרקמה במהירות להסיר את פיפטה מהפתרון.
  4. להסיר במהירות את פיפטה מן בעל הבמה הראש ולשטוף את קצה פיפטה בקצרה עם DEPC שטופלו H 2 O באמצעות מזרק 1 מ"ל. חבר את פיפטה מזרק 1 מ"ל דרך צינורות מתאים להדק את המדגם.
  5. מיד לגרש את התאים μL 10 של חיץ תמוגה 1 המכיל 1% β-mercaptoethanol ב 0.2 צינורות PCR מ"ל.
    הערה: לשאוב את כל התאים צריך להיות מגורש בעדינות כדי לא להכניס בועות.
    1. בקצרה צנטריפוגה הצינור בצנטריפוגה מיני השולחן ב 2000 xg במשך 10 שניות. מיד פלאש להקפיא את דגימות במשך 5 דקות על קרח יבש. לאחר הקפאה, לאחסן אותם ב -80 מעלות צלזיוס למשך עד שבועיים לקבלת התוצאות הטובות ביותר; הדגימות עשויות להימשך זמן רב יותר, אך מומלץ כי הן יעובדו במהירות האפשרית.
E "> 5. טיהור רנ"א (30 דקות)

  1. לפני תחילת, להגדיר התקן מפריד מגנטי על ידי הדבקת החלק העליון של בעל קצה P20 או P200 קצה הפוך לעמוד 96 מגנטי גם 23 .
  2. הכן אתנול 70% טרי (EtOH) - כ 1 מ"ל לכל מדגם יספיק. הסר את חרוזי רנ"א מגנטי מ 4 ° C אחסון להפשיר אותם ב RT לפחות 30 דקות.
    הערה: לא יותר מ 8 דגימות צריך להיות מעובד בבת אחת, כמו צעדים רבים בפרוטוקול זה להסתמך על יעילות וטיפול מהיר.
  3. לאחר חרוזים מגנטיים נמצאים ב RT, מערבולת במשך 30 s כדי להבטיח כי הפתרון מעורב היטב.
    הערה: חרוזים להשתמש RNA ספציפי למאגר כדי להיקשר באופן סלקטיבי RNA, והם מאפשרים הסרה של פסולת הסלולר אחרים כאשר מועסקים עם מעמד צלחת מגנטית.
  4. להפשיר תאים RT במשך 1 דקות, ולאחר מכן להוסיף 5 μL של RNase חינם H 2 O למדגם זה; פיפטה למעלה ולמטה. הוסף 22 μL של חרוזי RNA לכל צינור pipettלערבב היטב. דגירה דגימות ב RT במשך 5 דקות כדי לאפשר RNA לקיים אינטראקציה לאגד עם חרוזים מגנטיים.
  5. מניחים את הצינורות על מכשיר מפריד מגנטי ולתת לשבת 8 דקות; לפני שתמשיך, להבטיח כי supernatant ברור. שימו לב החרוזים מתוך גלולה אחת ולוודא לא לנתק אותו במהלך pipetting.
  6. הסר את supernatant מן דגימות ולהוסיף 150 μL של EtOH 70%. הסר את EtOH וחזור לשטוף פעמיים נוספות.
  7. אפשר דגימות לאוויר יבש במשך 6 דקות. בדוק לסירוגין כדי לראות אם EtOH יותר אספה בתחתית הצינור. הסר אותו בהתאם.
  8. בעוד הדגימות מתייבשים, להכין 10X חיץ התגובה על ידי שילוב של 19 μL של חיץ תמוגה 2 ו 1 μL של מעכב RNase (40 U / μL). סובב אותו בקצרה ושמור אותו על הקרח.
  9. לאחר דגימות יבש את כדורי חרוז כבר לא נראה מבריק, להסיר את צינורות מפריד מגנטי ולהוסיף 9.5 μL של RNase ללא H 2 Oכדי rehydrate דגימות. מניחים את הדגימות על הקרח ומוסיפים 1 μL של חיץ התגובה 10x למדגם זה.

6. שעתוק הפוך (10 דקות)

הערה: לפני תחילת, להפשיר את ריאגנטים הדרושים עבור שעתוק לאחור (RT, למעט האנזים) על הקרח. אלה כוללים: פריימר II, חיץ 1, oligonucleotide, ומעכב RNase.

  1. לכל צינור, להוסיף 2 μL של תחל II (AAGCAGTGGTATCAACGCAGAGAGTACT (30) N -1 N, אשר N -1 יכול להיות A, C, או G ו- N יכול להיות, C, G, או T, 12 מיקרומטר). מניחים את צינורות thermocycler כי כבר שחומם ב 72 מעלות צלזיוס למשך 3 דקות.
  2. במהלך הדגירה, להכין את תערובת מאסטר RT. עבור כל תגובה, להוסיף 4 μL של חיץ 1 (250 מ"מ טריס HCl, pH 8.3, 375 מ"מ KCl, ו 30 מ"מ MgCl 2 ), 1 μL של oligonucleotide (48 מיקרומטר), ו 0.5 μL של מעכב RNase (40 U / ΜL).
  3. מיד לאחר הדגירה, במקום צינורותקרח 2 דקות.
  4. הוסף 2 μL לכל תגובה של transcriptase הפוך (100 U / μL) לתערובת הורים פיפטה ביסודיות. הוסף 7.5 μL של תערובת אב לצינור כל ומערבבים על ידי pipetting בעדינות. בקצרה לסובב את הצינורות כדי לאסוף את התוכן בתחתית ומכניסים אותם thermocycler שחומם מראש עם התוכנית הבאה: 42 מעלות צלזיוס למשך 90 דקות, 70 מעלות צלזיוס למשך 10 דקות, והחזק ב 4 מעלות צלזיוס.
  5. אחסן את צינורות ב -20 ° CO / N לפני שתמשיך, אם כי מומלץ הדגימות להתבצע באמצעות צעד ההגברה לפני מאוחסן לתקופות זמן ארוכות; מקורות אחרים מציעים O / N אחסון ב 4 ° C יהיה גם מקובל בשלב זה 24 .

7. הגברה cDNA (2.5 שעות)

הערה: לפני תחילת, להפשיר חיץ PCR ו PCR תחל על הקרח ספין צינורות למטה צנטריפוגה מיני השולחן לפני ביצוע התמהיל הראשי PCR.

  1. עבור כל תגובה, עמ 'Repare תערובת הורים PCR המכיל 25 μL של חיץ PCR, 1 μL של תחל PCR (12 מיקרומטר), 1 μL של פולימראז דנ"א, ו 3 μL של Nuclease ללא H 2 O. הוסף את הפולימרז DNA האחרון, רק לפני תוספת של תערובת הורים לדגימות.
  2. הוסף 30 μL של תערובת אב צינור כל ספין ב 2000 xg במשך 10 שניות כדי לאסוף את התוכן בחלק התחתון של הצינורות.
  3. מניחים את צינורות thermocycler שחומם מראש עם התוכנית הבאה: 95 מעלות צלזיוס למשך דקה 1; 34 מחזורים של 98 מעלות צלזיוס למשך 10 שניות, 65 מעלות צלזיוס למשך 30 שניות, ו- 68 מעלות צלזיוס למשך 3 דקות; 72 מעלות צלזיוס למשך 10 דקות; ו להחזיק ב 4 ° C.
    הערה: מספר המחזורים עבור PCR זה הוגדל ל -34, שונה מהוראות היצרן המוצעות. לאחר בדיקה חוזרת, מספר מחזור זה נמצא כדי לייצר תוצאות אמינות באופן עקבי.
  4. חנות צינורות ב -20 מעלות צלזיוס למשך שנה אחת לפני שתמשיך.

8. טיהור של cDN מוגברA (30 דקות)

  1. לפני תחילת טיהור, להביא את חרוזי DNA חיץ elution כדי RT לפחות 30 דקות. הכן 80% EtOH טרי; 1 מ"ל לכל מדגם צריך להספיק. הוסף 1 μL של חיץ תמוגה 10X למדגם זה.
  2. וורטקס חרוזי ה- DNA עבור 30 s ולהוסיף 50 μL של חרוזי DNA לכל מדגם. מערבבים היטב על ידי pipetting, ולאחר מכן בקצרה ספין אותם ב 2000 xg במשך 10 שניות. דגירה צינורות ב RT במשך 8 דקות.
  3. מניחים את הצינורות על המכשיר ההפרדה המגנטית במשך 5 דקות. בעדינות פיפטה supernatant מעלה ומטה פעמיים ולאפשר דגימות לשבת במשך 2 דקות. בעוד הדגימות הן על המכשיר המגנטי, להסיר את supernatant וזורקים.
  4. הוסף 150 μL של EtOH 80% טריים למדגם זה ולאפשר להם לשבת ב RT במשך 30 שניות. הסר את EtOH וחזור על שטיפת EtOH פעם אחת.
  5. בקצרה לסובב את דגימות ומניחים אותם בחזרה על מפריד מגנטי במשך 1 דקות. הסר כל EtOH הנותרים ולאפשר דגימות לאוויר יבש במשך 5 דקות.
  6. לאחר גלולה חרוז כבר לא נראה מבריק, אבל לפני סדקים מתחילים להופיע, להסיר את הצינור מן מפריד מגנטי ולהוסיף 17 μL של חיץ elution. בעדינות פיפטה למעלה ולמטה כדי resuspend את החרוזים לחלוטין.
  7. דגירה דגימות resuspended ב RT במשך 2 דקות.
  8. בקצרה לסובב את הדגימות כדי לאסוף את כל נוזל בתחתית ומניחים אותם על מפריד מגנטי במשך 2 דקות. העברת 15 μL של supernatant ברור לצינור 1.5 מ"ל RNase חינם ולאחסן אותו ב -20 מעלות צלזיוס.
  9. לבחון את איכות וגודל הספריה cDNA עם שבב bioanalyzer רגישות גבוהה באמצעות 1 μL של cDNA. הגודל האידיאלי של ספריית cDNA הוא 0.3-2 Kb, עם ריכוז של לפחות 10 ng / μL ( איור 2 ).
    הערה: אתה יכול לבחור להעסיק PCR כדרך דגימות המסך כדי להבטיח את הביטוי של סמנים ידועים לפני שתמשיך עם מדגם PREparation.

9. קביעת ריכוזים ותגית cDNA (20 דקות)

  1. לפני תחילת, להביא את מגיב assay, דילול חיץ, וסטנדרטים RT במשך 30 דקות. הכן תערובת אב המכיל 1 μL של מגיב assay ו 199 μL של חיץ דילול לכל תגובה. Aliquot 199 μL של תערובת זו לתוך 500 צינורות assay μL. הוסף 1 μL של המדגם ומערבבים היטב.
  2. Aliquot 190 μL של תערובת הראשי צינור 1 & 2. הוסף 10 μL של תקן 1 כדי צינור 1 ו 10 μL של תקן 2 כדי צינור 2. וורטקס כל צינורות מדגם צינורות סטנדרטיים עבור 5 S; דגירה ב RT במשך 3 דקות.
  3. קביעת ריכוז של דגימות עם fluorometer רגישות גבוהה. ודא את כמות המדגם הנכון כבר קלט על ידי בחירת "חישוב פתרון המניות" אפשרות הדגשת "1 μL". לדלל כל מדגם בצינור 1.5 מ"ל נפרד לריכוז סופי של 0.2 ng / μL ב RNase חינם H 2 O.
    הערה:בעוד הוראות היצרן עולה כי אחד צריך להתחיל עם 1 ng / μL סך של DNA, השתמשנו כמות החל קטן יותר יש גם להתאים את הפרוטוקול כדי להסביר את התיקון הזה.
  4. ב 0.2 צינורות מ"ל חדש PCR, פיפטה 2.5 μL של חיץ 2. הוסף 1.25 μL של cDNA לצינור המתאים עבור סכום כולל של 250 pg. לבסוף, להוסיף 1.25 μL של תמהיל tagmentation לכל צינור פיפטה ביסודיות לערבב; טרנספוזאז בתוך תערובת תיוג יהיה לשבור את ה- DNA לגדילים קצרים anneal המתאמים את הקצה של כל גדיל, לשימוש מאוחר יותר על ידי מכשיר רצף.
    הערה: אמצעי האחסון המשמשים לתיוג ולצימוד לאינדקס הם חלק מהכמות המוצעת בהוראות היצרן. זה לא רק מאפשר שימור של ריאגנטים, אבל זה גם מייצר בעקביות דוגמאות מתויגות מניסיוננו.
  5. צנטריפוגה צינורות על microcentrifuge הדלפק במשך 1 דקות.
  6. מניחים את הצינורותב thermocycler מראש עם התוכנית הבאה: 55 מעלות צלזיוס למשך 10 דקות להחזיק ב 10 מעלות צלזיוס.
    הערה: אורך הדגירה הוא 10 דקות, לעומת 5 דקות המוצע מהוראות היצרן.
  7. מיד לאחר תוכנית זו תושלם, להסיר את צינורות להוסיף 1.25 μL של תיוג לנטרל חיץ לכל. פיפטה היטב לערבב דגירה ב RT במשך 5 דקות. השלם שלב זה מיד, כמו transposase נשאר פעיל עד למאגר מנטרל את האנזים ועוצר את התגובה.

10. מדד צימוד וטיהור (1 h)

הערה: לפני תחילת, להביא את חרוזי DNA למאגר resuspension ל RT לפחות 30 דקות. להחליט אילו מדדים להשתמש עבור כל אחד הדגימות.

הערה: מדדים אלה יצורפו 5 "ו 3" הקצוות המתאימים של ה- DNA מקוטעת לזיהוי דגימות הבאים רצף. ודא כי לא שנייםזוגות זהים עבור דגימות שניתן רצף יחד. לדוגמה, אם המדגם 1 ישתמש במדדים לבנים 1 וכתום 1, מדגם שני צריך להשתמש לבן 1 וכתום 2 או לבן 2 ותפוז 2, אבל לא את אותו שילוב של מדדים. ערכה זו מכילה 4 מדדים לבנים ו -6 כתומים שונים. כל השילובים האפשריים שונים מאפשרים עד 24 דגימות להיות משולב במסלול אחד רצף. למרות שאנו בדרך כלל רק 10 דגימות בריכה בנתיב, אפשר גם להשתמש בערכה המכילה 24 מדדים, אשר יאפשר קיבוץ של 96 דגימות בנתיב אחד של רצף, אם תרצה בכך.

  1. לכל צינור, להוסיף 1.25 μL של המדד השמאלי ו 1.25 μL של המדד הנכון למדגם מסוים. הוסף 3.75 μL של תערובת הורים PCR ו פיפטה גם לערבב.
  2. צנטריפוגה microcentrifuge הדלפק במשך 1 דקות.
  3. מניחים את צינורות thermocycler שחומם מראש עם התוכנית הבאה: 72 מעלות צלזיוס למשך 3 דקות; 95 מעלות צלזיוס למשך 30 שניות; 12 מחזורים של 9576; C במשך 10 שניות, 50 מעלות צלזיוס למשך 30 שניות, ו 72 מעלות צלזיוס למשך דקה 1; 72 מעלות צלזיוס למשך 5 דקות; ו להחזיק ב 4 ° C.
    הערה: הראשון 95 ° C צעד שונה מ 98 מעלות צלזיוס, אשר הוצע על ידי הוראות היצרן. כמו כן, פרטי המחזור הותאמו כך שהטמפרטורות ואורכי הזמן המותרים לתג האופטימלי של הדגימות שלנו. הסופי הדגירה C 72 מעלות נוספה גם פרוטוקול שלנו לא נכלל בהוראות היצרן.
  4. בקצרה לסובב את הצינורות כדי לאסוף את התוכן בתחתית. וורטקס חרוזי ה- DNA עבור 30 s, ולאחר מכן להוסיף 30 μL לצינור זה ומערבבים היטב על ידי pipetting.
  5. דגירה דגימות ב RT במשך 5 דקות.
  6. מניחים את הדגימות על מפריד מגנטי עבור 2 דקות. פיפטה supernatant למעלה ולמטה פעמיים דגירה דגימות במשך 1 דקות.
  7. הסר וזורקים את supernatant ברור. הוסף 150 μL של EtOH 80% לכל מדגם ולהסיר. חזור על שטיפת EtOH פעם אחת.
  8. לאפשר thדגימות אוויר לאוויר יבש במשך 10 דקות. בדוק לסירוגין כדי לראות אם EtOH כלשהו אספה בתחתית של צינורות להסיר לפי הצורך.
  9. לאחר סדק מתחיל להופיע גלולה חרוז DNA, להסיר את המדגם מן מפריד מגנטי ולהוסיף 27.5 μL של חיץ resuspension כדי לייבש את גלולה. ודא כי גלולה הוא resuspended לחלוטין, ולאחר מכן דגירה ב RT במשך 2 דקות.
    הערה: נפח המשמש למאגר resuspension שונה כדי להסביר את כמות קטנה יותר של חומר המוצא בפרוטוקול שלנו שונה מהנפח הציע בהוראות היצרן.
  10. מניחים את הצינורות על מפריד מגנטי במשך 2 דקות. העברת 25 μL של supernatant ברור לתוך צינור RNase חינם בחנות ב -20 מעלות צלזיוס.
    הערה: אל תמשיך בהוראות היצרן להשלמת נורמליזציה של הספרייה. הדגימות הוכנו בהצלחה לאחר שלב זה מוכנים מוכנים כמו רצף.
  11. לנתח את tאגמנטציה של דגימות באמצעות שבב bioanalyzer ו 1 μL של כל מדגם.
    הערה: ניתוח של כתמים יתבצע מוקדם יותר; עם זאת, cDNA צריך להיות מזוהה כעת בטווח גודל של 0.2-1 Kb ( איור 3 ). ריחות מתחת לנקודה זו עשויים לייצג את השפלה של דגימות, בעוד מריחות גדולות יותר מציעות תיוג חלקי.

11. מאגר של דוגמאות (10 דקות)

  1. השג ריכוזים של דגימות תיוג עם פלואורומטר רגישות גבוהה מ מוקדם יותר לקבוע את הריכוז ב- nm.
    הערה: חישוב זה יכול להיות מחושב עם השימוש בכלי ההמרה באינטרנט מסתמך על אורך השבר הממוצע מן ביואנליזה עקבות. כדי לקבוע את אורך השבר הממוצע, לבחון את עקבות עבור כל מדגם בנפרד ולקבוע את הגודל של קטע ה- DNA הממוצע. זה יכול להיות מחושב גם כאשר בוחנים את ביואנליזה עקבות על ידי הדגשת טווח של כתם ובדיקהE מולריות מחושב על ידי התוכנית.
  2. שלב דוגמאות כאלה הבריכה מכילה ריכוז זהה של כל מדגם. אין לדלל דגימות; הבריכה צריכה להיות רק כמו לדלל כמו המדגם הנמוך ביותר מרוכז יהיה אידיאלי יש ריכוז כולל של לפחות 15 ננומטר.
  3. אחסן את הדגימות שנאספו ב -20 מעלות צלזיוס לפני רצף; הוא הציע דגימות לעבור רצף בתוך שבוע 1 של איגום. בצע זוג בסוף, 100 רצף BP עם פלטפורמת HiSeq.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

סוגי תאים מסווגים בקלות בעקבות הזרקת צבע

איור 1 מציג דוגמה של RGC GFP + לפני ואחרי מילוי נותב ניאון. תא זה זוהה על בסיס הביטוי שלו של ה- GFP בקו מהונדס ( איור 1 א ). אטימה הדוקה נוצרה עם אלקטרודה עדינה, משושה, על סומה של התא הזה. על מנת לאפיין את תת סוג, צבע פלואורסצנטי הוזרק לתוך soma מותר למלא את כל התהליכים הקשורים ( איור 1 ב ). סיווג כמו ip4GR M4 התאפשר באמצעות תצפית כי תא זה יש סומה גדולה מאוד, כי התהליכים שלה לסיים בתוך sublamina ON של השכבה plexiform הפנימית ( איור 1 ג ). כמו איור של הבדלים ריבוד שניתן להבחין בהכנה רשתית מבודדת, מילאנו M1 (OFF-stratifyinז), M3 (bistratified), ו M4 (על ריבוד) ipRGCs עם נותב ניאון, קבוע אותם, וביצע הדמיה confocal של sublamina on ו- OFF ( איור 1D ). ויזואליזציה זו של הדנדריטים באמצעות הדמיה confocal דומה מאוד איך נראים הדנדריטים ב רקמות חוץ גופית כאשר תאים מלאים עם נותב פלואורסצנטי (שמידט ו Kofuji 2009, 2010, 2011).

CDNA ספריות מתא בודד

השימוש של אוליגו ד (T) תחל מאפשר לשעתוק סלקטיבי סלקציה הגברה של mRNA. לאחר יצירת והגברה של ספריות cDNA מכל תא, שבבי ביו-אנלייזר שימשו להערכת האיכות והגודל של הספריות. התוצאות של ניתוח זה מראים כי כתמים cDNA האידיאלי הם 0.5-2 Kb במדגם טוב ( איור 2 א ). כמה דוגמאות להראות כמה להקות או מריחות מתחת סימן 300 BP, sugמחווה כי ספריות אלה הם באיכות ירודה (ראה טבלה 1 לפתרון בעיות). דוגמה של עקבות bioanalyzer באיכות טובה מראה כמה או פחות להקות DNA מתחת 300bp ו כתם חזקים בין 500bp ו 2Kb (איור 2 ב). נתיבי בקרה ריקים צריכים להציג סמנים תחתונים וגבוהים ב 35 & 10380 bp, בהתאמה, כמו גם בסיס יציב כי לא להשתנות. ספריות שונות יכולות לייצר נתונים איכותיים, כפי שניתן לראות על ידי שני איור 2 ב ו 2C , אשר הפיק מעמקים לקרוא מעולה שיעורי מיפוי גבוהה. רק דגימות אלה עם ספריות cDNA חזקות בגודל הצפוי יש לבצע עד תיוג (ראה טבלה 1 לפתרון בעיות).

תיוג נמוך קלט מכין דוגמאות באיכות גבוהה עבור רצף

פרוטוקול זה מותאם במיוחד עבור tagmentation עם כמות קטנה של materia החל L. רק 250 pg עובד הכי טוב עבור תיוג מוצלח, כמו כמויות נמוכות לא להגביר כראוי כמויות גבוהות יותר לא יהיה קטע לחלוטין. לאחר השלמת תיוג ו PCR הגברה / מדגם ניקוי, הדגימות נותחו שוב על שבב bioanalyzer. CDNA האידיאלי מריח בנקודה זו צריכה להיות 0.2-1 Kb ( איור 3 א ). עקבות צריך להופיע חלקה מופץ באופן שווה בין שני גדלים ( איור 3 ב ); עקבות זה מתאים המדגם בנתיב 1. איור 3C מראה תיוג שלם, אשר ניתן לפתור בקלות (ראה טבלה 1 לפתרון בעיות). ביצענו ניתוח נתונים על דגימות ומצא כי פרוטוקול זה מיוצר דוגמאות עם עומק קריאה מעולה, לעתים קרובות עולה על 12 מיליון קורא לכל מדגם; ממוצעים של 69.1% מיפוי; ולמעלה מ -5,000 ביטויים של גנים.

/55229fig1.jpg "/>
איור 1: זיהוי של סוגי RGCs מבוסס על הביטוי GFP ב Melanopsin- להביע ipRGCs ועל נכסים מורפולוגיים. ( א ) שכבת תא גנגליון של הרשתית, דמיינו באמצעות IR-DIC בהכנה כולה הר הרשתית. ( ב ) הכנה זהה דמיינו epifluorescence (~ 480 ננומטר) כדי לזהות GFP- להביע תאים גנגליון. ( ג ) GFP- להביע תאים ממוקד עבור תיקון מהדק תיקון ומלא נותב ניאון. התא ניתן לזהות IPRGC M4 מבוסס על גודל soma גדול מאוד שלה על הדנדריטים stratifying 25 , 26 . ( D ) תמונה confocal של ipRGC dendrites הדמיה ב sub ו / או OFF של OFF של IPL (M1), ב sublamina ON של IPL (M4), וגם ב ON ו- OFF subliminae של ה- IPL (M3). IR-DIC: הפרעה דיפרנציאלית אינפרא-אדום..jpg.com / files / ftp_upload / 55229/55229 / 55229fig1large.jpg "target =" _ blank "> אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

איור 2
איור 2: ניתוח של איכות הספרייה cDNA עם מעקב Bioanalyzer. ( A) דוגמה פלט Bioanalyzer עבור דגימות מרובות אשר היו לאחור transcribed, מוגבר, מטוהרים. נתיבים 1-3 להראות את כתמי ה- DNA האידיאלי, עם רוב ה- DNA גדול מ 300 BP. ספריות עם כתמים בטווח זה סיפקו באופן עקבי נתונים רצף מעולה, מראה ממוצע של 5,683 גנים לידי ביטוי לכל תא. ליין 4 מייצג דגימה שלא עובדה בהצלחה ולכן לא יצרה cDNA. לנתיב הבקרה המוצלח יש קו בסיס קבוע ושני שיאים נקיים ב -35 ו -10,380 bp. ( ב ) דוגמה של עקבות bioanalyzer מוצלח עם עוצמה גבוהה של cDNA סביב 2 Kb. זה s Mear מתאים המדגם במסלול 1. ( ג ) דוגמה של עקבות bioanalyzer מוצלח עם cDNA מרוכז סביב 500 bp. עקבות זה מתאים המדגם במסלול 3. אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

איור 3
איור 3: דגימות מתויגות הצג ריחות חזקים בין 0.2 ל -2 ק"ג. ( A ) נציג לדוגמה bioanalyzer פלט הבאים תיוג, הגברה, ו- PCR לנקות. ( ב ) עקבות של מדגם מתויג בהצלחה המקביל לנתיב 1 ב (א). ( ג ) דוגמה של עקבות עבור מדגם עם תווית חלקית, ברור על ידי עוצמת שיא סביב 1 Kb."> אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

2 "> מדולל מדגם לריכוז של 0.4 ng / μL ותגובת rerun
בְּעָיָה סיבה אפשרית פִּתָרוֹן
שלב 3.3) לא ניתן ליצור חותמת GΩ משטח התא אינו נקי מספיק נקה עוד באמצעות לחץ חיובי
שלב 3.3) תא נראה לנפח / למות הכן פיפטה חדשה למקד תא חדש
שלב 3.4) לא ניתן לקבוע את מיקום המסוף של הדנדריטים Alexafluor לא היה מספיק זמן כדי לפזר בכל תא או ריכוז Alexafluor הוא לא מספיק גבוה בדוק כדי לוודא להרוויח זמן חשיפה על המצלמה הם גבוהים מספיק. המתן 5 דקות נוספות לפני הדמיית הדנדריטים. אם הדנדריטים עדיין אינם גלויים, להכין פתרון עם Alexafluor גבוההריכוז.
שלב 4.1) לא ניתן לשאוב את כל הציטופלסמה
שלב 5.5) Supernatant לא ברור לאחר 8 דקות בעדינות פיפטה הפתרון כולו פעמיים, בעוד עדיין על מפריד מגנטי, ולתת לשבת עוד 5 דקות
שלב 5.5) גלולה מתפזר במהלך pipetting המדגם רחוק מדי ממגנט שמור צינורות על מכשיר הפרדה מגנטי במהלך כל pipetting. לגרש פתרון ולאפשר חרוזים מחדש גלולה במשך 5 דקות
שלב 5.7) לאחר 5 דקות, דגימות עדיין נראה מבריק הסכום המרבי של EtOH לא הוסר המשך לעקוב אחר דגימות במהלך ייבוש. כל 2 דקות, להשתמש פיפטה P10 ולהסיר את כל EtOH בתחתית הצינור
שלב 8.9) גלולה היו סדקים לפני התייבשות אפשר מדגם rehydשיעור עבור סך של 4 דקות, במקום 2 (שלב 8.10)
שלב 8.11) כמות קטנה של חרוז הובא עם supernatant להוציא את כל המדגם בחזרה לתוך צינור במקום על מפריד מגנטי במשך 1 דקות; פיפטה בעדינות ולוודא כדי למנוע גלולה
שלב 8.12) DNA כתמי הם עקביים ואת היקף פלואורסצנטי משתנה ברציפות ריכוז DNA גבוה מדי בשבב HS בדוק ריכוז המדגם לדלל בין 1 - 10 ng / μL. Rerun bioanalyzer
שלב 8.12) נמוך מריחה משקל מולקולרי רנ"א הדרדרות ודא תא פלאש להקפיא מיד לאחר איסוף. מחק את הספריה cDNA
שלב 8.12) סמן מתפתל בתחילת נתיב הבקרה זיהום או מגיב הישן מחק סמן DNA ולהעסיק צינור חדש עבור Bioanalyzer לרוץ
שלב 8.12) אין כתם DNA אי-גירוש התא משוך מחטים חדשות עם קצה מעט גדול יותר
RNA חרוז כישלון ודא חרוזים בטוח כבר resuspended מלא לפני השימוש ולאפשר דגימות כדי לדגור לפני הצבת על מפריד מגנטי
שלב 8.12) חלש DNA כתם לא מספיק הגברה מעסיק יותר מחזורי PCR
שלב 8.12) DNA להריח מחוץ לטווח 500bp-2Kb ריחות DNA מתחת 0.5 ומעלה 2 Kb הם זיהום סביר. מחק מדגם
שלב 8.12) קבועים spikes על ד.נ. עקבות זיהום מדגם תמיד ללבוש כפפות טריות לעשות אתנול חדש עבור שטיפות; טיפים לסינון יש להשתמש בכל עת
שלב 9.3) לא ניתן לזהות ריכוז המדגם על fluorometer דוגמאות מתחת לרמת זיהוי יש מעט מדי DNA עבור tagmentation ולא ניתן להשתמש בהם
שלב 10.10) דוגמאות אינן יבשות לאחר 10 דקות המשך להסיר עודף EtOH אפשר דגימות כדי airdry יותר, לבדוק אותם כל דקות
שלב 10.13) מרחים מוטה לכיוון 2Kb פיצול חלקי Re- לדלל מדגם לריכוז של 0.15 ng / μL, ולא 0.2 ng / μL; - תיוג מחדש
שלב 10.13) למרוח מוטה לכיוון 200bp קלט DNA קטן מדי מדולל מדגם פחות, לנסות ריכוז של 0.4 ng / μL; - תיוג מחדש
תגובת תגובה ארוכה מדי להקטין את זמן התגובה של tagmentation ל 8 דקות
שלב 10.13) חלשים חלשים הגברה לא נכונה של דנ"א
שלב 11.2) ריכוז הבריכה המרבי הניתן להשגה נמוך מ -5 ננומטר לזהות אילו מדגם (ים) יש ריכוזים נמוכים באופן משמעותי ותגובת rerun עם דילול חדש

טבלה 1: פתרונות והצעות לעמידות פוטנציאליות בפרוטוקול. טבלה זו מפרטת קשיים פוטנציאליים העלולים להתרחש במהלך פרוטוקול זה ואת הצעדים בהם ניתן להיתקל בהם. טבלה זו מפרטת סיבות אפשריות עבור רבות מבעיות אלה, וכן פתרונות שעשויים לסייע בפתרון בעיות.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

הפרוטוקול שלנו מדגים, באמצעות מדריך מהיר וקל לשימוש, שיטה להכין תאים בודדים של שיעורים מורפולוגיים מזוהה עבור רצף באיכות גבוהה, עם פגיעה קטנה המדגם. בכתב היד הנוכחי, תאי הגנגליון ברשתית רגישים מבחינה גופנית מאופיינים באופן מורפולוגי, מבודדים ומוכנים ל- RNA-Seq. מדדים סלולריים עשויים להתרחש במהלך הטיפול ברשתית; מסיבה זו, אנחנו מחליפים כל פיסת רקמה לאחר לא יותר מ 4 שעות של שימוש. אנו יכולים להעריך את מצב התאים באמצעות המתקן electrophysiology להקליט תאים אלה כדי לפקח על תגובותיהם, אשר מאפשר לנו להבטיח כי התאים הם בריאים. פרוטוקול שלנו מותר עבור הדור של ספריות cDNA מוצלח מתוך 15 מתוך 23 דגימות מעובד, נותן שיעור הצלחה של 65%. יתר על כן, איכות הנתונים שלנו רצף היה מצוין, כמו המספר הממוצע של גנים לידי ביטוי על ידי התאים שלנו נע בין 2,316-10,353, עם ממוצע של 5,683גנים עם ערך FPKM לא אפס. מספרים אלה דומים ספירת גנים לידי ביטוי נמצא על ידי מחקרים אחרים של נוירונים 5 , מראה כי הנתונים שלנו הוא גם באיכות טובה.

אמנם היה לנו הצלחה עם פרוטוקול זה עבור נוירונים ספציפיים אלה, יש לציין כי תיקונים קלים טכניקה זו ניתן ליישם עבור מספר יישומים שונים. באמצעות פלואורסצנטי המופעל תאים סדרן (FACS) בתוך מודל העכבר נפרד, יש לנו מבודדים אוכלוסיות קטנות של תאים (1,000 -25,000) שכותרתו עם סמן GFP ממערכת העצבים המרכזית. RNA מאוכלוסיות אלה היה מבודד, ו 1 μL (ב או מעט מתחת 12 ng / μL) של RNA זה שימש כדי להתחיל את שעתוק לאחור בשלב 6.1. ההתאמה היחידה צריכה להיעשות לפרוטוקול לאחר שלב זה מתרחשת בשלב 7.4, שבו בשלב אחד ניתן לבחור להעסיק פחות מחזורי PCR. השתמשנו 19 מחזורים במקרים כאשר המדגם הראשוני הכיל gReater מ -10,000 תאים ומצאתי כי זה מייצר באיכות טובה cDNA ספריות. לדוגמה, דגימות תאים הוכנו מאוכלוסיית FACSorted, ומספר הגנים שהובעו נעה בין 12,340-14,052, עם ממוצע של 13,265 גנים עם ערך FPKM לא אפס. טכניקה זו יכולה להיות מיושמת על מודלים עכבר שונים אשר כתב פלואורסצנטי קיים. בשל תיקון זה, החוקרים יכולים ללמוד כל אוכלוסיית תאים שעבורו העכבר עיתונאי פלואורסצנטי זמין, הרחבת מחקרים מעבר לתחום של מגוון עצבי.

התאמת השני יכול להתבצע תאים פרופיל מבוסס על פונקציונליות ולא רק מורפולוגיה. פרויקט זה מסתמך על מודל מהונדס, אבל טכניקה זו יכולה להיות מיושמת על נוירונים ללא מזהה מזהים מולקולריים. לדוגמה, ישנם מעל 30 תת סוגים פונקציונליים של תאים גנגליון ברשתית מזוהה כיום 27 , מעטים מאוד מהם יש סמנים ייחודיים. כמו טכניקה זוכבר מסתמך על מתקן electrophysiology עבור מילוי תאים, אפשר להשתמש התיקון clamping לזהות פרופיל התגובה תפקודית של כל תא מבוסס על דפוס spiking שלה. שימוש בהקלטות אור ספייק קל, את הסיווג של נוירונים הרשתית ניתן לקבוע לפני בידוד התא. טכניקה זו פועלת על תאי הגנגליון ברשתית, אבל זה יכול להיות המורחבת לבחון נוירונים רשתית אחרים. יש לציין, עם זאת, כי אם פרוטוקול זה משמש להקליד תאים דו קוטביים או דו חמצני בשכבת הגרעין הפנימית, למשל, יש להיזהר לספק לחץ חיובי מתמיד בקצה האלקטרודה, כדי למנוע יצירת קשר עם תאים כמו אלקטרודה עובר דרך שכבת התא גנגליון שכבת plexiform הפנימית. עבור נוירונים ברשתית בתוך שכבת הגרעין הפנימית, הכנת קטעי הרשתית לפני הקלטות הסלולר סביר להניח לעבוד בצורה הטובה ביותר כדי למנוע באופן עקבי זיהום. כל תא יהיה מבודד ומוכן כפי שמתואר כאן בעקבות קלעשלב ssification. יתר על כן, אנו מציעים את השימוש בפרוטוקול זה עבור המחקר של נוירונים, אבל טכניקה זו עשויה להיות מיושמת על כל סוג התא כי ניתן מאופייני מורפולוגית או מבודדים באמצעות שימוש במודל מהונדס.

טכניקה זו יכולה גם להיות שונה לעבודה עם ספריות cDNA מוכן בעבר, כפי שהפקנו בעבר עבור הכלאה microarray 28 . עם ספרייה מוכנה בנפרד, אחד מתחיל עם כמויות cDNA בטווח של 50-150 ng ומתחיל את הפרוטוקול בשלב 8.4; ריכוזים גבוהים יותר ולא נמוכים יותר לא ניסו, למרות שהם עשויים לעבוד גם כן. טיהור של cDNA באמצעות חרוזי DNA יתרחש הראשון, ואחריו התגמול ואת הגברה PCR. בדקנו את זה הסתגלות עם cDNA מן ההכנות הספרייה, כגון אלה עבור הכלאה microarray 29 , ויש להם בהצלחה שיוצרו ספריות תיוג עבור RNA-Seq.

סְנַפִּירברית, פרוטוקול זה ניתן להשתמש בהערכת ההצלחה של אינדוקציה מסוימת של אוכלוסיות תאים מ המושרה Pluripotent תאי גזע (iPSCs). הכוח המניע מאחורי ההבחנה של תאים אלה pluripotent מחדש מתוכנת מחדש מסתמך על הבנה של גורמי שעתוק המוליכים סוגי תאים להתפתח בנפרד אחד מהשני. נהיגה iPSCs לעבר גורל תא מסוים היא שיטה חדשה לחקר מגוון עצבי, שכן ניתן להשתמש בו כדי ליצור באופן סלקטיבי סוגי תאים. פרוטוקול זה יכול להיות מותאם כדי להעריך את איכות הגיוון בין תאים מובחנים מן המודל הזה. כפי שצוין לעיל, ישנם יותר מ -30 תת סוגים פונקציונליים של תאים גנגליון ברשתית, ומאמצים רבים נעשו כדי לייצר RGCs תפקודית מ iPSCs. זיהוי של סמנים עבור תת סוגים של RGCs - במקרה שלנו, ipRGCs - יאפשר החוקר להעריך את ההצלחה של הפרוטוקול שלהם בהפקת subtypes שונים של RGCs. הערכה של סוגי תאיםבין נוירונים אלה ייהנו פרוטוקול זה עשוי לשמש גם כלי להמשך חקירה של סמנים ספציפיים משנה כמו מערכת מודל זה הופך להיות זמין.

בכתב היד הנוכחי אנו מתארים טכניקה פשוטה לבידוד ולהכנת תאים בודדים לניתוח תמלילי. יתר על כן, אנו מציעים דרכים לערוך את הפרוטוקול כך טכניקה זו יכולה לשמש עבור מספר רב של ניסויים עם מגוון של מטרות בראש. הפרוטוקול המתואר כאן היה מותאם פרוטוקול שתואר על ידי טרומבטה et al. 24 כהתאמה של הוראות ערכת מומלץ עבור קלט נמוך RNA-Seq. ההבדלים העיקריים נמצאים בתוך בידוד התא שינויים volumetric שונים שבחרנו כדי להתאים בצורה הטובה ביותר את הצרכים של הפרויקט הזה. חשוב להדגיש כי הצעד החשוב ביותר בפרוטוקול זה הוא בידוד של תאים מרקמת הרשתית. זו הנקודה בפרוטוקול durinG אשר רוב השגיאות יכול להתרחש, וזה צריך להתבצע בזהירות קפדנית ביותר. כל כמות של זיהום יכול לגרום דגימות שמיש, בעוד אובדן של ציטופלסמה עלולה לגרום דלדול חמור של מולקולות mRNA. צעד זה צריך להתבצע בזהירות עם אותו אדם מן הניסוי כדי הניסוי על מנת להבטיח כי דגימות טופלו במדויק.

לסיכום, פרוטוקול זה מתאר טכניקה לסיווג, בידוד, הכנת תאים באיכות גבוהה RNA-Seq. זוהי דרך יעילה, בעלות נמוכה יחסית כדי לייעל את איכות הנתונים מתאי יחיד. טכניקה זו היא צדדי וניתן לשנות באופן מינימלי ליישום למחקרים שונים.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

למחברים אין מה לחשוף.

Acknowledgments

ברצוננו להכיר בג'ניפר ביר ועינת שניר, כמו גם במכון האוניברסיטה לגנטיקה אנושית, על עזרתם בהכנת וטיפול בדגימות.

Materials

Name Company Catalog Number Comments
Ames' Medium Sigma Aldrich A1420-10X1L
Sodium Bicarbonate Sigma Aldrich S8875
K-gluconate Spectrum Chemical PO178
EGTA Sigma Aldrich E4378
HEPES Sigma Aldrich H3375
Diethyl pyrocarbonate (DEPC) Sigma Aldrich D5758
Alexa Fluor 594 Hydrazide Invitrogen A10442
Collagenase Worthington Biochemical  LS005273
Hyaluronidase Worthington Biochemical  LS002592
Petri dish (35 mm diameter) Thermo Fisher Scientific 153066
Ophthalmologic scissors Fine Science Tools 15000-00
#5 Forceps Fine Science Tools 11252-30
Microplate Shaker Fisher Scientific 13-687-708
Glass Micropipette Sutter BF120-69-10
Micropipette Puller Sutter P-1000 horizontal pipette puller
1 mL syringe Fisher Scientific 14-823-2F
Flexible tubing Fisher Scientific 14-171
TCL lysis buffer Qiagen 1031576 Lysis Buffer 1
β-mercaptoethanol Sigma Aldrich M3148
RNase-free Water Qiagen 129112
0.2 mL PCR tubes Eppendorf 30124359
Ethyl Alcohol, Pure Sigma Aldrich E7023 Ethanol
Analog Vortex Mixer Thermo Fisher Scientific 02215365 Vortex
Mini Centrifuge Thermo Fisher Scientific 05-090-100
Agencourt RNAClean XP Beads Beckman Coulter A63987 RNA magnetic beads
MagnaBlot II Magnetic Separator Promega V8351 Magnetic stand
1.5 mL MCT Graduated Tubes Thermo Fisher Scientific 05-408-129
Smart-Seq v4 Ultra Low Input RNA Kit Clontech 634888 Reagents for Reverse Transcription and PCR Amplification
10x Lysis Buffer Lysis Buffer 2
5x Ultra Low First-strand Buffer Buffer 1
3' SMART-Seq CDS Primer II A Primer II
SMART-Seq v4 Oligonucleotide Oligonucleotide
SMARTScribe Rverse Transcriptase Reverse Transcriptase (RT)
2x SeqAmp PCR Buffer PCR Buffer
PCR Primer II A PCR Primer
SeqAmp DNA Polymerase DNA Polymerase
Mastercycler pro S Eppendorf 950030020 Thermocycler
Agencourt AMPure XP Beads Beckman Coulter A63881 DNA magnetic beads
2100 Bioanalyzer Agilent Technologies G2939AA
HS Bioanalyzer Chips & Reagents Agilent Technologies 5067-4626
Qubit HS Assay Kit Thermo Fisher Scientific Q32851 For the calculation of sample concentrations
Qubit Assay Tubes Thermo Fisher Scientific Q32856
Qubit 2.0 Fluorometer Thermo Fisher Scientific Q32866
Nextera XT DNA Sample Preparation Kit Illumina FC-131-1024 Reagents for Tagmentation and Index Coupling
TD Buffer Buffer 2
ATM Tagmentation Mix
NT Buffer Tagmentation Neutralizing Buffer
NPM PCR Master Mix
Nextera XT Index Kit Illumina FC-131-1001 Indices for Tagmentation
N501 White 1
N502 White 2
N701 Orange 1
N702 Orange 2
HiSeq 2500 Illumina SY-401-2501 For completing sequencing of samples

DOWNLOAD MATERIALS LIST

References

  1. Austin, C., Cepko, C. L. Specification of Cell Fate in the Vertebrate Retina. Neural Cell Specif. 3, 139-143 (1995).
  2. Masland, R. H. The Neuronal Organization of the Retina. Neuron. 76, (2), 266-280 (2012).
  3. Rodieck, R. The First Steps in Seeing. Sinauer Associates, Inc. Sunderland, MA. (1998).
  4. Chiu, I. M., et al. Transcriptional profiling at whole population and single cell levels reveals somatosensory neuron molecular diversity. Elife. 3, e04660 (2014).
  5. Tasic, B., et al. Adult mouse cortical cell taxonomy revealed by single cell transcriptomics. Nat. Neurosci. 19, (2), 335-346 (2016).
  6. Trapnell, C. Defining cell types and states with single-cell genomics. Genome Res. 25, (10), 1491-1498 (2015).
  7. Zeisel, A., et al. Cell types in the mouse cortex and hippocampus revealed by single-cell RNA-seq. Science. 347, (6226), 1138-1142 (2015).
  8. Schmidt, T. M., Do, M. T. H., Dacey, D., Lucas, R., Hattar, S., Matynia, A. Melanopsin-Positive Intrinsically Photosensitive Retinal Ganglion Cells: From Form to Function. J. Neurosci. 31, (45), 16094-16101 (2011).
  9. Eberwine, J., Miyashiro, K., Kacharmina, J. E., Job, C. Local translation of classes of mRNAs that are targeted to neuronal dendrites. Proc. Natl. Acad. Sci. 98, (13), 7080-7085 (2001).
  10. Darmanis, S., et al. A survey of human brain transcriptome diversity at the single cell level. Proc. Natl. Acad. Sci. 112, (23), 7285-7290 (2015).
  11. Macosko, E. Z., et al. Highly Parallel Genome-wide Expression Profiling of Individual Cells Using Nanoliter Droplets. Cell. 161, (5), 1202-1214 (2015).
  12. Usoskin, D., et al. Unbiased classification of sensory neuron types by large-scale single-cell RNA sequencing. Nat. Neurosci. 18, (1), 145-153 (2015).
  13. Poulin, J. F., Zou, J., Drouin-Ouellet, J., Kim, K. Y. A., Cicchetti, F., Awatramani, R. B. Defining midbrain dopaminergic neuron diversity by single-cell gene expression profiling. Cell. Rep. 9, (3), 930-943 (2014).
  14. Gross, A., Schoendube, J., Zimmermann, S., Steeb, M., Zengerle, R., Koltay, P. Technologies for Single-Cell Isolation. Int. J. Mol. Sci. 16, 16897-16919 (2015).
  15. Lovatt, D., et al. Transcriptome in vivo analysis (TIVA) of spatially defined single cells in live tissue. Nat Methods. 11, (2), 190-196 (2014).
  16. Qiu, S., et al. Single-neuron RNA-Seq: Technical feasibility and reproducibility. Front. Genet. 3, (124), 1-8 (2012).
  17. Subkhankulova, T., Yano, K., Robinson, H. P. C., Livesey, F. J. Grouping and classifying electrophysiologically-defined classes of neocortical neurons by single cell, whole-genome expression profiling. Front. Mol. Neurosci. 3, (10), 1-11 (2010).
  18. Fuzik, J., et al. Integration of electrophysiological recordings with single-cell RNA-seq data identifies neuronal subtypes. Nat. Biotechnol. 34, (2), 175-183 (2016).
  19. Schmidt, T. M., Kofuji, P. An isolated retinal preparation to record light response from genetically labeled retinal ganglion cells. J. Vis. Exp. (47), e2367 (2011).
  20. Schmidt, T. M., Kofuji, P. Functional and morphological differences among intrinsically photosensitive retinal ganglion cells. J Neurosci. 29, (2), 476-482 (2009).
  21. Schmidt, T. M., Kofuji, P. Structure and Function of Bistratified Intrinsically Photosensitive Retinal Ganglion Cells in the Mouse. J Comp Neurol. 519, (8), 1492-1504 (2011).
  22. Schmidt, T. M., Kofuji, P. Differential cone pathway influence on intrinsically photosensitive retinal ganglion cell subtypes. J Neurosci. 30, (48), 16262-16271 (2010).
  23. Clontech Laboratories I. SMARTerTM Ultra Low RNA Kit for Illumina® Sequencing. (2013).
  24. Trombetta, J. J., Gennert, D., Lu, D., Satija, R., Shalek, A. K., Regev, A. Preparation of single-cell RNA-Seq libraries for next generation sequencing. Curr. Protoc. Mol. Biol. 4, (22), 1-17 (2014).
  25. Ecker, J. L., et al. Melanopsin-expressing retinal ganglion-cell photoreceptors: Cellular diversity and role in pattern vision. Neuron. 67, (1), 49-60 (2010).
  26. Schmidt, T. M., et al. A Role for Melanopsin in Alpha Retinal Ganglion Cells and Contrast Detection. Neuron. 82, (4), 781-788 (2014).
  27. Sanes, J. R., Masland, R. H. The Types of Retinal Ganglion Cells: Current Status and Implications for Neuronal Classification. Annu. Rev. Neurosci. 38, 221-246 (2014).
  28. Goetz, J. J., Trimarchi, J. M. Single-cell Profiling of Developing and Mature Retinal Neurons. J. Vis. Exp. e3824 (2012).
  29. Trimarchi, J. M., et al. Molecular Heterogeneity of Developing Retinal Ganglion and Amacrine Cells Revealed through Single Cell Gene Expression Profiling. J. Comp. Neurol. 502, 1047-1065 (2007).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics