망막 신경절 세포의 정의 된 서브 세트의 단일 세포 RNA-Seq

Neuroscience

Your institution must subscribe to JoVE's Neuroscience section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

여기에서, 우리는 단클론 성 전 사체의 단리 및 후속 특성 규명을 위해 연결 세포 유형을 분류하기위한 조합 접근법을 제시한다. 이 프로토콜은 성공적인 RNA 시퀀싱 (RNA-Seq)을위한 샘플 준비를 최적화하고 세포 다양성의 강화 된 이해를 위해 특별히 고안된 방법을 설명합니다.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Laboissonniere, L. A., Sonoda, T., Lee, S. K., Trimarchi, J. M., Schmidt, T. M. Single-cell RNA-Seq of Defined Subsets of Retinal Ganglion Cells. J. Vis. Exp. (123), e55229, doi:10.3791/55229 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

세포 유형별 마커의 발견은 세포 기능과 세포 이질의 기원에 대한 통찰력을 제공 할 수 있습니다. 최근 뉴런의 다양성에 대한 이해를 높이기 위해 발현이 세포의 여러 하위 집단을 정의하는 유전자를 확인하는 것이 중요합니다. 망막은 중추 신경계의 다양성 연구를위한 훌륭한 모델로, 여러 주요 세포 유형으로 구성되어 있습니다. 각 주요 부류의 세포에 대한 연구는 이러한 개체군의 동정을 용이하게하는 유전자 마커를 산출했다. 그러나, 세포의 여러 하위 유형이 각각의 주요 망막 세포 클래스 내에 존재하며, 이들 아형의 유형 중 일부는 형태 학적 또는 기능적 특징으로 특징 지어졌지만 유전 적 마커를 가지고있다. 개별 망막 아형에 대한 유전 적 마커에 대한 지식은 특정 시각 기능과 관련된 뇌 표적의 연구와지도 작성을 가능하게하고 유전자 네트워크에 대한 통찰력을 제공한다.세포 다양성을 유지하라. 아형의 유전 적 표지자를 확인하는 데 사용되는 현재의 방법은 서열 분석에 따른 세포 유형의 분류와 같은 단점을 가지고있다. 이는 데이터 분석에 대한 도전 과제이며 클러스터에 동일한 기능의 셀이 포함되도록하기 위해 엄격한 검증 방법이 필요합니다. 우리는 분리 및 시퀀싱 이전에 세포의 형태 및 기능을 확인하여 하위 유형별 마커를 쉽게 식별 할 수있는 기술을 제안합니다. 이 기술은 비 신경 세포 유형뿐만 아니라 사소한 변형이있는 희귀 한 세포 집단까지 확장 될 수 있습니다. 이 프로토콜은 우수한 품질의 데이터를 제공하며, 많은 라이브러리가 단일 셀에 대해 2,000 만 건 이상의 읽기 깊이를 제공합니다. 이 방법론은 Single-cell RNA-Seq이 제시하는 장애물 중 많은 부분을 극복하고 직접적이고 매우 효율적인 방법으로 세포 유형을 규명하고자하는 연구자에게 적합 할 수 있습니다.

Introduction

뉴런의 다양성은 중추 신경계, 특히 척수 망막에서 관찰되며 망막 전구 세포 1 , 2 , 3 의 한 집단에서 유래 한 1 개의 신경교 세포와 6 개의 신경 세포 유형으로 구성된 고도로 전문화 된 조직이다. 세포의 많은 아형들은 기능적으로, 형태 학적으로, 그리고 유 전적으로 분류 될 수 있습니다. 이 프로토콜의 목표는 세포 유형의 유전 적 다양성을 식별 가능한 기능적 및 / 또는 형태 학적 특성에 연결하는 것입니다. 세포의 분류를 위해 많은 유전자가 확인되었지만 많은 하위 유형은 전체 인구의 작은 부분을 대표하므로 특성화되지 않고 계속됩니다. 이러한 특정 아형 내에서의 유전자의 동정은 망막 내에서의 연결의 다양성에 대한 더 큰 이해를 가능하게 할 것이고, 다른 곳에서 신경 세포의 다양 화를 밝힐 수도있다. 부더구나, 단세포 연구는 새로운 세포 유형의 발견을 허용하며, 이는 전체 인구 중 낮은 수치로 인해 간과되었을지도 모르는 4 , 5 , 6 , 7 .

단일 세포 transcriptomics의 이점 중 하나는 특정 세포 아형을 정의하는 고유 마커 또는 마커의 조합을 발견 할 수 있다는 것입니다. 이것들은 다른 조작을 위해 그 세포 유형에 대한 유전자 접근을 얻기 위해 사용될 수 있습니다. 예를 들어, 우리는 photopigment melanopsin을 표현하는 망막 신경절 세포의 하위 집합의 세포 유형 특정 유전자를 특성화하기 위해이 프로토콜을 사용하고 있습니다. 망막 신경절 세포를 나타내는 멜라닌 신 (melanopsin)을 발현하는 세포에서 형광 마커를 사용하면 알려진 유전자의 발현으로 인해 이들 세포가 함께 모이기 때문에 이들 세포를 연구 할 수 있습니다. 흥미롭게도,이 세포 popu의 다섯 가지 알려진 아형이 있습니다마우스 망막 8에서 . 따라서, 각 유형의 세포에서 RNA를 분리하기 위해, 우리는 세포 분리 전에 각 아형을 확인하기 위해 형질 전환 모델 내에서 확립 된 형태 학적 분류를 사용했다. 이 기술은 조직 해리가 필요없는 세포의 특성화와 망막에서의 직접적인 분리를 가능하게합니다. 조직 해리없이 세포 내에서 스트레스 반응을 일으키고 절단 된 수상 돌기로 인한 오염을 유발할 수 있습니다.

RNA-Seq 방법이 계속 발전함에 따라 지난 몇 년 동안 수많은 새로운 기술이 밝혀졌습니다. 이 도구를 사용하면 4 , 7 , 10 , 11 , 12 , 13 번 문제에 접근하면서 최대의 셀 획득 및 비용 효율성을 극대화 할 수 있습니다. 그러나,이 기술은 우수한 디딤돌이었으며, 여전히이 프로토콜이 해결할 수있는 많은 장애물이 있습니다. 첫째, 현재의 많은 절차는 해리 된 조직으로부터 세포를 분리하고, 세포 분류를 결정하기 위해 주성분 분석 또는 사후 (post-hoc) 계층 적 클러스터링을 사용하려고 시도한다. 이러한 유형의 도구를 사용하여 하위 유형을 분류하면 신뢰할만한 결과를 얻을 수 없으며 기능성 세포 유형에 대한 유전 적 표지의 상관 관계에 대해이 데이터의 유효성을 검사하는 새로운 방법을 강요 할 수 있습니다. 다른 프로토콜에서 해리에 대한 요구 사항은 때때로 조직 손상을 초래할 수 있으며, 신경 프로세스가 절단되어 mRNA의 잠재적 손실을 초래할 수 있습니다. 또한, 해리 세포 준비에서 스트레스 반응은 이러한 세포의 transcriptomes 14 영향을 시작할 수 있습니다. 이 프로토콜은 격리 이전에 기능 세포 유형을 결정함으로써 이러한 문제를 극복하고, h망막 조직을 손상시키지 않으면 서 세포의 증식.

한 기술은 2014 년에 도입 되었고 생체 내 전 사체의 생체 내 분석으로 구성되었습니다 15 . 이 기술은 조직에 대한 기계적 파괴를 최소화하면서 전 사체의 검사를 허용하지만 매우 특이적인 기자 마우스를 사용하지 않고 전 사체를 검사하기 전에 조직 내 특정 세포 유형을 분류하는 능력이 부족합니다. 우리의 프로토콜은 특정 리포터를 필요로하지 않습니다. 왜냐하면 우리는 세포 충전 및 전기 생리학을 이용하여 격리 전에 세포를 특성화하기 때문입니다. 이 이전 프로토콜의 또 다른 한계는 특정 파장이 광활성 요소를 여기시키는 데 필요하다는 것인데, 우리 프로토콜은 형광 리포터와 형광 염료의 사용을 허용하고 있습니다.이 리포터와 형광 염료는 쉽게 사용할 수 있거나 각 실험실별로 개별적으로 선택할 수 있습니다. 아직도, 다른 실험실은 electr의 2 가지의 방법을 결혼했다세포 다양성 연구를위한 생리학 및 전이 학. 분리 이전에 세포의 기능을 특성화하기위한 패치 - 클램프 기록의 사용은 해리 된 뉴런 16에서 수행 되었고, 어떤 경우에는 이러한 연구를 위해 마이크로 어레이 분석 17 을 사용하기도했다. 이러한 접근법에서 동일한 합병증이 발생합니다. 조직 분해 또는 이용 가능한 프로브에 대한 시료의 하이브리드 화에 의존하는 마이크로 어레이 기술의 사용이 필요하기 때문입니다. 가장 최근의 진보 중 하나는 전체 뇌 조각에서 세포를 이해하기 위해 패치 클램프 녹음과 RNA-Seq 기술을 결합한 기술인 Patch-Seq의 개발이었습니다. 이 기술은 여기에 제시된 프로토콜과 유사하지만, 우리의 접근 방식은 조직이 세포의 건강을 유지하기 위해 그대로 유지된다는 것을 다시 한번 주목하는 것이 중요합니다. 여기서는 최적화를위한 프로토콜을 제시합니다.이는 RNA-Seq을 사용하여 높은 판독 깊이와 매핑 범위를 얻기 위해 고품질의 단일 세포 라이브러리를 생성합니다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

모든 절차는 Northwestern University의 기관 동물 관리 및 사용위원회 (IACUC)의 승인을 받았습니다.

1. 전기 생리학 솔루션 준비 (4 시간)

  1. 역삼 투 정제 된 H 2 O 999 mL에 디 에틸 피로 카보네이트 (DEPC) 1 mL를 첨가하여 0.1 % DEPC 처리 H 2 O를 만든다. 완전히 혼합하고 혼합물을 실온 (RT)에서 1 시간 동안 배양시킨다. 그런 다음 액체 순환에서 15 분 동안 DEPC 혼합 H 2 O를 고압 멸균합니다. DEPC 처리 H 2 O를 실온에서 냉각시킨다.
  2. Ames의 배지 1L과 중탄산 나트륨 1.9g (23mM)을 1L의 H 2 O에 섞어 세포 외 용액을 만듭니다. 세포 외 용액을 버블 링합니다.
    95 % O 2 / 5 % CO 2 로 유지하고 pH 7.3-7.4로 유지한다.
  3. 125 mM K-gluconate, 2 mM MgCl 2 , 10 mM EGTA, 10 mM HEPES 및 0.1 % DEPC 처리 된 H를 혼합하여 세포 내 용액을 생성한다2 O. -20 ° C에서 1 ML aliquots에 보관하십시오. 각 실험의 시작 부분에 형광 트레이서 10 μM을 추가합니다.
  4. 4.15 mL의 세포 외 용액에 10,000 단위의 콜라게나 제와 83 mg의 히알루로니다 제를 첨가하여 효소 용액을 만든다. 효소 용액은 -20 ° C에서 50 μL 나누어 져 저장해야합니다.

2. 망막 조직의 준비 (2 시간)

참고 :이 섹션의 모든 절차는 어두운 적색 조명 하에서 수행해야합니다

  1. 해부되기 최소 1 시간 전에 어둠 적응 동물. 희미한 적색 조명 하에서 모든 절차를 수행하십시오.
  2. 이산화탄소 질식으로 동물을 안락사시키고 이전에 산소가 공급 된 세포 외 용액이 담긴 페트리 접시에 안구를 적출하십시오.
  3. 바늘로 각막을 찔러 각막과 공막의 경계에서 안과 가위로 잘라서 잘라냅니다 19 .
  4. 렌즈를 사용하여 제거# 5 집게. 부드럽게 포셉로 공막에 눈물을 만들고 망막과 공막이 만나는 시신경을 절단하십시오. 조심스럽게 망막에서 공막 제거를 마칩니다.
  5. # 5 포 셉를 사용하여 투명한 유리를 제거하십시오; 한 번 제거하면 유리체는 포셉에 붙어 젤라틴 물질로 나타납니다. 망막을 반으로 썰어 (4 개 / 동물이 있도록) 사용하기 전까지 RT에서 산소가 공급 된 세포 외 용액에 저장하십시오.
  6. 기록 챔버에 조직을 장착 준비가되면, 산소화 된 세포 외 용액 500 μL로 희석 한 효소 용액에서 배양하기 위해 망막 조각을 놓습니다. 셰이커에서 실온에서 2 분 동안 페트리 접시에서 품어 라.
    1. 산소가 공급 된 세포 외 용액에서 망막 조각을 씻고 유리 바닥 기록 챔버에 조직을 놓습니다. 팁을 잘라내어 플라스틱 전달 피펫을 사용하여 망막이 조직에 손상을주지 않으면 서 전달되도록합니다.
  7. 사용ceps를 사용하여 photoreceptor layer가 아래를 향하게하여 조직을 조심스럽게 평평하게하십시오. 피펫을 사용하여 여분의 액체를 제거하십시오. 나일론 메쉬가있는 백금 링을 사용하여 조직을 고정시킵니다.
    참고 :이 방법은 또한 라벨 amacrine 및 양극성 세포에서 RNA를 분리하기 위해 조직을 준비하는 데 사용할 수 있습니다.
  8. 산소가 공급 된 세포 외 용액으로 챔버를 채우고 현미경 스테이지에 장착하십시오. 2 ~ 4 mL / min의 산소가 공급 된 세포 외 용액으로 조직을 관통시킵니다.

GFP + 망막 신경절 세포의 시각화 및 타게팅 (10 분)

참고 :이 섹션의 모든 절차는 어두운 적색 조명 하에서 수행해야합니다

  1. 시작하기 전에 마이크로 피펫 풀러 (micropipette puller)를 사용하여 전기 생리 학적 기록을 위해 유리 마이크로 피펫 (OD : 1.2 mm, ID : 0.69 mm)을 당깁니다. 전극에 대해 다음 프로토콜을 사용하십시오 (매개 변수는 원하는 저항과 목적을 달성하기 위해 적절히 조정해야합니다.풀러 및 다른 유리로 다양 함) : 열 : 램프 +10; 당기기 : 0; Vel : 23; 지연 : 1; 압력 : 500; 프로그램 루프 : 5 번. 팁의 직경이 ~ 1 μm이고 큰 셀을 타겟팅 할 때 2-4 MΩ, 작은 셀을 타겟팅 할 때 5-7 MΩ의 저항이 있는지 확인하십시오.
  2. 적외선 차동 간섭 대조 (IR - DIC) 광학 ( 그림 1A )을 사용하여 신경절 세포 레이어를 관찰하십시오. epifluorescence (~ 480 nm)를 사용하여 GFP + 망막 신경절 세포 (RGCs)를 확인하십시오 ( 그림 1B ).
  3. DIC에서 세포 내 솔루션으로 가득 피펫을 찾습니다. 약간의 양의 압력을 가하고 앰프의 모든 전압 오프셋을 제로로하십시오.
  4. GFP + 세포에 대한 유리 micropipette을 누르고 피펫과 세포막 사이에 GΩ 인감을 형성하는 부정적인 압력을 적용합니다. 테스트 전압 명령 단계 ( 예 : 5 mV)를 적용하여 씰 저항을 모니터링하십시오. 안정한 밀봉을 형성 한 후, n의 짧은 펄스를가함으로써 멤브레인을 파열시킨다전체 세포 접근을 얻기위한 압력.
  5. 형광 추적자를 채우기 위해 세포의 수상 돌기가 1-2 분 동안 기다리십시오.
    참고 : 세포는 epifluorescence ( 그림 1C )의 형태학을 검토하여 morphologically 입력하실 수 있습니다. melanopsin을 발현하는 RGCs의 경우, 내부 plexiform 층의 돌기 층화는 epifluorescent 조명 하에서 형광 추적자로 채워진 수상 돌기를 검사하고 ganglion 근처의 off sublamina (M1 ipRGCs)의 soma로부터 멀리 계층화 하는지를 결정함으로써 시각화된다 (M2 & M4 ipRGCs) 또는 둘 모두 (M3 ipRGCs)에 영향을 미칠 수 있습니다. soma 크기 (M4s는 다른 모든 ipRGC 아형에 비해 현저히 큰 somas를 가짐)와 결합 된이 관찰은 세포 유형 20 , 21 , 22의 확인을 허용 합니다. 따라서,이 기술은 RNA iso 전에 시험 관내에서 세포 유형의 동정을 허용한다준비. 이 방법은 수지상 형태 또는 세포 생리를 포함하는 다른 세포 유형 식별 프로토콜을 위해 변형 될 수있다.

4. 세포 분리 (2 분)

  1. 시작하기 전에 탁상용 미세 원심 분리기를 2,000 x g으로 설정하십시오. 1cc 주사기로 호스 (OD : 3/32 in, ID : 1/32 in)를 연결하여 시료 배출 장치를 준비하십시오.
  2. 얼음에 용해 버퍼와 1 % β - mercaptoethanol의 10 μL를 포함하는 장소 0.2 ML PCR 튜브. 피펫 팁을 씻어 DEPC - 처리 H 2 O를 포함하는 1 CC 주사기를 준비합니다. 샘플 수집 후 lysis buffer를 동결시키기 위해 드라이 아이스 용기를 준비하십시오.
  3. 조심스럽게 10 ML 주사기를 사용하여 부정적인 압력을 적용하여 세포 피펫의 세포질 콘텐츠를 추출; 가능한 경우 세포 기관을 포함하여 모든 세포질 함량을 추출해야한다.
    1. 크기가 감소하는 세포체를 시각화하여 DIC에서 추출을 모니터하십시오. 추출한 후 세포질 내용, 조직의 신중하게 피펫을 들어 올려 신속하게 솔루션에서 피펫을 제거합니다.
  4. 신속하게 헤드 - 스테이지 홀더에서 피펫을 제거하고 1 ML 주사기를 사용하여 DEPC - 치료 H 2 O로 피펫 팁을 짧게 씻어. 시료를 배출하기 위해 꽉 조이는 튜브를 통해 1 mL 주사기에 피펫을 연결하십시오.
  5. 즉시 0.2 ML PCR 튜브에 1 % 베타 - mercaptoethanol를 포함하는 용해 버퍼 1 10 μL에 세포를 추방.
    참고 : 세포와 함께 전체 aspirate는 거품을 유입시키지 않도록 부드럽게 배출해야합니다.
    1. 튜브를 탁상 형 미니 원심 분리기에 2,000 xg에서 10 초간 간단히 원심 분리하십시오. 드라이 아이스로 5 분간 샘플을 즉시 플래시 동결하십시오. 동결 후 최상의 결과를 위해 최대 2 주 동안 -80 ° C에서 보관하십시오. 샘플은 더 오래 지속될 수 있지만 가능한 빨리 처리하는 것이 좋습니다.
RNA 정제 (30 분)

  1. 시작하기 전에 뒤집힌 P20 또는 P200 팁 홀더의 상단 부분을 96- 웰 마그네틱 스탠드 23 에 테이프로 고정하여 자기 분리 장치를 설치하십시오.
  2. 신선한 70 % 에탄올 (EtOH)을 준비하십시오 - 샘플 당 약 1 mL로 충분합니다. 4 ° C 보관에서 RNA 자석 구슬을 제거하고 적어도 30 분 RT에서 해동.
    참고 :이 프로토콜의 많은 단계는 효율성과 신속한 처리에 의존하기 때문에 한 번에 최대 8 개의 샘플을 처리 할 수 ​​없습니다.
  3. 일단 자기 구슬이 실온에있게되면, 용액이 잘 섞여 있는지 30 초 동안 볼텍스하십시오.
    참고 : 비드는 RNA에 선택적으로 결합하는 RNA 특이 적 완충제를 사용하며, 자성 플레이트 스탠드와 함께 사용할 경우 다른 세포 낭성 물질을 제거 할 수 있습니다.
  4. RT에서 1 분 동안 세포를 해동시킨 다음 각 샘플에 RNase가없는 H 2 O 5 μL를 첨가하십시오. 피펫 위아래. 각 튜브와 pipett에 RNA 비즈 22 μL를 추가e를 철저히 섞어 라. RNA가 상호 작용하고 자기 구슬과 바인딩 수 있도록 RT에서 샘플을 품어 5 분.
  5. 튜브를 자기 분리 장치에 놓고 8 분 동안 그대로 두십시오. 계속하기 전에 상층 액이 깨끗한 지 확인하십시오. 한 펠릿에서 구슬을 관찰하고 pipetting 동안 분리하지 않도록하십시오.
  6. 샘플에서 뜨는을 제거하고 70 % EtOH 150 μL를 추가합니다. EtOH를 제거하고 두 번 더 세탁을 반복하십시오.
  7. 샘플을 6 분 동안 공기 건조시킵니다. EtOH가 튜브의 바닥에 모아 졌는지 간헐적으로 확인하십시오. 적절하게 제거하십시오.
  8. 시료가 건조되는 동안 19㎕의 용해 완충액 2와 1㎕의 RNase Inhibitor (40U / μL)를 혼합하여 10X 반응 완충액을 준비하십시오. 간단히 회전시키고 얼음 위에 올려 놓으십시오.
  9. 샘플이 건조하고 비드 알갱이가 더 이상 광택이 보이지 않으면 자성 분리기에서 튜브를 꺼내고 9.5 μL의 RNase-free H 2 O샘플을 다시 수화합니다. 얼음에 샘플을 놓고 각 샘플에 10x 반응 버퍼 1 μL를 추가합니다.

6. 역전사 (10 분)

참고 : 시작하기 전에 얼음에 역전사 (RT; 효소를 제외하고)를 위해 필요한 시약을 녹입니다. 여기에는 프라이머 II, 완충액 1, 올리고 뉴클레오티드 및 RNase 억제제가 포함됩니다.

  1. 각 튜브에 2μL의 프라이머 II (AAGCAGTGGTATCAACGCAGAGTACT (30) N -1 N, N -1 은 A, C 또는 G가 될 수 있고 N은 A, C, G 또는 T, 12 μM이 될 수 있음)를 첨가하십시오. 72 ° C에서 3 분간 예열 된 thermocycler에 튜브를 넣으십시오.
  2. 배양하는 동안 RT 마스터 믹스를 준비하십시오. 각각의 반응에 대해 완충액 1 (250 mM Tris-HCl, pH 8.3, 375 mM KCl, 30 mM MgCl 2 ) 4 μL, 올리고 뉴클레오타이드 (48 μM) 1 μL 및 RNase 억제제 (40 U / μL).
  3. 부화 직후에 튜브를2 분 동안 얼음.
  4. 마스터 믹스와 피펫으로 역전사 효소 (100 U / μL)의 반응 당 2 μL를 철저히 첨가하십시오. 각 튜브에 7.5 μL의 마스터 믹스를 첨가하고 부드럽게 피펫 팅하여 혼합하십시오. 짧게 내용물을 수집하기 위해 튜브를 회전시키고 다음 프로그램을 사용하여 예열 된 열 순환기에 넣으십시오 : 42 ° C에서 90 분, 70 ° C에서 10 분간, 그리고 4 ° C에서 멈춤.
  5. 계속하기 전에 -20 ° C / N에 튜브를 보관하십시오. 장기간 보관하기 전에 샘플을 증폭 단계로 옮기는 것이 좋습니다. 다른 소식통은 4 ° C에서의 O / N 저장이이 단계 24 에서도 받아 들여질 수 있다고 제안했다.

cDNA 증폭 (2.5 시간)

참고 : 시작하기 전에 PCR 버퍼와 PCR 프라이머를 얼음 위에서 녹이고 PCR 마스터 믹스를 만들기 전에 탁상 미니 원심 분리기에서 튜브를 회전 시키십시오.

  1. 각 반응에 대하여, pPCR 완충액 25 μL, PCR 프라이머 (12 μM) 1 μL, DNA 중합 효소 1 μL 및 핵산 분해 효소가없는 H 2 O 3 μL가 들어있는 PCR 마스터 믹스를 다시 채 웁니다. 추가하기 직전에 DNA 중합 효소를 마지막으로 첨가하십시오 마스터 믹스를 샘플에 적용합니다.
  2. 각 튜브에 30 μL의 마스터 믹스를 첨가하고 10 초 동안 2,000 xg으로 스핀하여 튜브의 바닥에서 내용물을 수집합니다.
  3. 다음 프로그램과 함께 예열 thermocycler에 튜브를 놓으십시오 : 1 분 95 ° C; 98 ℃에서 10 초, 65 ℃에서 30 초, 및 68 ℃에서 3 분의 34 사이클; 72 ℃에서 10 분; 4 ℃에서 유지.
    참고 :이 PCR의 사이클 수는 제안 된 제조업체의 지침과 달리 34로 증가되었습니다. 반복 테스트 후이 사이클 번호는 지속적으로 안정적인 결과를 산출하는 것으로 확인되었습니다.
  4. 진행하기 전에 최대 1 년 동안 -20 ° C에서 튜브를 보관하십시오.

8. 증폭 된 cDN의 정제A (30 분)

  1. 정화를 시작하기 전에 적어도 30 분 동안 DNA 비드 및 용리 완충액을 실온으로 가져온다. 신선한 80 % EtOH를 준비하십시오; 1 mL 당 1 mL로 충분합니다. 각 샘플에 10X 용해 버퍼 1 μL를 추가합니다.
  2. 30 초 동안 DNA 비즈를 와동시키고 각 샘플에 DNA 비즈 50 μL를 첨가한다. pipetting으로 철저히 섞어 준 다음, 2,000 xg에서 10 초 동안 짧게 돌립니다. 8 분 RT에서 튜브를 품어.
  3. 튜브를 자기 분리 장치에 5 분 동안 놓습니다. 부드럽게 상청액을 위아래로 두 번 피펫 팅하고 샘플을 2 분 동안 앉게하십시오. 샘플이 자기 장치에있는 동안, 뜨는 물을 제거하고 버린다.
  4. 각 샘플에 새로 만든 80 % EtOH 150 μL를 넣고 30 초 동안 RT에 놓습니다. EtOH를 제거하고 EtOH 세척을 한 번 반복하십시오.
  5. 샘플을 잠시 회전시키고 1 분 동안 자기 분리기에 다시 올려 놓습니다. 남은 EtOH를 제거하고 샘플을 5 분 동안 공기 건조시킵니다.
  6. 구슬 펠렛이 더 이상 광택이 보이지는 않지만 균열이 나타나기 전에 자기 분리기에서 튜브를 꺼내고 용리 완충액 17 μL를 넣으십시오. 부드럽게 구슬을 완전히 resuspend 위아래로 피펫.
  7. resuspended 샘플을 2 분 RT에서 품어.
  8. 샘플을 간단히 회전시켜 바닥에있는 모든 액체를 모으고 2 분 동안 자기 분리기에 놓습니다. 15 mL의 깨끗한 상등액을 1.5 mL RNase-free tube에 옮기고 -20 ° C에 보관하십시오.
  9. cDNA 1 μL를 사용하여 고감도 생체 분석기 칩으로 cDNA 라이브러리의 품질과 크기를 검사합니다. cDNA 라이브러리의 이상적인 크기는 0.3-2 Kb이며, 농도는 적어도 10 ng / μL입니다 ( 그림 2 ).
    참고 : 샘플 pr으로 진행하기 전에 알려진 마커의 발현을 확인하기 위해 샘플을 스크리닝하는 방법으로 PCR을 채택 할 수 있습니다eparation.

9. 농도 및 Tagment cDNA 결정 (20 분)

  1. 시작하기 전에 분석 시약, 희석 버퍼 및 표준을 30 분 동안 실온으로 가져온다. 1 μL의 분석 시약과 199 μL의 희석 완충액이 포함 된 마스터 믹스를 반응마다 준비하십시오. 500 μL 분석 튜브에이 혼합물 199 μL를 나누어주십시오. 1 μL의 시료를 넣고 철저하게 혼합합니다.
  2. 분주 한 190 μL의 마스터 믹스를 튜브 1 & 2에 넣습니다. 10 μL의 표준 1을 튜브 1에 넣고 10 μL의 표준 2를 튜브 2에 넣습니다. 모든 샘플 튜브와 표준 튜브를 5 초 동안 보텍스합니다. 3 분 동안 실온에서 배양한다.
  3. 고감도 형광 측정기로 시료의 농도를 결정하십시오. "calculate stock solution"옵션을 선택하고 "1 μL"을 강조 표시하여 올바른 샘플 양을 입력했는지 확인하십시오. RNase-free H 2 O에 최종 농도가 0.2 ng / μL가되도록 별도의 1.5 mL 튜브에 희석한다.
    노트:제조업 자의 지시에 따라 1ng / μL의 총 DNA로 시작해야한다고 제안되어 있지만, 우리는 더 작은 시작 량을 사용했으며이 개정안을 설명하기 위해 프로토콜을 조정했습니다.
  4. 새로운 0.2 ML PCR 튜브에서 피펫 2.5 μL 버퍼 2. 총 250 PG에 대한 적절한 튜브에 cDNA의 1.25 μL를 추가합니다. 마지막으로, 혼합하기 위해 철저히 각 튜브와 피펫에 1.25 μL의 tagmentation 믹스를 추가하십시오; tagmentation mix 내의 transposase는 DNA를 짧은 가닥으로 절단하고 어댑터를 각 strand의 한쪽 끝으로 어닐링하여 나중에 sequencing instrument에서 사용할 수 있습니다.
    NOTE : tagmentation과 index coupling에 사용되는 볼륨은 제조자의 지시에 의해 제시된 양의 일부분이다. 이것은 시약의 보존을 허용 할뿐만 아니라 우리의 경험에서 일관되게 tagmented 샘플을 생산해 냈습니다.
  5. 1 분 동안 싱크대에 microcentrifuge에 튜브를 원심 분리기.
  6. 튜브 놓기다음과 같은 프로그램으로 예열 thermocycler에서 : 55 ° C 10 분 및 10 ° C에서 개최.
    참고 :이 부화의 길이는 제조사의 지침서에서 제안 된 5 분과는 반대로 10 분입니다.
  7. 이 프로그램이 완료되면 즉시 튜브를 제거하고 각각에 tagmentation 중화 버퍼 1.25 μL를 추가합니다. 5 분 동안 RT에서 혼합하고 배양하기에 충분하게 피펫을 넣는다. transposase가 효소를 중화하고 반응을 멈출 때까지 활성 상태를 유지하므로이 단계를 즉시 완료하십시오.

인덱스 커플 링 및 정제 (1 시간)

참고 : 시작하기 전에 적어도 30 분 동안 DNA 비드 및 resuspension 버퍼를 RT로 가져 오십시오. 각 샘플에 사용할 색인을 결정하십시오.

참고 :이 색인은 시퀀싱 후 샘플 식별을 위해 조각난 DNA의 각 5 '및 3'말단에 부착됩니다. 2 명pairings은 함께 시퀀싱 될 수있는 샘플에 대해 동일합니다. 예를 들어 표본 1이 흰색 1과 오렌지 1 색인을 사용하면 표본 2는 흰색 1과 주황색 2 또는 흰색 2와 주황색 2를 사용해야하지만 동일한 색인 조합은 사용하지 않아야합니다. 이 키트에는 4 개의 별개의 흰색과 6 개의 별개의 오렌지 인덱스가 들어 있습니다. 가능한 모든 조합으로 최대 24 개의 샘플을 하나의 시퀀싱 레인에 저장할 수 있습니다. 우리는 일반적으로 차선에 10 개의 시료만을 채우지 만 24 개의 색인을 포함하는 키트를 사용할 수 있습니다. 원하는 경우 단일 레인의 순서대로 96 개의 시료를 풀링 할 수 있습니다.

  1. 각 튜브에 특정 표본에 대해 1.25 μL의 왼쪽 색인과 1.25 μL의 오른쪽 색인을 추가하십시오. 3.75 μL의 PCR 마스터 믹스를 첨가하고 잘 혼합합니다.
  2. 1 분 동안 싱크대 마이크로 원심 분리기에서 원심 분리기.
  3. 다음 프로그램과 함께 예열 thermocycler에 튜브를 놓습니다 : 3 분 72 ° C; 95 ℃에서 30 초; 95 사이클 12 회76 ℃, 10 초 C, 30 초 50 ℃, 1 분 72 ℃; 72 ℃에서 5 분; 4 ℃에서 유지.
    참고 : 처음 95 ° C 단계가 제조업체의 지침에 따라 제안 된 98 ° C에서 변경되었습니다. 또한 사이클 세부 사항은 온도와 시간 길이가 샘플의 최적의 태그 지정을 허용하도록 조정되었습니다. 최종 72 ° C 배양도 우리의 프로토콜에 추가되었으며 제조 업체의 지침에 포함되지 않았습니다.
  4. 튜브를 살짝 돌려서 내용물을 수집합니다. 30 초 동안 DNA beads를 휘젓고 각 튜브에 30 μL를 넣고 pipetting으로 철저히 섞는다.
  5. 5 분 동안 RT에서 샘플을 품어.
  6. 샘플을 자기 분리기에 2 분 동안 놓습니다. 상청액을 위 아래로 두 번 피펫 섞고 1 분 동안 표본을 부화시킨다.
  7. 깨끗한 상층 액을 제거하고 버린다. 각 샘플에 80 % EtOH 150 μL를 넣고 뺍니다. EtOH 세척을 한 번 반복하십시오.
  8. 허용샘플을 10 분 동안 공기 건조시켰다. EtOH가 튜브 바닥에 모아 졌는지 간헐적으로 확인하고 필요하면 제거하십시오.
  9. 균열이 DNA 비드 펠렛에 나타나기 시작하면 자성 분리기에서 샘플을 꺼내어 27.5 μL의 resuspension buffer를 넣어 펠렛을 재 수화하십시오. 펠렛이 완전히 resuspended 있는지 확인하고 2 분 RT에서 품어.
    참고 : resuspension 버퍼에 사용 된 볼륨은 프로토콜에서 시작 물질의 작은 금액을 설명하기 위해 수정되었으며 제조 업체의 지침에 제안 볼륨과 다릅니다.
  10. 2 분 동안 자기 분리기에 튜브를 놓습니다. 깨끗한 상등액 25 μL를 RNase-free tube에 옮기고 -20 ° C에서 보관하십시오.
    참고 : 라이브러리 정규화를 완료하려면 제조업체의 지침을 따르지 마십시오. 샘플은이 단계에 따라 성공적으로 준비되며 그대로 시퀀싱을 준비합니다.
  11. 분석하기bioanalyzer 칩과 각 샘플 1 μL를 사용하여 샘플의 agmentation.
    참고 : 얼룩의 분석은 이전에 수행됩니다; 그러나 cDNA는 이제 0.2-1 Kb의 크기 범위에서 검출되어야합니다 ( 그림 3 ). 이 지점 아래의 얼룩은 샘플의 품질 저하를 나타내는 반면 큰 얼룩은 불완전한 태미 네이션을 나타냅니다.

11. 샘플 풀링 (10 분)

  1. 고감도 형광 측정기로 초기에 tagmentation 샘플의 농도를 구하고 농도를 nM 단위로 결정하십시오.
    참고 :이 계산은 인터넷 변환 도구를 사용하여 계산할 수 있으며 생체 분석기 추적의 평균 단편 길이에 의존합니다. 평균 조각 길이를 결정하려면 각 샘플에 대한 추적을 개별적으로 관찰하고 평균 DNA 단편의 크기를 결정하십시오. 이것은 또한 스미어의 범위를 강조하고 th를 조사함으로써 생체 분석기 트레이스를 조사 할 때 계산 될 수있다프로그램에 의해 계산 된 몰 농도.
  2. 풀이 같은 농도의 각 샘플을 포함하도록 샘플을 결합하십시오. 샘플을 희석하지 마십시오. 풀은 가장 농도가 낮은 시료와 같이 희석되어야하며 이상적으로는 적어도 15nM의 총 농도를 가져야합니다.
  3. 시퀀싱하기 전에 풀링 된 샘플을 -20 ° C에 보관하십시오. 샘플을 풀 한 후 1 주 이내에 시퀀싱하는 것이 좋습니다. 하이 엔드 (HiSeq) 플랫폼으로 쌍방향 100 bp 시퀀싱을 수행합니다.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

세포 유형은 염료 주입에 따라 쉽게 분류됩니다.

그림 1 은 형광 추적 충전 전후의 GFP + RGC의 예를 보여줍니다. 이 세포는 유전자 변형 라인 ( 그림 1A )에서 GFP의 표현에 따라 확인되었습니다. 견고한 씰이이 셀의 소마 (soma) 위에 미세 팁의 인발 유리 전극으로 형성되었습니다. 아형을 특성화하기 위해, 형광 염색약은 체세포에 주입되어 모든 관련 공정을 채웠다 ( 그림 1B ). M4 ipRGC의 분류는이 세포가 매우 큰 세포를 가지고 있으며 그 과정이 내부 plexiform 층의 ON 하위 세포 내에서 종결된다는 관찰을 통해 가능하게되었습니다 ( 그림 1C ). 고립 된 망막 제제에서 식별 할 수있는 계층화의 차이를 보여주는 예로 M1 (OFF-stratifying), M3 (bistratified), M4 (on-stratifying) ipRGC를 형광 추적 장치로 고정시키고, ON과 OFF 서브 라미네이의 공 초점 이미징을 수행 하였다 ( 그림 1D ). 공 촛점 이미징을 통한 수상 돌기의 시각화는 세포가 형광 추적자 (Schmidt and Kofuji 2009, 2010, & 2011)로 채워질 때 수상 돌기가 고정되지 않은 시험관 조직 에서 보이는 것과 매우 유사합니다.

단일 세포의 cDNA 라이브러리

올리고 d (T) 프라이머의 사용은 mRNA의 선택적 역전사 및 증폭을 허용한다. 각 세포로부터 cDNA 라이브러리를 생성하고 증폭시킨 후, 생물학적 분석기 칩을 사용하여 라이브러리의 품질과 크기를 평가했다. 이 분석의 결과는 이상적인 cDNA 얼룩이 좋은 샘플에서 0.5-2 Kb임을 보여줍니다 ( 그림 2A ). 일부 샘플은 300 bp 이하의 밴드 또는 얼룩을 보여줍니다. sug이러한 라이브러리의 품질이 좋지 않음을 확인하십시오 (문제 해결을 위해 표 1 참조). 양질의 생체 분석기 트레이스의 예는 300bp 이하의 DNA 밴드가 거의 없거나 500bp와 2Kb 사이의 견고한 얼룩을 보여줍니다 (그림 2B). 빈 컨트롤 레인은 각각 35 & 10380bp의 낮은 쪽과 높은 쪽 마커를 표시해야하며 변동이없는 안정된 기준선을 표시해야합니다. 그림 2B2C 에서 볼 수 있듯이 다양한 라이브러리가 우수한 데이터를 생성 할 수있어 뛰어난 판독 깊이와 높은 매핑 속도를 제공합니다. 예상되는 크기의 cDNA 라이브러리가있는 샘플 만이 꼬리표 부착으로 옮겨 져야합니다 (문제 해결을 위해 표 1 참조).

낮은 입력 tagmentation은 시퀀싱을위한 고품질 샘플을 준비합니다.

이 프로토콜은 소량의 시작 물질로 tagmentation에 최적화되어 있습니다. 엘. 더 낮은 양은 적절하게 증폭되지 않고 더 높은 양은 완전히 단편화되지 않기 때문에 단지 250 pg가 성공적인 tagmentation을 위해 가장 잘 작동합니다. tagmentation 및 PCR 증폭 / 샘플 청소를 완료 한 후, 샘플을 다시 bioanalyzer 칩에서 분석했습니다. 이 시점에서 이상적인 cDNA 얼룩은 0.2-1 Kb이어야합니다 ( 그림 3A ). 추적은 두 가지 크기 ( 그림 3B ) 사이에서 부드럽게 균등하게 분포해야합니다. 이 추적은 레인 1의 샘플에 해당합니다. 그림 3C 는 불완전한 태깅을 보여 주며 쉽게 해결할 수 있습니다 (문제 해결을 위해 표 1 참조). 우리는 샘플에 대한 데이터 분석을 수행하여이 프로토콜이 우수한 판독 깊이의 샘플을 생성하고 종종 샘플 당 1,200 만 건의 읽기를 능가하는 것으로 나타났습니다. 평균 69.1 % 매핑; 5,000 개 이상의 유전자를 발현한다.

/55229fig1.jpg "/>
그림 1 : Melanopsin을 발현하는 ipRGCs 및 형태 학적 특성에서 GFP 발현에 기초한 RGCs 유형의 동정. ( A ) 전체 마운트 망막 준비에 IR-DIC를 사용하여 시각화 망막의 신경절 세포 레이어. ( B ) 동일한 준비는 GFP - 표현 ganglion 세포를 식별 epifluorescence (~ 480 nm의)에서 시각. ( C ) 패치 - 클램프 기록을 목표로하고 형광 추적기로 채워진 GFP 발현 세포. 세포는 매우 큰 소마 크기와 ON 층별 수상 돌기를 기반으로하는 M4 ipRGC로 확인 될 수 있습니다 25 , 26 . ( D ) IPL (M1)의 ON 및 / 또는 OFF 하위 부작용, IPL (M4)의 ON 하위 망막 및 IPL (M3)의 ON 및 OFF 부작용 모두에서 이미지화 된 ipRGC 수상 돌기의 공 초점 이미지. IR-DIC : 적외선 차동 간섭 대비..jove.com / files / ftp_upload / 55229 / 55229fig1large.jpg "target ="_ blank ">이 그림의 확대 버전을 보려면 여기를 클릭하십시오.

그림 2
도표 2 : Bioanalyzer 자취를 가진 cDNA 도서관 질의 분석. ( A) 역전사, 증폭 및 정제 된 여러 샘플에 대한 Bioanalyzer 출력 예. 레인 1 ~ 3은 이상적인 DNA 얼룩을 보여 주며 대다수의 DNA는 300bp보다 큽니다. 이 범위의 스미어가있는 라이브러리는 일관된 탁월한 시퀀싱 데이터를 제공하여 세포 당 평균 5,683 개의 유전자를 나타냅니다. 레인 4는 성공적으로 처리되지 않아 cDNA가 생성되지 않은 샘플을 나타낸다. 성공적인 제어 레인은 일정한 기준선과 35 및 10,380 bp에서 2 개의 깨끗한 최고점을가집니다. ( B ) 약 2Kb 정도의 높은 강도의 cDNA를 가진 성공적인 생물 분석기 추적의 예. 이것 이야말로 mear는 레인 1의 샘플에 해당한다. ( C ) 500bp 주위의 cDNA 중심의 성공적인 바이오 분석기 트레이스의 예. 이 추적은 레인 3의 샘플에 해당합니다.이 그림의 확대 버전을 보려면 여기를 클릭하십시오.

그림 3
그림 3 : Tagmented Samples 0.2와 2 Kb 사이의 강한 얼룩. ( A ) tagmentation, 증폭, PCR clean-up 후에 대표적인 bioanalyzer 산출물. ( B ) (A)의 레인 1에 해당하는 성공적으로 꼬리표를 붙인 표본의 추적. ( C ) 불완전한 태미 네이션 (tagmentation)을 갖는 샘플에 대한 트레이스의 예로서, 약 1Kb의 피크 강도에 의해 클리어된다.">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

2 "> 시료를 0.4 ng / μL의 농도로 희석하고 tagmentation을 다시 실행하십시오
문제 가능한 원인 해결책
단계 3.3) GΩ 씰을 형성 할 수 없음 세포 표면이 충분히 깨끗하지 못합니다. 정압을 사용하여 추가 청소
단계 3.3) 세포가 수축 / 사망하는 것처럼 보임 새로운 피펫을 준비하고 새 세포를 목표로하십시오.
단계 3.4) 수상 돌기의 터미널 위치를 결정할 수 없음 Alexafluor는 세포 전체에 퍼지기에 충분한 시간이 없거나 Alexafluor의 농도가 충분히 높지 않습니다. 카메라의 게인과 노출 시간이 충분히 긴지 확인하십시오. 수상 돌기를 시각화하기 전에 추가로 5 분 기다립니다. 수상 돌기가 여전히 보이지 않으면 높은 Alexafluor집중.
단계 4.1) 모든 세포질을 흡인 할 수 없음
단계 5.5) 8 분 후에 상등액이 맑지 않다. 부드럽게 자성 분리기에있는 동안 전체 솔루션을 두 번 pipette, 그리고 또 5 분 앉아
단계 5.5) 피펫 팅 중에 펠렛이 분산 됨 샘플이 자석에서 너무 멀리 있습니다. 모든 pipetting 동안 튜브를 자기 분리 장치에 보관하십시오. 용액을 제거하고 5 분 동안 구슬을 다시 펠렛에 넣습니다.
단계 5.7) 5 분 후 샘플은 광택이 나타남 EtOH의 최대 양이 제거되지 않았습니다. 건조 중에 샘플을 계속 모니터하십시오. 매 2 분마다, P10 피펫을 사용하고 튜브 바닥의 모든 EtOH를 제거하십시오
단계 8.9) 재수 화 전에 펠렛에 균열이 있음 샘플 재 확보 허용비율이 2가 아닌 총 4 분 동안 (단계 8.10)
단계 8.11) 소량의 비드를 상등액 전체 샘플을 다시 튜브로 꺼내고 1 분 동안 자성 분리기에 놓습니다. 부드럽게 피펫 펠렛을 피하십시오
단계 8.12) DNA 번짐이 일치하지 않고 형광 배율이 지속적으로 변경됩니다 HS 칩의 농도가 너무 높습니다. 검체의 농도를 확인하고 1 - 10 ng / μL 사이에서 희석하십시오. 재사용 bioanalyzer
단계 8.12) 저 분자량 스미어 RNA 분해 수거 후 즉시 세포를 플래시해야합니다. 이 cDNA 라이브러리 폐기
단계 8.12) 제어 레인의 마커 기저 변동 오염 또는 오래된 시약 DNA 마커를 버리고 Bioanalyzer 실행을 위해 새 튜브를 사용하십시오.
단계 8.12) DNA 번짐 없음 세포를 추방하지 못함 약간 큰 팁으로 새 바늘 잡아 당기기
RNA 비드 실패 구슬이 사용 전에 완전히 재현되었는지 확인하고 샘플을 자성 분리기에 놓기 전에 부화 시키도록하십시오
단계 8.12) 약한 DNA 번짐 증폭이 충분하지 않다. 더 많은 PCR주기 사용
단계 8.12) 500bp-2Kb 범위 외의 DNA 번짐 0.5 이하 및 2 Kb 초과의 DNA 얼룩은 오염 가능성이 있습니다. 샘플 삭제
단계 8.12) DNA 추적에 규칙적으로 간격을 둔 스파이크 샘플의 오염 항상 신선한 장갑을 착용하고 헹굼을 위해 새로운 에탄올을 만드십시오. 필터 팁은 항상 사용되어야합니다.
9.3 단계) 형광 분석기에서 시료 농도를 검출 할 수 없음 검출 수준 이하의 표본은 표본을 만들기에 너무 적은 DNA를 가지고 있으므로 사용할 수 없습니다
단계 10.10) 10 분 후에 샘플이 건조하지 않음 과량의 EtOH를 계속 제거한다. 샘플을 더 오래 보관할 수있게하고, 매분마다 점검하십시오.
단계 10.13) 스미어가 2Kb로 기울어 짐 불완전한 조각화 0.2 ng / μL가 아닌 0.15 ng / μL의 농도로 시료를 다시 희석하십시오. 꼬리표 재실행
10.13 단계) 도말이 200bp로 기울어 짐 DNA 입력이 너무 적습니다. 샘플을 덜 희석하고 농도를 0.4 ng / μL로하십시오. 꼬리표 재실행
Tagmentation 반응이 너무 깁니다. tagmentation 반응 시간을 8 분으로 단축
단계 10.13) 약한 얼룩 부적절한 DNA 증폭
단계 11.2) 최대 수득 가능한 풀 농도는 5 nM 미만이다 현저하게 낮은 농도를 가진 표본을 확인하고 새로운 희석액으로 표백을 재실행하십시오.

도표 1 : 의정서에있는 잠재적 인 방해를위한 해결책 그리고 제안. 이 표에는이 프로토콜 동안 발생할 수있는 잠재적 인 어려움과이를 접할 수있는 단계가 나열되어 있습니다. 이 표에는 이러한 문제에 대한 가능한 원인과 문제 해결에 도움이되는 해결책이 나와 있습니다.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

우리의 프로토콜은 신속하고 사용하기 쉬운 가이드를 통해 표본에 거의 손상을주지 않으면 서 높은 수준의 서열 분석을 위해 확인 된 형태 학적 분류의 단일 세포를 준비하는 방법을 보여줍니다. 본 원고에서 본질적으로 감광성 망막 신경절 세포는 형태 학적으로 특성화되고 분리되고 RNA-Seq에 대해 준비된다. 망막 처리 도중 세포 응력이 발생할 수 있습니다. 이러한 이유로 우리는 4 시간 이상 사용하지 않으면 각 조직을 대체합니다. 우리는 전기 생리학 장비를 사용하여 이들 세포에서 기록하고 그들의 반응을 모니터함으로써 세포의 상태를 평가할 수 있으며, 이는 세포가 건강하다는 것을 보장합니다. 우리의 프로토콜은 65 %의 성공률을 제공하는 23 개 샘플 중 15 개에서 성공적인 cDNA 라이브러리를 생성 할 수있었습니다. 또한 우리의 세포가 발현하는 유전자의 평균 수는 2,316 ~ 10,353 건으로 평균 5,683 건으로 서열 데이타의 질이 뛰어났습니다FPKM 값이 0이 아닌 유전자. 이 수치는 뉴런의 다른 연구에서 발견 된 유전자 수치와 유사하며, 우리의 데이터 또한 좋은 품질임을 보여줍니다.

우리가 이러한 특정 뉴런에 대해이 프로토콜을 성공적으로 수행 한 동안이 기술에 대한 사소한 수정안을 여러 가지 다른 응용 프로그램에 적용 할 수 있다는 점에 유의해야합니다. 별도의 마우스 모델 내에서 Fluorescence-activated Cell Sorter (FACS)를 사용하여 우리는 중추 신경계로부터 GFP 마커로 분류 된 작은 세포 집단 (1,000-25,000)을 분리했습니다. 이 집단의 RNA를 분리하고이 RNA의 1 μL (12 ng / μL 이하)를 사용하여 단계 6.1에서 역전사를 시작했습니다. 이 단계 후에 프로토콜에 대해 수행해야하는 유일한 조정은 7.4 단계에서 발생하며,이 시점에서 더 적은 PCR주기를 채택 할 수 있습니다. 초기 샘플에 g가 포함 된 경우 19 사이클을 사용했습니다.10,000 세포보다 더 많은 양을 가지고 있으며, 이것은 좋은 품질의 cDNA 라이브러리를 생산한다는 것을 발견했다. 예를 들어, 세포 샘플은 FACSorted 모집단으로부터 준비되었고, 표현 된 유전자의 수는 12,340-14,052이고, FPKM 값이 0이 아닌 평균 13,265 개의 유전자가있다. 이 기술은 형광 기자가있는 다양한 마우스 모델에 적용 할 수 있습니다. 이 개정안으로 인해 연구진은 형광 리포터 마우스를 사용할 수있는 세포 집단을 연구하여 신경 다양성 분야에서 연구를 확장 할 수있었습니다.

두 번째 조정은 형태학이 아니라 기능성을 기반으로 세포를 프로파일 링 할 수 있습니다. 이 프로젝트는 형질 전환 모델을 사용하지만이 기술은 알려진 분자 식별자가없는 뉴런에 적용될 수 있습니다. 예를 들어, 현재 27 개의 망막 신경절 세포의 기능적 아형이 30 개 이상 있으며, 그 중 극히 일부만 고유 한 마커를 가지고 있습니다. 이 기법이미 세포 충진을위한 전기 생리 기기를 사용하고 있으며, 패치 클램핑을 사용하여 스파이크 패턴에 기초하여 각 세포의 기능적 반응 프로파일을 확인할 수있다. 광 유발 스파이크 기록을 사용하여 망막 뉴런의 분류를 세포 분리 전에 결정할 수 있었다. 이 기술은 망막 신경절 세포에서 작동하지만 다른 망막 신경 세포를 검사하기 위해 확장 될 수 있습니다. 그러나이 프로토콜을 사용하여 망막 양극성 또는 무 건성 세포를 내핵 세포층에 입력하는 경우, 예를 들어 세포의 접촉을 피하기 위해 전극의 끝 부분에 일정한 양의 압력을가하도록주의해야합니다 전극은 신경절 세포층과 내부 plexiform 층을 통과한다. 내핵 층 내의 망막 뉴런의 경우, 세포 녹음 전에 망막 부분을 준비하는 것이 오염을 일관되게 피하는 데 가장 효과적 일 수 있습니다. 각 세포는 다음과 같이 cla 다음에 기술 된대로 분리되고 준비됩니다.분류 단계. 또한, 우리는 뉴런 연구에이 프로토콜의 사용을 제안하지만,이 기술은 형질 전환 모델의 사용을 통해 형태 학적으로 특성화되거나 분리 될 수있는 모든 세포 유형에 적용될 수 있습니다.

이 기술은 또한 이전에 준비된 cDNA 라이브러리로 작동하도록 수정할 수 있습니다. 우리는 과거에 마이크로 어레이 하이브 리다이 제이션을 위해 생성했습니다. 개별적으로 준비된 라이브러리로, 50-150ng 범위의 cDNA 양으로 시작하여 단계 8.4에서 프로토콜을 시작합니다. 더 높거나 낮은 농도는 시도가되지 않았지만 효과가있을 수 있습니다. DNA 비드를 사용하여 cDNA를 정제 한 다음 태깅 (tagmentation)과 PCR 증폭을 수행합니다. 우리는이 조정을 마이크로 어레이 하이브 리다이 제이션 ( microarray hybridization) 29 와 같은 라이브러리 준비물의 cDNA로 테스트했으며 RNA-Seq에 대한 태그 라이브러리를 성공적으로 생산했습니다.

지느러미이 프로토콜은 유도 된 Pluripotent Stem Cell (iPSCs)의 세포 집단 유도의 성공 여부를 평가하는 데 사용할 수 있습니다. 이러한 재 프로그램 된 다 능성 세포의 분화 뒤에있는 원동력은 세포 유형을 유도하여 서로 독립적으로 발달하는 전사 인자에 대한 이해에 달려있다. iPSC를 특정 세포 운행으로 유도하는 것은 선택적으로 세포 유형을 생성하는 데 사용할 수 있기 때문에 신경원 다양성을 연구하기위한 새로운 방법입니다. 이 프로토콜은이 모델로부터 분화 된 세포들 사이의 다양성의 질을 평가하기 위해 적용될 수 있습니다. 앞서 언급했듯이, 망막 신경절 세포의 30 개 이상의 기능적 하위 유형이 있으며 iPSC에서 기능적 RGC를 생성하기위한 많은 노력이있어 왔습니다. 우리의 경우에는 ipRGCs 인 RGC의 아형 (subtypes)에 대한 마커의 확인은 연구원이 RGC의 다양한 아형을 생산할 때 프로토콜의 성공 여부를 평가할 수있게합니다. 세포 유형의 평가이 뉴런들 사이에서이 프로토콜로부터 이익을 얻고,이 모델 시스템이 즉시 이용 가능 해짐에 따라 아 유형 특이적인 마커에 대한 지속적인 연구를위한 도구로 사용될 수 있습니다.

본 원고에서는 transcriptomic analysis를위한 단일 세포의 분리와 준비를위한 간단한 기술을 설명한다. 또한 프로토콜을 편집하여이 기술을 다양한 범위의 목표를 염두에두고 여러 실험에 사용할 수있는 방법을 제안합니다. 여기에 설명 된 프로토콜은 Trombetta et al. 24 를 사용하여 저 입력 RNA-Seq에 대한 권장 키트 지침을 조정합니다. 주요 차이점은이 프로젝트의 요구에 가장 잘 부합하도록 선택한 세포 분리 및 다양한 용적 변화입니다. 이 프로토콜에서 가장 중요한 단계는 망막 조직에서 세포를 분리하는 것임을 강조하는 것이 중요합니다. 이것이 프로토콜 durin의 요점입니다.g 대부분의 오류가 발생할 수 있으며 가장주의 깊은주의를 기울여 수행해야합니다. 세포질의 손실은 mRNA 분자의 심각한 고갈을 초래할 수있는 반면 오염의 양은 사용 불능 샘플을 초래할 수 있습니다. 이 단계는 시료를 정확하게 취급했는지 ​​확인하기 위해 실험에서 실험까지 동일한 개인에 의해 조심스럽게 수행되어야합니다.

요약하면,이 프로토콜은 고품질 RNA-Seq을위한 세포의 분류, 분리 및 준비 기술을 설명합니다. 이것은 단일 셀에서 데이터의 품질을 최적화하는 비교적 효율적이며 비교적 저렴한 방법입니다. 이 기술은 다목적이며 다양한 연구에 적용하기 위해 최소한으로 수정할 수 있습니다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자는 공개 할 것이 없습니다.

Acknowledgments

우리는 샘플을 준비하고 취급하는 데 도움을 준 Jennifer Bair와 Einat Snir, Iowa Institute for Human Genetics를 인정하고 싶습니다.

Materials

Name Company Catalog Number Comments
Ames' Medium Sigma Aldrich A1420-10X1L
Sodium Bicarbonate Sigma Aldrich S8875
K-gluconate Spectrum Chemical PO178
EGTA Sigma Aldrich E4378
HEPES Sigma Aldrich H3375
Diethyl pyrocarbonate (DEPC) Sigma Aldrich D5758
Alexa Fluor 594 Hydrazide Invitrogen A10442
Collagenase Worthington Biochemical  LS005273
Hyaluronidase Worthington Biochemical  LS002592
Petri dish (35 mm diameter) Thermo Fisher Scientific 153066
Ophthalmologic scissors Fine Science Tools 15000-00
#5 Forceps Fine Science Tools 11252-30
Microplate Shaker Fisher Scientific 13-687-708
Glass Micropipette Sutter BF120-69-10
Micropipette Puller Sutter P-1000 horizontal pipette puller
1 mL syringe Fisher Scientific 14-823-2F
Flexible tubing Fisher Scientific 14-171
TCL lysis buffer Qiagen 1031576 Lysis Buffer 1
β-mercaptoethanol Sigma Aldrich M3148
RNase-free Water Qiagen 129112
0.2 mL PCR tubes Eppendorf 30124359
Ethyl Alcohol, Pure Sigma Aldrich E7023 Ethanol
Analog Vortex Mixer Thermo Fisher Scientific 02215365 Vortex
Mini Centrifuge Thermo Fisher Scientific 05-090-100
Agencourt RNAClean XP Beads Beckman Coulter A63987 RNA magnetic beads
MagnaBlot II Magnetic Separator Promega V8351 Magnetic stand
1.5 mL MCT Graduated Tubes Thermo Fisher Scientific 05-408-129
Smart-Seq v4 Ultra Low Input RNA Kit Clontech 634888 Reagents for Reverse Transcription and PCR Amplification
10x Lysis Buffer Lysis Buffer 2
5x Ultra Low First-strand Buffer Buffer 1
3' SMART-Seq CDS Primer II A Primer II
SMART-Seq v4 Oligonucleotide Oligonucleotide
SMARTScribe Rverse Transcriptase Reverse Transcriptase (RT)
2x SeqAmp PCR Buffer PCR Buffer
PCR Primer II A PCR Primer
SeqAmp DNA Polymerase DNA Polymerase
Mastercycler pro S Eppendorf 950030020 Thermocycler
Agencourt AMPure XP Beads Beckman Coulter A63881 DNA magnetic beads
2100 Bioanalyzer Agilent Technologies G2939AA
HS Bioanalyzer Chips & Reagents Agilent Technologies 5067-4626
Qubit HS Assay Kit Thermo Fisher Scientific Q32851 For the calculation of sample concentrations
Qubit Assay Tubes Thermo Fisher Scientific Q32856
Qubit 2.0 Fluorometer Thermo Fisher Scientific Q32866
Nextera XT DNA Sample Preparation Kit Illumina FC-131-1024 Reagents for Tagmentation and Index Coupling
TD Buffer Buffer 2
ATM Tagmentation Mix
NT Buffer Tagmentation Neutralizing Buffer
NPM PCR Master Mix
Nextera XT Index Kit Illumina FC-131-1001 Indices for Tagmentation
N501 White 1
N502 White 2
N701 Orange 1
N702 Orange 2
HiSeq 2500 Illumina SY-401-2501 For completing sequencing of samples

DOWNLOAD MATERIALS LIST

References

  1. Austin, C., Cepko, C. L. Specification of Cell Fate in the Vertebrate Retina. Neural Cell Specif. 3, 139-143 (1995).
  2. Masland, R. H. The Neuronal Organization of the Retina. Neuron. 76, (2), 266-280 (2012).
  3. Rodieck, R. The First Steps in Seeing. Sinauer Associates, Inc. Sunderland, MA. (1998).
  4. Chiu, I. M., et al. Transcriptional profiling at whole population and single cell levels reveals somatosensory neuron molecular diversity. Elife. 3, e04660 (2014).
  5. Tasic, B., et al. Adult mouse cortical cell taxonomy revealed by single cell transcriptomics. Nat. Neurosci. 19, (2), 335-346 (2016).
  6. Trapnell, C. Defining cell types and states with single-cell genomics. Genome Res. 25, (10), 1491-1498 (2015).
  7. Zeisel, A., et al. Cell types in the mouse cortex and hippocampus revealed by single-cell RNA-seq. Science. 347, (6226), 1138-1142 (2015).
  8. Schmidt, T. M., Do, M. T. H., Dacey, D., Lucas, R., Hattar, S., Matynia, A. Melanopsin-Positive Intrinsically Photosensitive Retinal Ganglion Cells: From Form to Function. J. Neurosci. 31, (45), 16094-16101 (2011).
  9. Eberwine, J., Miyashiro, K., Kacharmina, J. E., Job, C. Local translation of classes of mRNAs that are targeted to neuronal dendrites. Proc. Natl. Acad. Sci. 98, (13), 7080-7085 (2001).
  10. Darmanis, S., et al. A survey of human brain transcriptome diversity at the single cell level. Proc. Natl. Acad. Sci. 112, (23), 7285-7290 (2015).
  11. Macosko, E. Z., et al. Highly Parallel Genome-wide Expression Profiling of Individual Cells Using Nanoliter Droplets. Cell. 161, (5), 1202-1214 (2015).
  12. Usoskin, D., et al. Unbiased classification of sensory neuron types by large-scale single-cell RNA sequencing. Nat. Neurosci. 18, (1), 145-153 (2015).
  13. Poulin, J. F., Zou, J., Drouin-Ouellet, J., Kim, K. Y. A., Cicchetti, F., Awatramani, R. B. Defining midbrain dopaminergic neuron diversity by single-cell gene expression profiling. Cell. Rep. 9, (3), 930-943 (2014).
  14. Gross, A., Schoendube, J., Zimmermann, S., Steeb, M., Zengerle, R., Koltay, P. Technologies for Single-Cell Isolation. Int. J. Mol. Sci. 16, 16897-16919 (2015).
  15. Lovatt, D., et al. Transcriptome in vivo analysis (TIVA) of spatially defined single cells in live tissue. Nat Methods. 11, (2), 190-196 (2014).
  16. Qiu, S., et al. Single-neuron RNA-Seq: Technical feasibility and reproducibility. Front. Genet. 3, (124), 1-8 (2012).
  17. Subkhankulova, T., Yano, K., Robinson, H. P. C., Livesey, F. J. Grouping and classifying electrophysiologically-defined classes of neocortical neurons by single cell, whole-genome expression profiling. Front. Mol. Neurosci. 3, (10), 1-11 (2010).
  18. Fuzik, J., et al. Integration of electrophysiological recordings with single-cell RNA-seq data identifies neuronal subtypes. Nat. Biotechnol. 34, (2), 175-183 (2016).
  19. Schmidt, T. M., Kofuji, P. An isolated retinal preparation to record light response from genetically labeled retinal ganglion cells. J. Vis. Exp. (47), e2367 (2011).
  20. Schmidt, T. M., Kofuji, P. Functional and morphological differences among intrinsically photosensitive retinal ganglion cells. J Neurosci. 29, (2), 476-482 (2009).
  21. Schmidt, T. M., Kofuji, P. Structure and Function of Bistratified Intrinsically Photosensitive Retinal Ganglion Cells in the Mouse. J Comp Neurol. 519, (8), 1492-1504 (2011).
  22. Schmidt, T. M., Kofuji, P. Differential cone pathway influence on intrinsically photosensitive retinal ganglion cell subtypes. J Neurosci. 30, (48), 16262-16271 (2010).
  23. Clontech Laboratories I. SMARTerTM Ultra Low RNA Kit for Illumina® Sequencing. (2013).
  24. Trombetta, J. J., Gennert, D., Lu, D., Satija, R., Shalek, A. K., Regev, A. Preparation of single-cell RNA-Seq libraries for next generation sequencing. Curr. Protoc. Mol. Biol. 4, (22), 1-17 (2014).
  25. Ecker, J. L., et al. Melanopsin-expressing retinal ganglion-cell photoreceptors: Cellular diversity and role in pattern vision. Neuron. 67, (1), 49-60 (2010).
  26. Schmidt, T. M., et al. A Role for Melanopsin in Alpha Retinal Ganglion Cells and Contrast Detection. Neuron. 82, (4), 781-788 (2014).
  27. Sanes, J. R., Masland, R. H. The Types of Retinal Ganglion Cells: Current Status and Implications for Neuronal Classification. Annu. Rev. Neurosci. 38, 221-246 (2014).
  28. Goetz, J. J., Trimarchi, J. M. Single-cell Profiling of Developing and Mature Retinal Neurons. J. Vis. Exp. e3824 (2012).
  29. Trimarchi, J. M., et al. Molecular Heterogeneity of Developing Retinal Ganglion and Amacrine Cells Revealed through Single Cell Gene Expression Profiling. J. Comp. Neurol. 502, 1047-1065 (2007).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics