La dissezione del larvale Zebrafish gonadica Tissue

* These authors contributed equally
Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Qui, vi presentiamo un protocollo per isolare il tessuto gonadico di zebrafish larvale, che faciliterà le indagini della differenziazione sessuale zebrafish e manutenzione.

Cite this Article

Copy Citation | Download Citations

Wang, X., Chen, S., Zhang, W., Ren, Y., Zhang, Q., Peng, G. Dissection of Larval Zebrafish Gonadal Tissue. J. Vis. Exp. (122), e55294, doi:10.3791/55294 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Anche se zebrafish selvatici in possesso di un / ZW determinazione del sesso ZZ, zebrafish addomesticato hanno perso il cromosoma sessuale. Essi utilizzano un sistema di determinazione del sesso poligenica, in cui diversi geni distribuiti in tutto il genoma determinare collettivamente le identità sessuali di singoli pesci. Attualmente, i geni coinvolti nella regolazione dello sviluppo delle gonadi e come funzionano rimangono sfuggente. Normalmente, isolando tessuto gonadico è il primo passo per esaminare i processi di sviluppo del sesso. Qui vi presentiamo una procedura per isolare il tessuto gonadico da 17 dpf (giorni dopo la fecondazione) e 25 dpf larve di zebrafish. Il tessuto gonadico isolato può essere successivamente esaminati dalla morfologia e l'espressione genica.

Introduction

Il principale determinante del sesso femminile nel selvaggio cromosoma zebrafish 4 è perso o modificato nel zebrafish addomesticato (vale a dire i ceppi più comuni di laboratorio) 1. Al contrario, hanno un sistema di determinazione del sesso poligenica accompagnato da fattori ambientali come la temperatura, l'ipossia, la disponibilità di cibo e la densità di popolazione. I meccanismi dettagliati dello sviluppo sessuale zebrafish non sono pienamente compresi. Domande fondamentali come quando si verifica determinazione del sesso zebrafish, ciò che il segnale determinazione sessuale primaria (s) è / sono, e quali geni regolano il primo passo di trasformazione gonadi restano da risolvere 2, 3.

Nel processo di sviluppo sessuale zebrafish, più tappe importanti sono state riconosciute. Nella fase iniziale di sviluppo, a partire dal 4 HPF (ore dopo la fecondazione) cellule germinali primordiali (PGC) sottoporsi specifica, migrazione cresta genitale eproliferazione. Numeri PGC e interazioni reciproche tra cellule germinali e cellule somatiche sono importanti per gonadi differenziazione 4. A 13 dpf (giorni dopo la fecondazione), le gonadi sono in fase indifferenziata. Con 17 DPF, le gonadi si sviluppano in ovaie bi-potenziali in entrambi i maschi e femmine futuri. La transizione apoptosi dipendente da ovaio al testicolo inizio alle 21 a 25 dpf e può continuare per diverse settimane. Da 35 dpf, il sesso della gonade è stata determinata e produzione di gameti sesso-specifico è in corso in entrambe le ovaie e testicoli 5, 6, 7.

Fino ad oggi, sono stati proposti diversi geni candidati ei meccanismi di determinazione del sesso. Proteomica e analisi trascrittomica hanno isolato molti geni con espressione dimorfismo sessuale e questi geni sono stati utilizzati per studiare la differenziazione del sesso in zebrafish 8, 9, 10. Ad esempio, in zebrafish larvale, il gene cyp19a1a è specificamente espresso nelle ovaie, ma non nel testicolo 11, 12. Inoltre, gene amh è debolmente espressa nelle cellule follicolo granulosa ovarica, ma fortemente nei testicoli cellule di Sertoli 13. Al contrario, gene vasa continuamente espresso nelle cellule germinali sia zebrafish maschile e femminile, che lo rendono adatto marcatore gonadi 14, 15.

Indagare gonadici livelli di espressione genica è fondamentale per capire il meccanismo molecolare di determinazione del sesso e la differenziazione soprattutto nella fase ovaie bi-potenziale 3, 9. Tuttavia, le piccole dimensioni delle zebrafish larvale e corrispondentemente piccole gonadi complicare l'isolamento di gonadal tessuti per ulteriori analisi molecolari. Precedenti studi utilizzati sezionati tutta la regione del tronco tra l'opercoli e pori anale 16. Questa preparazione, anche se contenenti gonadi, costituito da più tessuti e organi. In alternativa, gli animali transgenici con espressione GFP specifico gonade come vasa: EGFP sono stati usati per l'isolamento tessuto gonadico mediante fluorescenza delle cellule attivate (FACS) e la cattura laser micro-dissezione 17, 18. Ma la loro applicazione diffusa è limitata. Qui, descriviamo una semplice procedura per isolare il tessuto gonadico da zebrafish larvale a 17 dpf e 25 dpf. Dimostriamo la posizione delle gonadi rispetto ad altri organi e isolare le gonadi morfologicamente intatte dai tessuti circostanti. Mostriamo ulteriormente i geni specifici gonade come vasa e cyp19a1a sono altamente espresso nelle gonadi isolate rispetto al tessuto tronco tramite PCR quantitativa (qPCR) analisi. Il presente protocollo permette l'identificazione, l'isolamento, la purificazione dell'RNA e l'amplificazione di geni specifici gonadici da zebrafish larvale, consentendo così successiva analisi molecolare del tessuto gonadica 19.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Esperimenti zebrafish sono stati approvati dal Comitato Istituzionale cura degli animali e Usa Fudan University. Zebrafish sono state sollevate e allevati secondo le procedure standard 20.

1. preparativi

  1. Coltivare 17 dpf e 25 dpf zebrafish larvale
    1. Trasferimento 2 maschi e 2 femmine zebrafish adulti (in buona salute, da 3 a 6 mesi di età, di laboratorio AB strain) ad un serbatoio traversata nel tardo pomeriggio prima del giorno traversata. Separare i maschi e le femmine con una barriera. La mattina seguente, rinfrescare l'acqua della vasca e togliere la barriera per consentire loro di accoppiarsi. Raccogliere uova a 100 mm di Petri 1 a 2 h dopo la fecondazione.
    2. Tenere circa 40 embrioni in un piatto 100 millimetri con 40 ml di media embrione (EM) a 28,5 ° C durante il periodo di sviluppo iniziale (4 giorni) e aggiornare la EM due volte al giorno. Trasferimento larve a 1 serbatoi L (40 larve per 300 dell'acqua del sistema mL) e si nutrono con rotiferi dal vivo (fornitura completa, due volte al giorno), dopo 5 dpf.Live feed artemie, invece di dieta rotifero dopo 10 dpf. Trasferire il pesce nel sistema ricircolo dell'acqua a 14 dpf 21.
    3. Sollevare zebrafish larvale nel sistema di ricircolo dell'acqua fino al 17 dpf o 25 dpf. Garantire il ciclo luce / buio è 14/10 h ed il pH valore dell'acqua sistema è di circa 7.2. Misurare la lunghezza del corpo di 17 dpf (5,5 a 6,8 millimetri) e 25 dpf (da 8 a 11 mm) larve 22.
  2. Preparare 2% agar per la dissezione.
    1. Aggiungere 4 g di agar a 200 ml di acqua sterile. Scaldare la miscela in un forno a microonde fino a quando si scopre trasparente.
    2. Raffreddare la soluzione di agar per circa 15 minuti, poi versarlo in 60 mm di diametro Petri piatti (circa 1/3 del volume della piastra). Conservare le piastre di agar solidificato a 4 ° C.

2. Protocollo 1: sezionare il tessuto gonadico del 17 e 25 dpf Larve

  1. Aggiungere ghiaccio tritato nel serbatoio per anestetizzare 17 dpf larve. trasferire illarve anestetizzato a un 100 mm refrigerate Petri con la soluzione di 30 ml di freddo Ringer. Mantenere il pesce incubate in soluzione della refrigerate di Ringer per almeno 15 minuti per anestetizzare completamente le larve.
  2. Trasferire le larve di una piastra di agar pre-raffreddata con un cucchiaio di plastica di piccole dimensioni. Immergere l'intero corpo di pesce in 10 ml refrigerate soluzione di Ringer e delicatamente adagiarla su un fianco.
  3. Effettuare le seguenti operazioni sotto il campo di visione stereo microscopio 25X. Bloccare il tronco di pesce con una pinzetta per la stabilizzazione. Strappare l'addome longitudinalmente dall'ano al cuore con un altro paio di pinzette. Rimuovere delicatamente la pelle ed i muscoli su un lato del corpo per esporre gli organi interni.
  4. Rimuovere la massa di organi ventrali alla vescica natatoria con attenzione. Evitare di danneggiare gonade attaccato alla vescica natatoria.
  5. Tagliare il collegamento tra la vescica natatoria e il corpo anteriore. Estrarre l'intera vescica natatoria e tessuto gonadico delicatamente.
    NOTA: Nella maggior parte casos, il tessuto gonadico a 17 dpf contiene circostante tessuto epiteliale e protonephridium. Essi non sono facilmente separati l'uno dall'altro, ma a 25 dpf può essere facilmente separati. Gonade è collegato anche l'ano. Una giunzione con gonadi sinistra e destra collegati tra loro alle ano sarà chiaramente visibile.
  6. Utilizzare le pinzette per separare con attenzione il tessuto gonadico dalla vescica natatoria e ripulire i tessuti adiposi circostanti.
  7. trasferire immediatamente il tessuto gonadico isolato ad un prechilled 1,5 mL provetta contenente una soluzione di 200 microlitri Ringer. Tenere la provetta in ghiaccio fino a quando tutti i tessuti gonadici sono separati dal larve.
  8. Sezionare le gonadi di 25 DPF larve come descritto nei punti 2.1 - 2.7.

3. Protocollo 2: Analisi di espressione genica dei tessuti gonadici isolati

  1. Estrarre l'RNA totale dai tessuti gonadici larvali.
    1. Trasferire i isolati tessuti gonadici ad un nuovo RNase-free 1.5 ml di tubo e rimuovere soluzione di Ringer. Aggiungere 100 microlitri soluzione di lisi. Vortice finché i tessuti sono completamente lisato.
    2. Eseguire la procedura di estrazione dell'RNA totale secondo le istruzioni del produttore.
    3. Aggiungere 1/10 volume di 10x DNasi I buffer e 1 ml di DNasi I per la soluzione di RNA e mescolare delicatamente. Incubare per 20 minuti a 37 ° C.
    4. Aggiungere 1/10 del volume di reagente DNasi inattivazione alla soluzione di RNA. Incubare per 10 minuti a 70 ° C. Misurare la concentrazione di RNA totale utilizzando uno spettrofotometro. Conservare a -20 ° C.
  2. Eseguire sintesi del DNA prima filamento
    1. Utilizzare un oligo (dT) Primer -linker per eseguire la sintesi del primo filamento di cDNA seguendo il protocollo del produttore. Aggiungere 1 a 2 mg di RNA per un volume totale di reazione a 20 ml.
    2. Incubare la soluzione di reazione per 90 minuti a 45 ° C. Terminare la reazione mediante riscaldamento a 70 ° C per 5 min.
    3. Aggiungere 1 ml RNasi H al cDNA cosìluzione per rimuovere l'RNA residua. Mescolare delicatamente e centrifugare per 10 s a ~ 13.000 x g. Incubare per 20 minuti a 37 ° C. Aggiungere 20 ml di acqua priva di nucleasi. Conservare a -70 ° C.
  3. Eseguire fluorescente PCR quantitativa
    1. Eseguire qPCR su un sistema ciclatore con un colorante fluorescente. Utilizzare i seguenti PCR condizioni di ciclo: 35 cicli a 95 ° C per 15 s, Tm-5 ° C per 15 s, 68 ° C per 30 s. Utilizzare sequenze primer come segue: AMH (fwd: GTGGATGGCAGCAGTACGAC; rev: GCGGAGAGGTGGAAGAGAGAATG), cyp19a1a (fwd: GTCCTGTTGTCTCCTACTGTCG; rev: CATTTGAGTTGAATATGATGCCCTG), nanos3 (fwd: GCTCGGTGTACGCCAAATCAACAT; rev: CCAAGTGAAAACACAACACCAGTGC), vasa (fwd: ATCGCATAGGAAGAACTGGACGCT; rev: CCAAGTGAAAACACAACACCAGTGC) e β-actina (fwd: AGTGCGACGTGGACATCCGTA; rev: GCACTTCCTGTGGACGATGGA) 19.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Dissezioni delle gonadi sono state effettuate su AB strain zebrafish larvale. La figura 1 mostra tessuto tipico gonadi di zebrafish larvale a 17 dpf e 25 dpf. In primo luogo, la pelle ei muscoli di un lato dell'addome viene tagliato per esporre gli organi interni. Dopo aver rimosso la massa degli organi interni, la vescica natatoria insieme gonade rimangono nel bagagliaio. Gonade era attaccato alla faccia ventrale vescica natatoria (freccia in Figura 1B '). A 17 dpf, gonade era in fase di ovaio bi-potenziale. Gonade isolato conteneva la sinistra e la destra gonadi e stato traslucido (Figura 1C). Nella maggior parte dei casi, è stato circondato da tessuto epiteliale e protonephridium (freccia in Figura 1C). Al 25 dpf gonade era spesso avvolta da tessuti adiposi (Figura 1D). A questo sviluppo stl'età, sia grande o piccolo gonade può osservare. L'ovaio immaturo è grande come lo sviluppo degli ovociti secondari, e cellule follicolari aumentare il volume delle gonadi (Figura 1E). Testicolo immaturo è piccolo a causa della degenerazione e apoptosi dell'ovaio larvale (Figura 1F).

Per analizzare le proprietà molecolari dei tessuti gonadici isolati, abbiamo prima esaminato gene livelli di espressione di AMH, cyp19a1a, nanos3 e vasa, quattro marcatori gonadi in zebrafish, di qPCR. L'RNA totale è stato estratto dai tessuti larvali gonadici (n = 35) utilizzando un kit di isolamento di RNA. Inoltre, abbiamo rimosso la testa e la coda 17 dpf larva, e usato il tessuto tronco (tra la struttura del cuore e poro anale) per estrarre l'RNA come il gruppo di controllo (n = 15). Il tessuto tronco compreso la pelle, muscoli, ossa (vertebre e costole), vescica natatoria, rene e gonadi. Oligo dT-primed cDNA è stato utilizzato per qPCR. Il risultato qPCR mostrato aumenti nei livelli di AMH, cyp19a1a, nanos3 ed espressione vasa in 17 tessuto gonadico dpf isolato di circa 397, 342, 45 e 170 volte, rispettivamente (figura 2).

Figura 1
Figura 1. microfotografie di Tipici gonadici tessuti larvali Zebrafish a 17 dpf e 25 dpf. (A) Rip pelle e dei muscoli di un lato del ventre per esporre gli organi interni con uno stereo microscopio 25X. (B) Dopo aver rimosso la massa degli organi interni, la vescica natatoria e gonade rimanere attaccato al tronco. (B ') vista della scatola rossa amplificato in pannello B per mostrare la posizione relativa della vescica natatoria e gonade. Gonade è indicato dalla freccia. (C) Iso lata tessuto gonadico a 17 dpf. I tessuti neri nell'immagine (frecce) sono il tessuto endoteliale e protonephridium attaccato gonadi. (DE) Un grande gonadi prima e dopo la rimozione del tessuto adiposo a 25 dpf. (F) Una piccola gonade a 25 dpf. Barre di scala: 200 micron. Si prega di cliccare qui per vedere una versione più grande di questa figura.

figura 2
Figura 2. normalizzate livelli di espressione genica di amh, cyp19ala, nanos3 e vasa nei tronchi e dalle gonadi isolato a 17 dpf. Numero di animali usati: gruppo di controllo, n = 15; gruppo gonadi, n = 35. I tessuti tronco del gruppo di controllo sono senza la testa e le strutture posteriori. gruppo gonadi si riferisce ai tessuti gonadici isolati./files/ftp_upload/55294/55294fig2large.jpg" target = '_ blank'> Clicca qui per vedere una versione più grande di questa figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Il pesce zebra è diventato un modello potente ed è ampiamente utilizzato nello sviluppo e nella ricerca sulle malattie correlate. I metodi per l'isolamento degli organi in zebrafish adulti come il cervello, il cuore, gonadi, e del rene, sono stati ben documentati 23, 24, 25. A causa delle piccole dimensioni e rimodellamento dinamica dei tessuti gonadici nella zebrafish larvale, isolamento di tessuto gonadico è un compito impegnativo. Precedenti studi utilizzati interi sezionato tessuti tronco o vasa transgenici: l'ordinamento delle cellule basato EGFP e microdissezione laser per esaminare le gonadi larvali 26. Le modifiche del cromosoma 4 durante addomesticamento rende la determinazione del sesso un mistero nel zebrafish addomesticato. Il nostro metodo qui descritto può fornire preparati gonade relativamente pulito e l'inizio di ulteriori esami morfologici e molecolari, che può essere utile per esplorare il mech che determina il sessomec-.

Non è facile separare gonade in via di sviluppo da altre strutture nelle prime fasi di sviluppo. Il nostro metodo descrive come eseguire la dissezione. Per eseguire con successo questo protocollo, alcuni passaggi critici hanno bisogno di essere notato. In primo luogo, la condizione di crescita zebrafish larvale è fondamentale per producano risultati attesi. Lo sviluppo delle gonadi di zebrafish larvale è un processo altamente dinamico. La dimensione e l'aspetto dei tessuti gonadici sono determinati dalle fasi di sviluppo degli animali 27. E 'importante mantenere diversi lotti di zebrafish in condizioni standardizzate. I fattori che possono influenzare la crescita delle larve includono densità di popolazione, la durata di luce e buio cicli, la disponibilità di cibo e protocolli di alimentazione. La misurazione lunghezza standard delle larve può essere utilizzato come guida per determinare lo stato di crescita degli animali 22. Un secondo fattore critico per il successo isolat tessuto gonadicoione è una buona comprensione della posizione relativa e differenze morfologiche tra le gonadi e dei tessuti circostanti. A causa della gonade si trova al lato ventrale della vescica natatoria, è conveniente per isolare inizialmente gonadi insieme alla vescica natatoria. Inoltre, l'estremità distale delle gonadi è strettamente attaccato alla estremità distale del budello. Quindi, si deve fare attenzione quando si rimuove l'intestino dalla gonade alle estremità distali. Per la successiva analisi di espressione genica, è essenziale per utilizzare i media pre-refrigerati e piastra di agar, ed eseguire l'intera procedura in fretta.

Un metodo simile è stato con successo utilizzato da RF Ketting et al. 28. Hanno applicato il metodo di isolamento delle gonadi per indagare la funzione di piRNAs e il percorso PIWI in 3 settimane di età larve. Qui, abbiamo sezionato tessuto gonadico da larve di pesce zebra fin dal 17 DPF per esplorare l'identità e profilo di espressione genica molecolare del sviping gonadi zebrafish. analisi molecolari future del tessuto gonadico isolato anteriore possono essere eseguiti per determinare transcriptome, metiloma e istoni schemi per illustrare i meccanismi alla base dello sviluppo sesso in zebrafish.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori dichiarano di non avere interessi finanziari in competizione.

Acknowledgments

Ringraziamo C Zhang per la cura dei pesci. Questo lavoro è stato sostenuto dalla National Science Foundation naturali della Cina (31.171.074, 31.371.099 e 31.571.067 di GP) e dal talento Progetto Pujiang (09PJ1401900 a GP).

Materials

Name Company Catalog Number Comments
Cell culture dish 100 mm Corning 430167 For embryo incubation
20x EM For a 1 L needed: add 17.5 g NaCl, 0.75 g KCl and 2.9 g CaCl·2H2O; then add 0.41 g KH2PO4, 0.412 g Na2HPO4 anhydrous and 4.9 g MgSO4·7H2O.
1x EM Dilute 20x EM in distilled water
AGAROSE G-10 Gene 121985 For preparing the 2% agar plates
Trizol Reagent Invitrogen 15596-026 For RNA isolation
Meter glass Shen Bo 250 ml For preparing the 2% agar plates
Microwave Oven Midea M1-211A For heating the AGAR
Tweezer DUMONT#5INOX World Precision Instrument 500341 For dissection
Stereomicroscope Motic SMZ168 For dissection
Pure water equipment Millipore
Ringer’s solution For a 1 L needed: Add 6.78 g NaCl, 0.22 g KCl, 0.26 g CaCl2 and 1.19 g Hepes; then fill to 1 L; Adjust pH to 7.2. Sterilize by filtration and keep in an autoclaved clear polycarbonate container.
Transfer pipette Samco 202, 204
Metal bath QiLinbeier Model GL-150
Microscope Leica  M205 FA For photomicrograph
Centrifuge Eppendorf 5417R
Micro Scale RNA Isolation Kit Ambion AM1931 For RNA isolation from gonad tissues
Dnase I Sigma AMPD1-1KT For DNA digestion in the RNA solution
RevertAid First Strand cDNA Synthesis Kit Thermo Scientific #K1631 For first-strand cDNA synthesis
Rnase H Thermo Scientific #EN0202 For digesting the residual RNA in the cDNA solution.
SYBR Green Realtime PCR Master Mix TOYOBO QPK-201 This product is a Taq DNA polymerase-based 2x master mix for real-time PCR and  applicable for intercalation assay with SYBR Green I.
Spectrophotometer Ne Drop OD-2000+ Measuring the concentration of the total RNA
Mastercycler Eppendorf AG 22331 Hamburg gene expression profiling

DOWNLOAD MATERIALS LIST

References

  1. Wilson, C. A., et al. Wild sex in zebrafish: loss of the natural sex determinant in domesticated strains. Genetics. 198, (3), 1291-1308 (2014).
  2. Liew, W. C., Orban, L. Zebrafish sex: a complicated affair. Genomics. 13, (2), 172-187 (2014).
  3. Orban, L., Sreenivasan, R., Olsson, P. Long and winding roads: Testis differentiation in zebrafish. Mol. Cell. Endocrinol. 312, (1-2), 35-41 (2009).
  4. Blaser, H., et al. Transition from non-motile behaviour to directed migration during early PGC development in zebrafish. J. Cell Sci. 118, 4027-4038 (2005).
  5. Wang, X. G., Orban, L. Anti-Müllerian hormone and 11 β-hydroxylase show reciprocal expression to that of aromatase in the transforming gonad of zebrafish males. Dev. Dynam. 236, (5), 1329-1338 (2007).
  6. Siegfried, K. R., Nüsslein-Volhard, C. Germ line control of female sex determination in zebrafish. Dev. Biol. 324, (2), 277-287 (2008).
  7. Uchida, D., Yamashita, M., Kitano, T., Iguchi, T. Oocyte apoptosis during the transition from ovary-like tissue to testes during sex differentiation of juvenile zebrafish. J. Exp. Biol. 205, (Pt 6), 711-718 (2002).
  8. Groh, K. J., Schönenberger, R., Eggen, R. I. L., Segner, H., Suter, M. J. F. Analysis of protein expression in zebrafish during gonad differentiation by targeted proteomics. Gen. Comp. Endocr. 193, 210-220 (2013).
  9. Siegfried, K. R. In search of determinants: gene expression during gonadal sex differentiation. J. Fish Biol. 76, (8), 1879-1902 (2010).
  10. Small, C. M., Carney, G. E., Mo, Q., Vannucci, M., Jones, A. G. A microarray analysis of sex- and gonad-biased gene expression in the zebrafish: evidence for masculinization of the transcriptome. BMC Genomics. 10, 579 (2009).
  11. Chiang, E. F., Yan, Y. L., Guiguen, Y., Postlethwait, J., Chung, B. Two Cyp19 (P450 aromatase) genes on duplicated zebrafish chromosomes are expressed in ovary or brain. Mol. Biol. Evol. 18, (4), 542-550 (2001).
  12. Kishida, M., Callard, G. V. Distinct cytochrome P450 aromatase isoforms in zebrafish (Danio rerio) brain and ovary are differentially programmed and estrogen regulated during early development. Endocrinology. 142, (2), 740-750 (2001).
  13. Rodríguez-Marí, A., et al. Characterization and expression pattern of zebrafish anti-Müllerian hormone (amh) relative to sox9a, sox9b, and cyp19a1a, during gonad development. Gene Expr.Patterns. 5, (5), 655-667 (2005).
  14. Krovel, A. V., Olsen, L. C. Expression of a vas::EGFP transgene in primordial germ cells of the zebrafish. Mech Dev. 116, (1-2), 141-150 (2002).
  15. Krovel, A. V., Olsen, L. C. Sexual dimorphic expression pattern of a splice variant of zebrafish vasa during gonadal development. Dev. Biol. 271, (1), 190-197 (2004).
  16. Tzung, K. W., et al. Early depletion of primordial germ cells in zebrafish promotes testis formation. Stem Cell Reports. 4, (1), 61-73 (2015).
  17. Hsiao, C., Tsai, H. Transgenic zebrafish with fluorescent germ cell: a useful tool to visualize germ cell proliferation and juvenile hermaphroditism in vivo. Dev. Biol. 262, (2), 313-323 (2003).
  18. Jorgensen, A., Nielsen, J. E., Morthorst, J. E., Bjerregaard, P., Leffers, H. Laser capture microdissection of gonads from juvenile zebrafish. Reprod Biol Endocrinol. 7, 97 (2009).
  19. Chen, S., Zhang, H., Wang, F., Zhang, W., Peng, G. nr0b1 (DAX1) mutation in zebrafish causes female-to-male sex reversal through abnormal gonadal proliferation and differentiation. Mol. Cell. Endocrinol. 433, 105-116 (2016).
  20. Westerfield, M. The Zebrafish Book: A Guide for The Laboratory Use of Zebrafish (Danio rerio). Eugene: University of Oregon Press. University of Oregon. (2000).
  21. Liew, W. C., et al. Polygenic sex determination system in zebrafish. PLoS One. 7, (4), e34397 (2012).
  22. Parichy, D. M., Elizondo, M. R., Mills, M. G., Gordon, T. N., Engeszer, R. E. Normal table of postembryonic zebrafish development: staging by externally visible anatomy of the living fish. Dev Dyn. 238, (12), 2975-3015 (2009).
  23. Gupta, T., Mullins, M. C. Dissection of Organs from the Adult Zebrafish. J. Vis Exp. (37), (2010).
  24. Arnaout, R., Reischauer, S., Stainier, D. Y. R. Recovery of Adult Zebrafish Hearts for High-throughput Applications. J. Vis Exp. (94), (2014).
  25. Gerlach, G. F., Schrader, L. N., Wingert, R. A. Dissection of the Adult Zebrafish Kidney. J. Vis Exp. (54), (2011).
  26. Yoon, C., Kawakami, K., Hopkins, N. Zebrafish vasa homologue RNA is localized to the cleavage planes of 2- and 4-cell-stage embryos and is expressed in the primordial germ cells. Development. 124, (16), 3157-3165 (1997).
  27. Braat, A. K., Speksnijder, J. E., Zivkovic, D. Germ line development in fishes. Int. J. Dev. Biol. 43, (7), 745-760 (1999).
  28. Huang, H. Y., Ketting, R. F. Isolation of zebrafish gonads for RNA isolation. Methods Mol Biol. 1093, 183-194 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics