דיסקציה של רקמות הזחל דג הזברה האשכים

* These authors contributed equally
Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 1 hour trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

כאן, אנו מציגים פרוטוקול לבידוד רקמת האשכים של דג הזברה הזחל, אשר יקל על חקירות של בידול מין דג הזברה ותחזוקה.

Cite this Article

Copy Citation | Download Citations

Wang, X., Chen, S., Zhang, W., Ren, Y., Zhang, Q., Peng, G. Dissection of Larval Zebrafish Gonadal Tissue. J. Vis. Exp. (122), e55294, doi:10.3791/55294 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

למרות דג זברה פרא להחזיק מערכת ZZ / ZW מין להגדרה, דג זברה מבוית אבדה את כרומוזום המין. הם מנצלים מערכת קביעת הזוויג polygenic, שבו מספר גנים מופצים ברחבי הגנום קולקטיבי לקבוע את זהותם המין של דגים בודדים. נכון לעכשיו, את הגנים מעורבים בויסות התפתחות בלוטת מין וכיצד הם פועלים להישאר חמקמקים. בדרך כלל, לבודד רקמת אשכים הוא הצעד הראשון כדי לבחון את התהליכים ההתפתחותיים מין. כאן, אנו מציגים הליך לבודד רקמת אשכים מן 17 DPF (הפריה פוסט ימים) ו 25 DPF זחלי דג זברה. רקמת האשכים המבודדת עשויה להיבחן לאחר מכן על ידי פרופיל ביטוי מורפולוגיה גן.

Introduction

קובע המין הנשי המרכזי כרומוזום דג זברה פרא 4 אבד או שונה של דג הזברה המבויתת (זני מעבדה הנפוצים כלומר) 1. במקום זאת, יש להם מערכת קביעת הזוויג polygenic בליווי גורמים סביבתיים כגון טמפרטורה, היפוקסיה, זמינות המזון וצפיפות האוכלוסייה. המנגנונים המפורטים של התפתחות מין דג זברה אינם מובנים במלואם. שאלות יסוד כגון כאשר קביעת הזוויג דג זברה מתרחשת, מה אות קביעת המין העיקרית (ים) היא / הם, ואשר גנים להסדיר את הצעד הראשון של טרנספורמציה שַׁחֲלָה להישאר ייענה 2, 3.

בתהליך פיתוח מין דג זברה, בכמה שלבים חשובים הוכרו. בשלב מוקדם של הפיתוח, החל 4 hpf (הפריה פוסט שעות)-תאי נבט בראשיתי (PGCs) עוברים המפרט, הגירה אל הרכס גניטלישִׂגשׂוּג. מספרים PGC ואינטראקציות גומלין בין תאי הנבט תאים סומטיים חשובים בידול שַׁחֲלָה 4. בשעה 13 DPF (הפריה פוסט ימים), בלוטות המין נמצאים בשלב מובחן. עד 17 DPF, בלוטות המין להתפתח דו-פוטנציאל שחלות הן נקבות וזכרים בעתיד. המעבר תלוי-אפופטוזיס מן השחלה אל האשכים מתחילים בגיל 21 כדי 25 DPF ועשוי להימשך מספר שבועות. עד 35 DPF, המין של בלוטת המין נקבע וייצור תא מין ספציפי מין מתנהל בשני השחלות ואשכים 5, 6, 7.

נכון להיום, גנים ומנגנוני מועמד מגוונים של קביעת הזוויג הוצעו. פרוטאומיקה וניתוח transcriptomic הצליחו לבודד גנים רבים עם הביטוי דימורפית מינית גנים אלה נוצלו כדי ללמוד בידול מין דג הזברה 8, 9, 10. לדוגמה, ב דג הזברה הזחל, הגן cyp19a1a מתבטא במיוחד בשחלה אך לא את האשך 11, 12. בנוסף, גן AMH מתבטא בחולשה בתאי granulosa הזקיק בשחלה, אבל מאוד בתאי testis Sertoli 13. לעומת זאת, הגן ושה מתבטא באופן רציף בתאי הרבייה של שני דג הזברה הנשית והגברית, מה שהופך אותו סמן שַׁחֲלָה מתאים 14, 15.

חקירת רמות ביטוי הגנים האשכים הוא קריטי כדי להבין את המנגנון המולקולרי של קביעת הזוויג והבחנה במיוחד בשלב הדו-פוטנציאל השחלה 3, 9. עם זאת, גודלו הקטן של דג הזברה הזחל והאשכים קטנים בהתאמה לסבך את הבידוד של gonadal רקמות לניתוח מולקולרי נוסף. מחקרים קודמים השתמשו גזורים באזור תא מטען כולו בין opercula ואת הנקבוביות אנאליות 16. הכנה זו, למרות בלוטות מין המכיל, מורכבת של רקמות ואיברים מרובים. לחלופין, חיות טרנסגניות עם הביטוי GFP שַׁחֲלָה ספציפיים כגון ושה: EGFP שימשו לבידוד רקמת האשכים באמצעות תא מופעל הקרינה מיון (FACS) ו ללכוד לייזר דיסקציה מיקרו 17, 18. אבל היישום הנרחב שלהם מוגבל. כאן, אנו מתארים תהליך פשוט לבודד רקמת האשכים מן דג הזברה הזחל ב 17 DPF ו 25 DPF. אנחנו מדגימים את המיקום של בלוטות המין ביחס לאיברים אחרים ולבודד את בלוטות המין ללא פגע מורפולוגית הרקמות הסובבות. אנחנו מראים עוד את הגנים ספציפיים שַׁחֲלָה כגון ושה cyp19a1a מבוטאים מאוד בלוטות המין המבודדות לעומת רקמת תא המטען באמצעות PCR כמוני (ניתוח qPCR). הפרוטוקול הנוכחי מאפשר זיהוי, בידוד, טיהור RNA והגברה של גנים ספציפיים אשכים מן דג זברת זחל, ובכך מאפשר ניתוח מולקולרי הבא של רקמת אשכי 19.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

ניסויים הזברה אושרו על ידי ועדת טיפול בבעלי חיים מוסדיים אוניברסיטת פודאן ושימוש. זברה הועלתה וגדלה על פי נהלים קבועים 20.

1. הכנות

  1. טפחו 17 DPF ו 25 DPF דג הזברה הזחל
    1. העברה 2 זכרים ו 2 דג זברה מבוגר נקבה (בריאה, 3 עד 6 חודשים, זן מעבדת AB) ועד טנק המעבר בשעות אחר הצהריים המאוחרים לפני יום המעבר. להפריד בין זכרים לנקבות עם מחסום. למחרת בבוקר, לרענן את המים במיכל ולהסיר את המחסום כדי לאפשר להם להזדווג. אסוף ביצים 100 מ"מ פטרי מנות 1 עד 2 שעות לאחר ההפריה.
    2. שמור על 40 העוברים בתוך צלחת 100 מ"מ עם המדיום העובר 40 מ"ל (EM) ב 28.5 מעלות צלזיוס במהלך תקופת ההתפתחות המוקדמת (4 ימים) ולרענן את EM פעמיים ביום. עבר זחלי 1 טנקי L (40 זחלים למי מערכה 300 מיליליטר) ולהאכיל עם rotifers החי (אספקה ​​מלאה, פעמים ביום) לאחר 5 DPF.Feed ארטמיה חיה במקום דיאטה rotifer לאחר 10 DPF. מעבירים את הדג לתוך מערכת המים במחזור מחדש ב 14 DPF 21.
    3. תרים דג הזברה הזחל במערכת המים במחזור מחדש עד 17 DPF או 25 DPF. ודא מחזור אור / חושך הוא 14/10 h ו pH ערך של מים במערכת הוא על 7.2. מדדו את אורך הגוף של 17 DPF (5.5 כדי 6.8 מ"מ) ו 25 DPF (8 עד 11 מ"מ) זחלי 22.
  2. כן 2% צלחות אגרו לנתיחה.
    1. הוספת אגר 4 גרם ל 200 מ"ל מים סטריליים. מחממים את התערובת במיקרוגל עד שהוא הופך שקוף.
    2. מצנן את הפתרון אגר במשך כ 15 דקות, ואז לשפוך אותו לתוך 60 מנות מ"מ קוטר פטרי (כ 1/3 נפח של הצלחת). אחסן את הצלחות אגרו הקרושה ב 4 מעלות צלזיוס.

2. פרוטוקול 1: לנתח את רקמת האשכים של 17 ו 25 DPF זחלים

  1. להוסיף קרח כתוש לתוך הטנק כדי להרדים 17 זחלי DPF. העברתזחלים הרדימו עד 100 מ"מימ מקוררים צלחת פטרי עם 30 הפתרון של המ"ל הקר Ringer. שמור את הדגים וטופחו על ידי פתרון של מקורר Ringer עבור 15 דקות לפחות כדי להרדים את זחלי במלואה.
  2. מעבירים את הזחלים לצלחת אגר precooled בכפית פלסטיק קטנה. לצלול הגוף דג שלם 10 מ"ל מקורר בתמיסת רינגר בעדינות ולהניח אותה על צדה.
  3. לעשות את הפעולות הבאות מתחת לשדה הראייה של מיקרוסקופ סטריאו 25x. הצמד את תא המטען דגים עם פינצטה עבור ייצוב. תולשים את הבטן אורכית מפי הטבעת אל הלב עם זוג אחר של פינצטה. הסר בעדינות את העור והשרירים בצד אחד של הגוף על מנת לחשוף את האיברים הפנימיים.
  4. הסר את מסת איברי גחון בשלפוחית ​​השחייה בזהירות. למנוע נזק שַׁחֲלָה המצורפת בשלפוחית ​​השחייה.
  5. חותך את הקשר בין בשלפוחית ​​השחייה והגוף קדמי. משוך החוצה בשלפוחית ​​השחייה כולו רקמות האשכים בעדינות.
    הערה: ברוב המקרהים, רקמת האשכים ב 17 DPF מכיל לרקמות אפיתל protonephridium. הם אינם מופרדים בקלות זה מזה, אבל 25 DPF זה ניתן להפריד בקלות. אֶשֶׁך מחובר גם אל פי הטבעת. צומת עם אשך שמאל וימין מחוברים זה לזה על פי הטבעת תהיה גלויה בבירור.
  6. להשתמש בפינצטה כדי להפריד את רקמת האשכים בקפידה מתוך בשלפוחית ​​השחייה ולנקות את רקמות השומן שמסביב.
  7. מיד להעביר את רקמת האשכים מבודדת כדי צינור צנטריפוגות prechilled 1.5 מ"ל המכיל 200 הפתרון של μL Ringer. שמור את הצינור על קרח עד שכל רקמות האשכים מופרדות מן הזחלים.
  8. לנתח את בלוטות המין של 25 DPF זחלי כמתואר בשלבים 2.1 - 2.7.

3. פרוטוקול 2: לנתח ביטוי גנים של רקמות האשכים המבודדות

  1. חלץ RNA הכולל רקמות אשכי הזחל.
    1. העברת רקמות אשכים המבודדות עד 1 חדש RNase חינם.5 מ"ל צינור ולהסיר בתמיסת רינגר. להוסיף 100 פתרון תמס μL. וורטקס עד הרקמות הם lysed לחלוטין.
    2. בצע את הליך חילוץ RNA הכולל על פי הוראות היצרן.
    3. להוסיף 1/10 נפח DNase 10x ואני חיץ 1 μL של DNase אני לפתרון RNA ומערבבים בעדינות. דגירה של 20 דקות ב 37 מעלות צלזיוס.
    4. הוספת ריאגנט איון DNase 1/10 נפח לפתרון RNA. דגירה של 10 דקות ב 70 מעלות צלזיוס. מדדו את הריכוז של RNA הכולל באמצעות ספקטרופוטומטר. חנות ב -20 מעלות צלזיוס.
  2. בצע סינתזה cDNA הראשון גדיל
    1. השתמש אוליגו (DT) תחל -linker לבצע סינתזה cDNA הראשון גדיל בעקבות פרוטוקול של ייצור. להוסיף 1 עד 2 מיקרוגרם של RNA לנפח התגובה הכולל 20 μL.
    2. דגירת פתרון התגובה עבור 90 דקות ב 45 מעלות צלזיוס. לסיים את התגובה על ידי חימום על 70 מעלות צלזיוס למשך 5 דקות.
    3. להוסיף 1 μL RNase H אל cDNA כךlution להסרת RNA שיורית. מערבבים בעדינות צנטריפוגות במשך 10 שניות על ~ 13,000 g x. דגירה של 20 דקות ב 37 מעלות צלזיוס. להוסיף 20 μl מים חינם nuclease. חנות ב -70 מעלות צלזיוס.
  3. בצע פלורסנט PCR כמותי
    1. בצעו qPCR על מערכת Cycler עם צבע פלואורסצנטי. השתמש תנאי אופני PCR הבאים: 35 מחזורים ב 95 מעלות צלזיוס למשך 15 s, C ° TM-5 עבור 15 s, 68 מעלות צלזיוס למשך 30 s. השתמשו רצפים פריימר כדלקמן: AMH (FWD: GTGGATGGCAGCAGTACGAC; rev: GCGGAGAGGTGGAAGAGAGAATG), cyp19a1a (FWD: GTCCTGTTGTCTCCTACTGTCG; rev: CATTTGAGTTGAATATGATGCCCTG), nanos3 (FWD: GCTCGGTGTACGCCAAATCAACAT; rev: CCAAGTGAAAACACAACACCAGTGC), ושה (FWD: ATCGCATAGGAAGAACTGGACGCT; rev: CCAAGTGAAAACACAACACCAGTGC) ו β-אקטין (FWD: AGTGCGACGTGGACATCCGTA; rev: GCACTTCCTGTGGACGATGGA) 19.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

והניתוחים של בלוטות המין בוצעו על דג הזברה הזחל זן AB. איור 1 מציג רקמת האשכים טיפוסית של דג הזברה הזחל ב 17 DPF ו 25 DPF. ראשית, העור והשרירים של צד אחד של הבטן הוא חתכו לחשוף את האיברים הפנימיים. לאחר הסרת המסה של איברים פנימיים, בשלפוחית ​​השחייה יחד עם האשך להישאר בתא המטען. שַׁחֲלָה צורף בצד הגחון של שלפוחית השחייה (החץ באיור 1B '). בשעה 17 DPF, את בלוטת המין היה בשלב הדו-פוטנציאל השחלה. אֶשֶׁך המבודד כלול שמאל ואת בלוטת המין הנכון היה שקוף (איור 1C). ברוב המקרים, זה היה מוקף ברקמת אפיתל protonephridium (החץ באיור 1C). בשעה 25 DPF אֶשֶׁך נעטף לעתים קרובות על ידי רקמות השומן (איור 1D). בשלב התפתחות זו stגיל, או אשך גדול או קטן אפשר לראות. השחלה בשלה היא גדולה כמו ההתפתחות של הביציות המשניות, ותאי זקיק להגדיל את נפח בלוטת המין (איור 1E). לאשכים בשלה הוא קטן בגלל ניוון אפופטוזיס של השחלה הזחל (איור 1F).

כדי לנתח את המאפיינים המולקולריים של רקמות האשכים המבודדות, בדקו ראשון רמות ביטוי גנים של AMH, cyp19a1a, nanos3 וושה, ארבעה סמני אֶשֶׁך דג זברה, על ידי qPCR. RNA סה"כ היה שחולץ מן רקמות אשכי זחל (n = 35) באמצעות ערכת בידוד RNA. בנוסף, הסרנו את הראש והזנב של 17 DPF זחל, ומשתמש רקמת תא המטען (בין מבנה הלב ואת הנקבוביות אנאליות) כדי לחלץ RNA כחלק מקבוצת הביקורת (n = 15). רקמת תא המטען כללה עור, שריר, עצם (חוליות וצלעות), לשחות שלפוחית ​​שתן, כליות בלוטת מין. אוליגו DT-pשוליה cDNA שימש qPCR. התוצאה qPCR הראה עליות AMH, cyp19a1a, nanos3 ורמות ושה ביטוי 17 רקמת האשכים מבודדת DPF בכ 397, 342, 45 ו 170 של פי, בהתאמה (איור 2).

איור 1
איור 1. Microphotographs של רקמות אשכים אופייניות זחל דג זברת 17 DPF ו 25 DPF. (א) תולשים את העור והשרירים של צד אחד של הבטן כדי לחשוף את האיברים הפנימיים תחת מיקרוסקופ סטריאו 25x. (ב) לאחר הסרת המסה של האיברים הפנימיים, בשלפוחית השחייה ואת בלוטת המין נשארים מחוברים תא המטען. (ב ') מוגבר לאור התיבה האדומה B פאנל להראות את המיקום היחסי של בשלפוחית השחייה ואת בלוטת המין. אֶשֶׁך הוא מסומן בחץ. (ג) Iso lated רקמת האשכים ב 17 DPF. הרקמות השחורות בתמונה (חיצים) הנן רקמת האנדותל protonephridium המצורפת אֶשֶׁך. (DE) A שַׁחֲלָה גדול לפני ואחרי הסרת רקמת שומן ב 25 DPF. (ו) שַׁחֲלָה קטן 25 DPF. ברי סולם: 200 מיקרומטר. אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

איור 2
איור 2. רמות Gene Expression מנורמלות של AMH, cyp19ala, nanos3 וושה בגזעים והאשכים מבודדים 17 DPF. מספרים של בעלי חיים המשמשים: קבוצת ביקורת, n = 15; קבוצת אֶשֶׁך, n = 35. רקמות הגזע בקבוצת הביקורת הנן ללא ראש מבני הזנב. הקבוצה שַׁחֲלָה מתייחסת רקמות האשכים המבודדות./files/ftp_upload/55294/55294fig2large.jpg" target = '_ blank'> אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

דג הזברה הפכה מודל עוצמה והוא משמש באופן נרחב בפיתוח ומחקר הקשורות למחלה. השיטות לבידוד איברי דג זברה מבוגרת כגון מוח, לב, בלוטת מין, ו בכליות, תועדו היטב 23, 24, 25. בשל גודלו הקטן שיפוץ דינמי של הרקמות האשכים של דג הזברה הזחל, הבידוד של רקמת האשכים היא משימה מאתגרת. מחקרים קודמים השתמשו ברקמות גזע גזור כולו או ושה מהונדס: תא המבוססת EGFP מיון microdissection לייזר לבחון את בלוטות המין הזחל 26. השינויים של כרומוזום 4 במהלך הביות מקבלים את החלטת מין תעלומה של דג הזברה המבויתת. השיטה שלנו המתואר כאן יכול לספק יחסית נקי מוקדם בהכנות שַׁחֲלָה לבדיקות מורפולוגיים ומולקולריים נוספת, אשר יכול להיות מועיל כדי לחקור את mech בקביעת מיןanisms.

זה לא קל להפריד את בלוטת המין בפיתוח ממבנים אחרים בבית מוקדם בשלבי הפיתוח. השיטה שלנו מתארת ​​כיצד לבצע את הנתיחה. כדי לבצע זאת בפרוטוקול בהצלחה, כמה צעדים קריטיים צריכים לציין. ראשית, מצב הצמיחה של דג זברת זחל הוא קריטי תוצאות צפויות תשואה. התפתחות האשכים של דג הזברה הזחל היא תהליך דינמי מאוד. הגודל והמראה של רקמות אשכים נקבעים לפי שלבי ההתפתחות של בעלי החיים 27. חשוב לשמור על קבוצות שונות של דג זברה במצב סטנדרטי. הגורמים שעשויים להשפיע על הצמיחה של זחלים כוללים צפיפות אוכלוסייה, משך אור מחזורים כהים, זמינויות מזון ולוחות זמני האכלה. המדידה באורך הסטנדרטית של דגי זחל יכולה לשמש כמדריך כדי לקבוע את מצב הגידול של בעלי החיים 22. גורם קריטי שני עבור בידוד ע רקמת אשכים המוצלחיון הוא הבנה טובה של המיקום היחסי ואת הבדלים מורפולוגיים בין בלוטות המין לבין הרקמות הסובבות. מכיוון שַׁחֲלָה ממוקמת בצד הגחון של בשלפוחית ​​השחייה, זה נוח בתחילה לבודד את בלוטות המין יחד עם בשלפוחית ​​השחייה. בנוסף, בקצה הדיסטלי של בלוטות המין מחובר בחוזקה אל הקצה הדיסטלי של בטן. אז צריך להיזהר בעת הוצאת המעיים מן שַׁחֲלָה בקצוות דיסטלי. עבור ניתוח ביטוי גנים לאחר מכן, חשוב להשתמש במדיה טרום צוננים צלחת אגרה, ולבצע את ההליך כולו במהירות.

שיטה דומה נוצלה בהצלחה על ידי RF Ketting ואח. 28. הם יישמו את שיטת הבידוד שַׁחֲלָה על חקירת הפונקציה של piRNAs ואת מסלול PIWI זחלי 3 שבועות בן. הנה, נתחנו רקמת אשכים מן זחלי דג זברה מוקדם ככל 17 DPF לחקור את פרופיל הביטוי זהה גן המולקולרי של develoשַׁחֲלָה דג הזברה פינג. ניתוחים מולקולריים העתיד של רקמת האשכים מבודדת מוקדם עשוי להתבצע כדי לקבוע את transcriptome, methylome ו acetylation היסטון דפוסים כדי להבהיר את המנגנונים שבבסיס התפתחות המין של דג הזברה.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

החוקרים מצהירים כי אין להם אינטרסים כלכליים מתחרים.

Acknowledgments

אנו מודים C ג'אנג לטיפול דגים. עבודה זו נתמכה על ידי הקרן הלאומית למדע הטבע של סין (31171074, 31371099 ו 31571067 כדי GP) ועל ידי פרויקט Talent ופאג'יאנג (09PJ1401900 כדי GP).

Materials

Name Company Catalog Number Comments
Cell culture dish 100 mm Corning 430167 For embryo incubation
20x EM For a 1 L needed: add 17.5 g NaCl, 0.75 g KCl and 2.9 g CaCl·2H2O; then add 0.41 g KH2PO4, 0.412 g Na2HPO4 anhydrous and 4.9 g MgSO4·7H2O.
1x EM Dilute 20x EM in distilled water
AGAROSE G-10 Gene 121985 For preparing the 2% agar plates
Trizol Reagent Invitrogen 15596-026 For RNA isolation
Meter glass Shen Bo 250 ml For preparing the 2% agar plates
Microwave Oven Midea M1-211A For heating the AGAR
Tweezer DUMONT#5INOX World Precision Instrument 500341 For dissection
Stereomicroscope Motic SMZ168 For dissection
Pure water equipment Millipore
Ringer’s solution For a 1 L needed: Add 6.78 g NaCl, 0.22 g KCl, 0.26 g CaCl2 and 1.19 g Hepes; then fill to 1 L; Adjust pH to 7.2. Sterilize by filtration and keep in an autoclaved clear polycarbonate container.
Transfer pipette Samco 202, 204
Metal bath QiLinbeier Model GL-150
Microscope Leica  M205 FA For photomicrograph
Centrifuge Eppendorf 5417R
Micro Scale RNA Isolation Kit Ambion AM1931 For RNA isolation from gonad tissues
Dnase I Sigma AMPD1-1KT For DNA digestion in the RNA solution
RevertAid First Strand cDNA Synthesis Kit Thermo Scientific #K1631 For first-strand cDNA synthesis
Rnase H Thermo Scientific #EN0202 For digesting the residual RNA in the cDNA solution.
SYBR Green Realtime PCR Master Mix TOYOBO QPK-201 This product is a Taq DNA polymerase-based 2x master mix for real-time PCR and  applicable for intercalation assay with SYBR Green I.
Spectrophotometer Ne Drop OD-2000+ Measuring the concentration of the total RNA
Mastercycler Eppendorf AG 22331 Hamburg gene expression profiling

DOWNLOAD MATERIALS LIST

References

  1. Wilson, C. A., et al. Wild sex in zebrafish: loss of the natural sex determinant in domesticated strains. Genetics. 198, (3), 1291-1308 (2014).
  2. Liew, W. C., Orban, L. Zebrafish sex: a complicated affair. Genomics. 13, (2), 172-187 (2014).
  3. Orban, L., Sreenivasan, R., Olsson, P. Long and winding roads: Testis differentiation in zebrafish. Mol. Cell. Endocrinol. 312, (1-2), 35-41 (2009).
  4. Blaser, H., et al. Transition from non-motile behaviour to directed migration during early PGC development in zebrafish. J. Cell Sci. 118, 4027-4038 (2005).
  5. Wang, X. G., Orban, L. Anti-Müllerian hormone and 11 β-hydroxylase show reciprocal expression to that of aromatase in the transforming gonad of zebrafish males. Dev. Dynam. 236, (5), 1329-1338 (2007).
  6. Siegfried, K. R., Nüsslein-Volhard, C. Germ line control of female sex determination in zebrafish. Dev. Biol. 324, (2), 277-287 (2008).
  7. Uchida, D., Yamashita, M., Kitano, T., Iguchi, T. Oocyte apoptosis during the transition from ovary-like tissue to testes during sex differentiation of juvenile zebrafish. J. Exp. Biol. 205, (Pt 6), 711-718 (2002).
  8. Groh, K. J., Schönenberger, R., Eggen, R. I. L., Segner, H., Suter, M. J. F. Analysis of protein expression in zebrafish during gonad differentiation by targeted proteomics. Gen. Comp. Endocr. 193, 210-220 (2013).
  9. Siegfried, K. R. In search of determinants: gene expression during gonadal sex differentiation. J. Fish Biol. 76, (8), 1879-1902 (2010).
  10. Small, C. M., Carney, G. E., Mo, Q., Vannucci, M., Jones, A. G. A microarray analysis of sex- and gonad-biased gene expression in the zebrafish: evidence for masculinization of the transcriptome. BMC Genomics. 10, 579 (2009).
  11. Chiang, E. F., Yan, Y. L., Guiguen, Y., Postlethwait, J., Chung, B. Two Cyp19 (P450 aromatase) genes on duplicated zebrafish chromosomes are expressed in ovary or brain. Mol. Biol. Evol. 18, (4), 542-550 (2001).
  12. Kishida, M., Callard, G. V. Distinct cytochrome P450 aromatase isoforms in zebrafish (Danio rerio) brain and ovary are differentially programmed and estrogen regulated during early development. Endocrinology. 142, (2), 740-750 (2001).
  13. Rodríguez-Marí, A., et al. Characterization and expression pattern of zebrafish anti-Müllerian hormone (amh) relative to sox9a, sox9b, and cyp19a1a, during gonad development. Gene Expr.Patterns. 5, (5), 655-667 (2005).
  14. Krovel, A. V., Olsen, L. C. Expression of a vas::EGFP transgene in primordial germ cells of the zebrafish. Mech Dev. 116, (1-2), 141-150 (2002).
  15. Krovel, A. V., Olsen, L. C. Sexual dimorphic expression pattern of a splice variant of zebrafish vasa during gonadal development. Dev. Biol. 271, (1), 190-197 (2004).
  16. Tzung, K. W., et al. Early depletion of primordial germ cells in zebrafish promotes testis formation. Stem Cell Reports. 4, (1), 61-73 (2015).
  17. Hsiao, C., Tsai, H. Transgenic zebrafish with fluorescent germ cell: a useful tool to visualize germ cell proliferation and juvenile hermaphroditism in vivo. Dev. Biol. 262, (2), 313-323 (2003).
  18. Jorgensen, A., Nielsen, J. E., Morthorst, J. E., Bjerregaard, P., Leffers, H. Laser capture microdissection of gonads from juvenile zebrafish. Reprod Biol Endocrinol. 7, 97 (2009).
  19. Chen, S., Zhang, H., Wang, F., Zhang, W., Peng, G. nr0b1 (DAX1) mutation in zebrafish causes female-to-male sex reversal through abnormal gonadal proliferation and differentiation. Mol. Cell. Endocrinol. 433, 105-116 (2016).
  20. Westerfield, M. The Zebrafish Book: A Guide for The Laboratory Use of Zebrafish (Danio rerio). Eugene: University of Oregon Press. University of Oregon. (2000).
  21. Liew, W. C., et al. Polygenic sex determination system in zebrafish. PLoS One. 7, (4), e34397 (2012).
  22. Parichy, D. M., Elizondo, M. R., Mills, M. G., Gordon, T. N., Engeszer, R. E. Normal table of postembryonic zebrafish development: staging by externally visible anatomy of the living fish. Dev Dyn. 238, (12), 2975-3015 (2009).
  23. Gupta, T., Mullins, M. C. Dissection of Organs from the Adult Zebrafish. J. Vis Exp. (37), (2010).
  24. Arnaout, R., Reischauer, S., Stainier, D. Y. R. Recovery of Adult Zebrafish Hearts for High-throughput Applications. J. Vis Exp. (94), (2014).
  25. Gerlach, G. F., Schrader, L. N., Wingert, R. A. Dissection of the Adult Zebrafish Kidney. J. Vis Exp. (54), (2011).
  26. Yoon, C., Kawakami, K., Hopkins, N. Zebrafish vasa homologue RNA is localized to the cleavage planes of 2- and 4-cell-stage embryos and is expressed in the primordial germ cells. Development. 124, (16), 3157-3165 (1997).
  27. Braat, A. K., Speksnijder, J. E., Zivkovic, D. Germ line development in fishes. Int. J. Dev. Biol. 43, (7), 745-760 (1999).
  28. Huang, H. Y., Ketting, R. F. Isolation of zebrafish gonads for RNA isolation. Methods Mol Biol. 1093, 183-194 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics