Brug Syntetisk Biologi Engineer levende celler der Grænseflade med Programmable Materials

* These authors contributed equally
JoVE Journal
Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Denne artikel præsenterer en række protokoller til at udvikle manipulerede celler og funktionaliserede overflader, der muliggør syntetisk manipuleret E. coli til at kontrollere og manipulere programmerbare materiale overflader.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Heyde, K. C., Scott, F. Y., Paek, S. H., Zhang, R., Ruder, W. C. Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials. J. Vis. Exp. (121), e55300, doi:10.3791/55300 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Vi har udviklet en abiotisk-biotiske interface, der tillader manipulerede celler for at kontrollere materialeegenskaber en funktionaliseret overflade. Dette system er lavet ved at skabe to moduler: et syntetisk manipuleret stamme af E. coli-celler og en funktionaliseret materiale interface. Inden dette papir, vi detalje en protokol for gensplejsning af udvalgte adfærd inden for en stamme af E. coli ved hjælp af molekylær kloning strategier. Når udviklet, denne stamme producerer forhøjede niveauer af biotin når den udsættes for en kemisk inducer. Desuden har vi detalje protokoller for at oprette to forskellige funktionaliserede overflader, som hver især er i stand til at reagere på celle-syntetiserede biotin. Tilsammen præsenterer vi en metode til at skabe en sammenkædet, abiotisk-biotiske system, der tillader manipulerede celler til kontrol materialesammensætningen og montage på ikke levende substrater.

Introduction

Her rapporterer vi procedurerne for at udvikle en programmerbar substrat i stand til at reagere på et kemisk signal fra en manipuleret celle linje. 1 Det gør vi ved at skabe en biotin-streptavidin grænseflade, der reagerer på biotin produceret af celler syntetisk manipuleret Escherichia coli (E. coli). Tidligere har programmerbare overflader blevet udviklet til en bred vifte af applikationer fra toksin afsløring 2 og point-of-care diagnostik 3 til forsvar og sikkerhed. 4 Mens programmerbare overflader kan være nyttige som sensorer og aktuatorer, kan de gøres "smartere" ved at give dem mulighed for at tilpasse sig forskellige miljøudfordringer. I modsætning hertil selv simple mikroorganismer, såsom E. coli, har iboende tilpasningsevne og er i stand til at reagere på udfordringer med avancerede og ofte uventede løsninger. Denne tilpasningsevne har gjort det muligt E.coli befolkninger, der kontrolleres af deres komplekse gen netværk, på en omkostningseffektiv måde søger ressourcer, 5 skabe værdiskabende produkter, 6 og endda magt mikro-skala robotteknologi. 7 Ved at koble de adaptive fordele ved levende celler med brug af programmerbare overflader, kan vi skabe en smart substrat i stand til at reagere på forskellige miljøforhold.

Syntetisk biologi har givet forskere nye evner til at programmere adfærd levende organismer. By engineering celler til at indeholde nye gen regulatoriske netværk, kan forskerne designe celler, der udviser en række programmerede adfærd. 8, 9 Beyond grundforskning, kan disse adfærdsmønstre anvendes til applikationer såsom kontrollere materiale samling og biologisk producerer forædlede produkter. 10 Heri vi detaljer, hvordan vi brugte de værktøjer syntetisk biologi til engineer en E. coli stamme, der syntetiserer biotin efter induktion. Denne stamme blev udviklet ved anvendelse af restriktionsenzym kloningsmetoder at samle et plasmid, pKE1-lacI-bioB. Dette plasmid, når det blev transformeret ind i E. coli stamme K-12 MG1655, forlener celler med evnen til at udtrykke forhøjede niveauer af bioB, et essentielt enzym til biotin syntese. Når transformerede celler blev induceret med isopropyl β-D-1-thiogalactopyranosid (IPTG) og er forsynet med en biotin-precursor, desthiobiotin (DTB), blev forhøjede niveauer af biotin produceret.

Biotin er bindende interaktion med streptavidin er en af ​​de stærkeste ikke-kovalente bindinger findes i naturen. Som sådan biotin-streptavidin interaktion er både velkarakteriserede og højt ansat i bioteknologi. 11 Inden for dette manuskript, præsenterer vi to strategier anvender biotin-streptavidin interaktion til at sanse og opdage celle-producerede biotin med en funktionaliseret overflade. Vihenvise til disse modsatrettede overflader som "indirekte" og "direkte" kontrol ordninger. I indirekte kontrol ordning, celle-produceret biotin konkurrerer med biotin, som er blevet konjugeret og immobiliseres på en polystyren-overflade til streptavidin bindingssteder. Desuden er streptavidin konjugeret med peberrodsperoxidase (HRP). HRP modificerer 3, 3 ', 5, 5'-tetramethylbenzidin (TMB), til frembringelse af et optisk signal, 12, som kan overvåges ved kvantificering af spektrale absorbans (dvs. optisk densitet) ved 450 nm (OD 450). Således kontrolsystem indirekte tillader forskerne at måle celle-produceret biotin ved at overvåge attentuation af OD450 signal.

Ordningen direkte kontrol udnytter streptavidin-biotin begivenhed ved at immobilisere streptavidin direkte til et materiale overflade og tillade celle-producerede biotin og biotinyleret HRP til at konkurrere om streptavidin bindingssteder. Igen,relative niveauer af celle-produceret biotin overvåges ved at måle en OD 450 signal.

Tilsammen de manipulerede celler og funktionaliserede overflader tillade os at kontrollere egenskaberne af en programmerbar overflade ved at inducere net i levende celler. Med andre ord, har vi skabt et system, der drager fordel af tilpasningsevne levende organismer, og pålideligheden og specifikation af en manipuleret materiale grænseflade ved at koble disse systemer sammen.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Medier og Kultur Forberedelse

  1. Forbered lysogeni bouillon (LB) medier ved blanding af 25 g LB pulver lager med 1 I deioniseret (DI) vand og autoklavering af opløsningen ved 121 ° C i 20 minutter for at sterilisere.
    1. Til fremstilling LB-plader tilsættes 15 g agar (1,5%) til LB-medium før sterilisering
    2. Forbered stamopløsninger af 1.000 x carbenicillin (Cb) i DI vand (50 mg / ml).
    3. Hvis forberede LB medier, der indeholder et antibiotikum til selektion af resistente transformanter, vente, indtil steriliserede LB media temperatur er under 60 ° C, og derefter tilføje en pi antibiotisk bestand for hver 1 ml LB-medier.
  2. For M9 minimal medier (tabel 1), udarbejde særskilte stamopløsninger af følgende: 5X M9 salte (56,4 g / L), 1 M MgSO4, 1 M CaCl 2, 20% glucose, og 2% biotin-fri casaminosyrer.
    1. I en autoklav sikker flaske, kombinere 20 ml 5x M9 salte, 200 &# 181; L 1 M MgSO4, 10 pi 1 M CaCl2, 2 ml 20% glucose, 1 ml 2% biotin-fri casaminosyrer, og 76,8 ml Dl vand.
    2. Autoklaver opløsningen fremstillet i trin 1.2.1 ved 121 ° C i 20 min.
  3. Inkuber alle kulturer ved 37 ° C med omrøring ved 400 rpm. Inkubationstider varierer afhængigt af eksperiment og stamme, men typisk vare fra 8 til 12 timer.

2. generation af biotin producerende E. coli (Plasmid pKE1-lacI-bioB)

BEMÆRK: Den genetiske kredsløb består af to dele: en lacl repressor, drevet af en P L, tetO-1 promotoren resulterer i konstitutiv ekspression på grund af fraværet af en tetR repressorprotein, samt et biotin ekspressionssystem indeholdende P trc-2 promotor efterfulgt af en stærk ribosombindingssted (rbs), der driver ekspression af bioB. Alle kloning blev henrettet i en kommerciel, hurtigt delende E. coli strai. Den endelige konstruktion blev transformeret til E. coli MG1655WT til test. Primere (tabel 2) blev erhvervet kommercielt.

  1. Isoler bioB-gen fra E. coli-genomet ved at udføre helcelle-polymerasekædereaktion (PCR):
    1. Grow E. coli MG 1655WT celler natten over ved 37 ° C.
    2. I en 0,2 ml PCR-rør, kombinere 1 pi overnatskulturen fremstillet i trin 2.1.1 med 9 pi sterilt deioniseret vand.
    3. Inkubér røret ved 95 ° C i 5 minutter i en thermocycler og straks overføre røret til en -80 ° C fryser i 10 minutter for at lysere cellerne. Dette muliggør genomisk DNA til at tjene som en PCR-skabelon.
    4. Optø opløsningen og tilføje (i) 2,5 pi af hver af primerne nBioB2-f1 og nBioB2-R, (ii) 5 pi 5x DNA-polymerase-buffer, (iii) 0,25 pi DNA-polymerase, (iv) 0,5 pi dNTP-blanding og (v) 6,75 pi DI vand til et samlet reaktionsvolumen på 25 pi(Tabel 4).
    5. Strike siden af (dvs. svirp) røret for at blande indholdet. Dernæst straks vågeblus røret hurtigt (~ 2 s) for at sikre at prøven er i bunden af ​​røret.
    6. Glasset anbringes i en PCR thermocycler og bruge programmet beskrevet i tabel 3 med et yderligere trin med 3 minutter ved 95 ° C ved begyndelsen af protokollen.
    7. Bekræft vellykket PCR under anvendelse af gelelektroforese (1,0 - 1,2% agarose i DI vand + ethidiumbromid) i Tris-base, eddikesyre, og EDTA-buffer (TAE). PCR-produktet bør være 1.070 basepar (bp) lange.
    8. Brug kommercielle kit ifølge producentens instruktioner til at udtrække DNA-fragmenter fra gelen fra trin 2.1.7.
  2. Isoler P trc-2 promotoren og lacl operon fra plasmidet pKDL071 13 (høflighed af laboratoriet af James Collins på MIT):
    1. Grow E. coli-celler indeholdendeden pKDL071 plasmidet natten over i LB + Cb ved 37 ° C.
    2. Ekstrahere plasmid-DNA fra cellerne ved anvendelse af en kommerciel miniprep kit ifølge producentens instruktioner. Plasmidet vil tjene som en PCR-skabelon.
    3. Følg PCR-protokol fra trin 2.1.4. til 2.1.8. med følgende ændringer:
    4. Erstat lyserede celler med plasmidet ekstrakt i trin 2.2.2.
    5. Bruge 2,5 pi af hver primer 1-f og 1-R for lacl kassette ekstraktion. Alternativt bruge 2,5 uL hver af primere nBioB1-f og nBioB1-r for P trc-2 ekstraktion.
    6. Udføre gelelektroforese (trin 2.1.7) for at bekræfte PCR-produkterne er lacl kassette og P trc-2-promotoren site. De bør være 1213 bp og 109 bp lange, hhv.
  3. Brug splejsning ved overlap extension (SOE) PCR at bygge bioB kassette, der indeholder P trc-2, et syntetisk ribosombindingssted (RBS) i primer nBioB2-f2, og bioB tabel 3.
  4. Indsæt konstruktioner (P L, tetO-1 + lacI og P trc-2 + bioB) i pKE1-MCS plasmidvektor 13 rygrad (høflighed af laboratoriet af James Collins ved MIT) ved at fordøje vektor og indsætte med restriktionsenzymer:
    1. Uddrag gener under anvendelse af restriktionsenzymer og gelelektroforese. Hver reaktion indeholder (i) 5 pi 10x reaktionsbuffer, (ii) 1 pi restriktionsenzym 1, (iii) 1 pi restriktionsenzym 2, (iv) mindst 1 ug DNA, og (v) DI vand til bringe slutvolumenet til 50 pi (tabel 5). Fordøje med enzymer AatII og EcoRI for lacl kassette og med enzymer HindIII og SacII for bioB kassetten.
    2. Efter reaktionerne er samlet, hurtigt vortex dem og kortvarigt centrifuge (~ 2 s) inden inkubering i 1 time ved 37 ° C.
    3. I løbet affordøjelse, forberede geler til elektroforese i overensstemmelse med standardprotokoller.
    4. Kombiner fordøjede DNA med gelelektroforese 6x loading buffer.
    5. Anvend en 2-log stige til at verificere placeringen af ​​ønskede konstruktion, skåret DNA-fragment fra gelen, og benytte kommerciel Gel Extraction kit ifølge producentens instruktioner til at udtrække DNA-fragmenter fra gelen.
  5. Kvantificere DNA under anvendelse spektroskopi og mængderne beregnet til 0: 1, 1: 1, og 3: 1 molforhold mellem indsatsen til vektor ved anvendelse af ligning 1:
    ligning 1 ligning 1
    I ligning 1, M er forholdet mellem indsatsen til vektor (0, 1, eller 3), X i er mængden af indsættelses-DNA, bp i er længden af insertet i basepar, bp v er længden af vektoren i basepar, og X v er mængden af vektor (50 ng).
  6. Bland ligeringsreaktion ved at kombinere (i) 1 pi 10X ligasepuffer, (ii)1 pi T4 Ligase, (iii) 50 ng vektor-DNA, (iv) en masse af indsat DNA er specifikke for hver reaktion, og (v) DI vand til 10 pi total reaktionsvolumen (tabel 6).
  7. Der inkuberes ved stuetemperatur (RT) i 1 time.
  8. Under ligering inkubering i trin 2.7, forberede kemisk kompetente celler.
    1. Portion 1 ml overnatskulturer i 1,5 ml centrifugerør.
    2. Centrifuger ved 16.200 xg i 1 min.
    3. Dekanter supernatanten og resuspender pellet i 200 pi afkølet (på is) 100 mM CaCl2. Pelleten resuspenderes ved forsigtigt at pipettere. Undlad at slynge.
    4. Placer mikrocentrifugerør på is i 10 min.
    5. Centrifuge, supernatanten fjernes, pellet resuspenderes i 100 pi af kølede 100 mM CaCl2, og placer røret på is igen.
    6. Centrifugeres røret en sidste gang, og pellet resuspenderes i 50 pi kølet 100 mM CaCl2.
    7. Placererøret på is og bruge de kemisk kompetente celler straks.
  9. Tilsæt 5 uL af ligeret DNA, tilberedt i trin 2.6 og 2.7, til hvert rør af kompetente celler, fremstillet i trin 2.8.
  10. Ryst røret kortvarigt ved at slå den side (dvs. svirpe) rørene og derefter placere rørene på is i 30 minutter.
  11. Varmechok rørene i 45 s ved 42 ° C og returnere rørene til is i 2 min.
  12. Pipette celler på selektiv LB agar + antibiotiske plader og sprede cellerne ved hjælp af glas plating perler.
  13. Inkubér pladerne natten over ved 37 ° C.
  14. Den følgende morgen, plukke kolonier fra insert-positive plader (dvs. 1: 1 og 3: 1 plader). Pick 3 kolonier hvis 0: 1 negativ kontrol plade viser ingen vækst eller bryde 5-8 kolonier hvis 0: 1 plade har en vis vækst. Brug de plukkede kolonier til at inokulere 5 ml LB + antibiotikum og vokse i 8 timer ved 37 ° C under omrøring.
  15. Ekstrahere plasmid-DNA fra cellerne ved anvendelse af en miniprep kit, ifølge producentens instruktioner. Udfør en test skæres med restriktionsenzymer (efter samme procedure beskrevet i trin 2.4.1.).
  16. Identificere celler med vellykkede konstruktioner ved sammenligning af længden af ​​de fordøjede DNA-fragmenter med de forventede fra en korrekte konstruktion resultater. Kulturer transporterer vellykkede plasmidkonstruktioner kan konserveres ved at blande lige dele kultur med en opløsning af sterilfiltreret, 40% glycerol (i DI vand) og frysning af blandingen ved -80 ° C.
    BEMÆRK: Transformations of plasmider i andre E. coli-stammer (dvs. MG1655WT) kan opnås ved at følge ovenstående procedure til fremstilling af kemisk kompetente celler.

3. Cell Karakterisering: vækstkurve og Dosisrespons

  1. Grow manipulerede stammer natten over i LB-medium med en passende antibiotikum.
  2. For vækstkurver, forberede 50 ml minimal M9 medier med og uden IPTG (fra en 0,5 M stock) og / eller DTB (fra en 500 ug / ml stamopløsning) som følger:
    1. Forbered 0 ng / mL DTB (0 pi lager) / 0 mM IPTG (0 pi lager).
    2. Forbered 200 ng / mL DTB (200 pi lager) / 0 mM IPTG (0 pi lager).
    3. Forbered 0 ng / mL DTB (0 pi lager) / 0,5 mM IPTG (50 pi lager).
    4. Forbered 200 ng / mL DTB (200 pi lager) / 0,5 mM IPTG (50 pi lager).
    5. Inokulering med overnatskultur ved 1: 100 i medierne specificeret ovenfor.
    6. I en 96-brønds plade, alikvot 200 pi af kultur, i tre eksemplarer, til hver brønd.
    7. Mål OD 600 hver 5 min i 24 timer under stadig omrystning og inkubering ved 37 ° C i pladeaflæser.
  3. For dosis-respons undersøgelser, udskifte bioB genet i pKE1-lacI-bioB med mCherry (et rødt fluorescerende protein) for real-time optisk kvantificering.
  4. Tilføj varierende mængder IPTG i området fra 0,1 mM til 5 mM for at inducere ekspressioni LB-medier.
  5. Inokulering med overnatskultur i en fortynding på 1: 100.
  6. Måle fluorescens hver 30 min i 15 timer.

4. Induktion af Biotin Produktionen fra manipulerede celler og Supernatant Fremstilling

  1. Grow pKE1-lacI-bioB i E. coli MG1655 stammen natten over i LB medier.
  2. Supplere M9-medium med DTB mellem 30 og 200 ng / mL.
  3. Tilsæt 0,5 mM IPTG for at inducere biotin syntese.
  4. Pode suppleret, biotin-free minimal M9 medier med overnatskultur ved 1: 100 fortynding.
  5. Efter 24 timers vækst, centrifugeres celler og indsamle biotin-berigede supernatant.
  6. Mål biotin-beriget supernatant med den indirekte kontrol og direkte kontrol funktionaliserede overflader. Brug supernatanten i stedet for biotin prøve i trin 5.23 og 6.12, henholdsvis.

5. Indirekte kontrol Scheme funktionaliserede Forbehandling

  1. Forbered the følgende løsninger.
    1. Forbered en SMCC opløsning bestående af 20 mg / ml succinimidyl trans-4- (maleimidylmethyl) cyclohexan-1-carboxylat (SMCC) i dimethylsulfoxid (DMSO).
    2. Forbered en SPDP opløsning bestående af 20 mg / ml succinimidyl 3- (2-pyridyldithio) propionat (SPDP) i DMSO.
    3. Forbered 20 mg / ml LC-LC-biotin i DMSO.
    4. Forbered 10 mg / ml peberrodsperoxidase (HRP) i phosphatbufret saltvand (PBS).
    5. Forbered 10 mg / ml streptavidin (SA) i PBS.
    6. Forbered 10 mg / ml bovint serumalbumin (BSA) i PBS.
    7. Forbered 100 mM dithiothreitol (DTT) i DI vand.
    8. Forbered 5 mM ethylenediaminetetaacetic (EDTA) i PBS.
    9. Forbered 0,5% casein i PBS.
    10. Forbered 20% Tween 80 lager i DI vand.
    11. Forbered 0,05% Tween 80 (fra 20% lager) i PBS.
    12. Forbered 50 mM natriumacetat i DI vand.
    13. Forberede 1% TMB i DMSO.
    14. Forbered 3% H 2 O 2 in DI vand.
    15. Forbered to MH 2 SO 4 i DI vand.
  2. Tilføj 1,4 pi af SPDP opløsningen til 20 pi SA-opløsning.
  3. Inkubér opløsningen fra 5,2 til 1,5 timer ved stuetemperatur, pakket ind i aluminiumfolie for at undgå udsættelse for lys. Dette trin tillader SPDP tværbinder til at binde til SA via en aminogruppe danner en pyridyldithio-aktiveret SA.
  4. Tilføj 2,4 pi af DDT opløsningen til opløsningen fra trin 5.3 og inkuberes i 1 time ved stuetemperatur. Dette giver mulighed for en pyridin 2-thion-spaltning, hvilket resulterer i et sulfhydryl-aktiveret SA.
  5. Tilføj 7,5 uL SMCC løsning på 72 uL HRP-opløsning og inkuberes i 1,5 timer ved stuetemperatur, pakket ind i aluminiumfolie for at undgå udsættelse for lys. Dette resulterer i en maleimid-aktiveret HRP bundet af en aminogruppe.
  6. Bland 17 pi LC-LC-biotin-opløsning med 200 pi BSA-opløsning og inkuberes i 1,5 timer ved stuetemperatur, pakket ind i aluminiumfolie for at undgå udsættelse for lys. Dette trin tillader biotin til konjugat to BSA via en amidbinding.
  7. Overfør løsninger fra trin 5.4, 5.5 og 5.6 for at adskille centrifugalkoncentratorer indenfor spin-rør.
  8. For rør indeholdende SA-SPDP, fra trin 5.4, centrifugeres ved 10.000 xg, indtil volumenet røret når 100 pi eller i 16 min. Fyld centrifugerøret til 500 pi med PBS-EDTA.
    1. Gentag trin 5.8 fem gange. Opbevar lager ved 4 ° C.
  9. For rør indeholdende HRP-SMCC, fra trin 5.5, centrifugeres ved 10.000 xg, indtil volumenet bliver 25 pi eller i 16 min. Fyld centrifugerøret til 500 pi med PBS.
    1. Gentag trin 5.9 fem gange. Opbevar lager ved 4 ° C.
  10. For rør indeholdende BSA-biotin, fra trin 5.6, centrifugeres ved 10.000 xg, indtil volumenet når 100 pi eller i 12 min. Fyld centrifugerøret til 500 pi med PBS.
    1. Gentag trin 5.10 fire gange.
    2. Der centrifugeres ved 10.000 xg, indtil volumenet når 100 pieller i 12 min. Tilsæt 100 pi PBS i røret. Opbevar lager ved 4 ° C.
  11. 25 pi af 10 mg / ml HRP-opløsning med 25 pi 10 mg / ml SA-opløsning og opbevares ved 4 ° C natten over. Dette bevirker, at SA bliver konjugeret med HRP via en thioetherbinding.
    1. Forbered en 1: 4 arbejdsopløsning med overnight løsning, og butik i 4 ° C køleskab. Store resterende opløsning ved -20 ° C.
  12. Fremstille to opløsninger bestående af BSA-biotin (eller BSA) i PBS, ved at tilsætte 10 pi BSA-biotin-stamopløsning (eller 10 pi BSA lager) til 490 pi PBS.
  13. Tilsæt 100 pi af opløsningen fra trin 5.12 til hver brønd i en 96-brønds polystyrenplade.
  14. Inkubér pladen ved 37 ° C i 1 time, indpakket i folie.
  15. Vask brøndene i pladen med 0,05% Tween 80.
    1. Tilsæt 200 pi af 0,05% PBS-Tween 80 til brøndene. Inkuber i 2 minutter ved stuetemperatur. Væsken dekanteres.
    2. <li> Gentag trin 5.15.1 tre gange.
  16. Tilsæt 200 pi af 0,5% casein-opløsning til hver af brøndene i 96-brønds plade.
  17. Inkubér pladen ved 37 ° C i 1 time.
  18. Gentag trin 5,15 til Brøndene vaskes tre gange.
  19. Der fremstilles en opløsning ved blanding 12 ml 0,5% casein opløsning med 7,5 pi 0,05% Tween 80.
  20. Fortynd SA-HRP lager 1: 10.000 ved hjælp af opløsning fremstillet i trin 5.19.
  21. Der tilsættes 80 pi af opløsningen fremstillet i trin 5.20 til hver brønd i en plade med 96 brønde.
  22. Tilsæt 20 pi af den fremstillede biotin prøve til hver brønd af polystyren plade. Supernatanten fremstillet i 4,6, kan anvendes som den biotin prøven i dette trin.
  23. Inkubér pladen ved 37 ° C i 1 time. Dette trin muliggør kompetitiv binding mellem fri biotin og immobilisere BSA-biotin for SA-HRP-bindingssteder.
  24. Gentag trin 5,15 til Brøndene vaskes tre gange.
  25. Bland 50 mM natriumacetat-opløsning, 1% TMB-opløsning,og 3% H2O 2-opløsning ved en 1.000: 10: 1 forhold (20 ml totalvolumen).
  26. Tilsæt 200 pi af opløsningen fra trin 5,25 til hver brønd og lad det sidde i 15 minutter ved stuetemperatur, dækket med folie.
  27. Der tilsættes 50 pi af 2 MH 2 SO 4 til hver brønd for at standse reaktionen. Mål OD 450 under anvendelse af en pladelæser.

6. Direct Control Scheme funktionaliserede Forbehandling

  1. Forbered følgende løsninger.
    1. Forbered 20 mg / ml LC-LC-biotin i DMSO.
    2. Forbered 10 mg / ml HRP i PBS.
    3. Forbered 0,17 ug / ml SA i PBS.
    4. Forbered 0,5% casein i PBS.
    5. Forbered 20% Tween 80 lager i DI vand.
    6. Forbered 0,05% Tween 80 (fra 20% lager) i PBS.
    7. Forbered 50 mM natriumacetat i DI vand.
    8. Forberede 1% TMB i DMSO.
    9. Forbered 3% H 2 O 2 i DI-vand.
    10. Forbered to MH 2 SO 4 vand.
  2. Tilføj 7,5 uL LC-LC-biotin til 72 uL HRP og inkuberes ved i 1,5 time ved stuetemperatur, pakket ind i aluminiumfolie for at undgå udsættelse for lys. Dette trin forårsager biotin til konjugat til HRP via en amidbinding.
  3. Opløsningen overføres fra trin 6.2 til en centrifugal-koncentrator i et glas-
    1. Centrifuger løsningen på 10.000 xg, indtil volumen når 100 uL eller 12 min. Fyld centrifugerøret til 500 pi med PBS og gentag centrifugeringen og PBS tilsætning fire gange. Opbevar lager ved 4 ° C.
  4. Tilsæt 100 pi af SA-opløsning fra 6.1.3 til hver brønd i en 96-brønds polystyrenplade.
  5. Inkubér pladen ved 37 ° C i 1 time, indpakket i folie.
  6. Vask brøndene i pladen med 0,05% Tween 80.
    1. Tilsæt 200 pi 0,05% Tween 80 til brøndene. Inkuber i 2 minutter ved stuetemperatur. Væsken dekanteres.
    2. Gentag 6.6.1 tre gange.
  7. Tilsæt 200 pi af 0,5% casein-opløsning til hver af brøndene i 96-brønds plade.
  8. Inkubér pladen ved 37 ° C i 1 time.
  9. Gentag trin 6,6 tre gange for at vaske brøndene.
  10. Fortynd biotin-HRP stamopløsning 1: 10.000 ved anvendelse af opløsningen fremstillet i trin 6.3.
  11. Der tilsættes 80 pi af opløsningen fremstillet i trin 6.10 til hver brønd i en plade med 96 brønde.
  12. Tilsæt 20 pi af den fremstillede biotin prøve til hver brønd af polystyren plade. Supernatanten fremstillet i 4,6, kan anvendes som den biotin prøven i dette trin.
  13. Inkubér pladen ved 37 ° C i 1 time. Dette trin muliggør kompetitiv binding mellem fri biotin og biotin-HRP til immobiliserede SA bindingssteder.
  14. Gentag trin 6.6 til at vaske brøndene tre gange.
  15. Bland 50 mM natriumacetat-opløsning, 1% TMB-opløsning, og 3% H2O 2-opløsning ved en 1.000: 10: 1 forhold (20 ml totalvolumen).
  16. Tilsæt 200 pi af opløsningen fra trin 6.15 til hver brønd og inkuberes i 15 minutter ved stuetemperatur, dækket med folie.
  17. Der tilsættes 50 pi af 2 MH 2 SO 4-opløsning til hver brønd for at standse reaktionen. Mål OD 450 under anvendelse af en pladelæser.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Repræsentative resultater er vist i de ledsagende fem figurer. Først præsenterer vi kloningsprocessen grafisk (figur 1), således at læseren visuelt kan følge de kritiske trin for at skabe den syntetisk manipuleret E. coli stamme. For at karakterisere populationsdynamikken for cellerne, tilvejebringer vi en vækstkurve (figur 2) genereres ved at måle den optiske densitet ved 600 nm (OD600) af befolkningen. Derefter viser vi, hvordan den regulerende gen-netværket er bekræftet, ved at bruge mCherry som en proxy for bioB (figur 3), tillader os at optisk måle den relative mængde af bioB der ville blive produceret af cellen ved induktion med IPTG. Dernæst præsenterer vi svardata for indirekte kontrol og direkte kontrol funktionaliserede overflader. Disse data (figur 4) blev udviklet ved hjælp af målte opløsninger af fribiotin at karakterisere de funktionaliserede overflader 'respons profiler. Endelig præsenterer vi karakteristiske data, der viser, hvordan de manipulerede celler induceres til at producere biotin (figur 5), hvorved modificere funktionaliserede overflader.

figur 1
Figur 1: Design og konstruktion af Inducerbare, manipulerede celler. (A) Primere blev designet til at isolere bioB genet fra E. coli-genomet, som koder for et afgørende enzym i biotin syntesevejen. (B) P L, kan tetO-1 -lacI og P trc-2-sekvenser isoleres fra et plasmid indeholdende en genetisk vippekontakt med tilsvarende primere. (C) Det ekstraherede bioB-gen og de to fragmenter fra vippeafbryderen kan derefter anvendes til at skabe genet kredsløb. Tilsætningen af ​​IPTG kan derefter INDUCE ekspressionen af bioB og derved biotin syntese, når DTB tilsættes som et substrat for bioB. (D) Den monterede plasmid blev transformeret ind i K-12 MG1655 E. coli. Dette forårsagede tilstedeværelsen af IPTG for at inducere ekspressionen af bioB og derved biotin syntese ved det manipulerede cellelinje når DTB blev tilvejebragt som et substrat. Klik her for at se en større version af dette tal.

Figur 2
Figur 2: vækstkurver for manipulerede celler. De konstruerede, inducerbare MG1655 vildtypeceller blev dyrket og overvåges i minimalmedium (dvs. biotin-frit M9 medier), samt det mindste medier tilsat DTB (200 ng / ml) og / eller IPTG (0,5 mM). Graferne viser OD 600 læsning, målt hver 5 mi n i 24 timer. Klik her for at se en større version af dette tal.

Figur 3
Figur 3: Test af Engineered Gene Network. Den fluorescerende protein mCherry blev anvendt i stedet for bioB gen, således at vi optisk kunne måle induktion profil, når manipulerede celler blev induceret med IPTG. Vi kontrast cellerne induceret med IPTG (røde diamanter) med cellerne ikke induceret med IPTG (blå diamanter). Disse resultater viser effektiviteten af ​​den inducerbare gen-netværket. Klik her for at se en større version af dette tal.

/55300/55300fig4.jpg "/>
Figur 4: Kontrol af funktionaliseret Material Interface. Ved at udsætte vores funktionaliserede overflade til varierende koncentrationer af biotin, er vi i stand til at måle den optiske respons ved at måle OD450 absorbans. Disse resultater giver os mulighed for at generere en kalibreringskurve, der forbinder koncentrationen af ​​biotin til den optiske intensitet af responset. Her præsenterer vi biotin vs. optiske signal kurver for både de indirekte (til venstre) og direkte (til højre) funktionaliserede overflade ordninger. Klik her for at se en større version af dette tal.

Figur 5
Figur 5: manipulerede celler kontrolmateriale Interface. Ved at udnytte protokol §§ 5 eller 6, er vi i stand til at bruge produkterne af induceret, manipuleret calen til kemisk modificere den funktionaliserede overflade. Vi kan overvåge disse svar optisk ved at måle OD 450. Endvidere ved anvendelse af den kalibreringskurve i figur 4, kan vi knytte den optiske intensitet af reaktionerne på biotin inden fusionen. Vi præsenterer her de forskellige biotin koncentrationer, målt ved vores indirekte kontrol ordning funktionaliserede overflade, for vildtypeceller (hvid), ikke-inducerede celler indeholdende pKE1-lacI-bioB plasmid (orange), og inducerede celler indeholdende pKE1-lacI-bioB plasmid (grå). Klik her for at se en større version af dette tal.

Kemisk slutkoncentration Beløb
5x M9 salte 1x 20 ml
1 M MgSO4 2 mM 200 pi
1 M CaCl2 0,1 mM 10 pi
20% glucose 0,40% 2 ml
2% biotin-fri casaminosyre 0,02% 1 ml
DI Water N / A 76,8 ml

Tabel 1: M9 Media opskrift.

Navn primersekvens Usage
1-f CCGCCGGAATTCTCCCTATCAGTGATAGAGATT lacl kassette udvinding
1-r CCGACGTCTCACTGCCCGCTTTCCAGTC lacl kassette udvinding
nBioB1-f CCCAAGCTTCTGAAATGAGCTGTTGACAATTAATCAT P trc-2-ekstraktion
nBioB1-r GGGGGGTTCTTTTAATAAAGGTACCGTGTGAAATTGTT P trc-2-ekstraktion
nBioB2-f1 ACCCCCCTAAGGAGGTCATCATGGCTCACCGCCCACG bioB udvinding
nBioB2-r TCCCCGCGGTCATAATGCTGCCGCGTTGTAATATTC bioB udvinding
nBioB2-f2 ACGGTACCTTTATTAAAAGAACCCCCCTAAGGAGGTCATC Syntetisk RBS tilføjelse

Tabel 2: Liste over Primere.

Trin 1
trin 2 trin 3 trin 4 trin 5 trin 6 trin 7 trin 8 Trin 9
98 ° C 98 ° C 70 ° C 72 ° C 98 ° C 60 ° C 72 ° C 72 ° C 4 ° C
00:30 00:10 00:30 01: 00 / kb 00:10 00:30 01: 00 / kb 02:00
Gentag 12 gange Gentag 25 gange
-1 ° C / cycle

Tabel 3: PCR program.

Navn Bind
Cellelysat (template) 10 pi
Primer (hver) 0,625 pi (hver)
5x Q5 buffer 5 pi
Q5 Polymerase 0,25 uL
dNTP Mix 0,5 uL
DI Water 6,75 uL

Tabel 4: Whole Cell PCR-reaktion (25 pi).

Navn Bind
10x Reaction buffer 5 pi
Enzym 1 1 pi
Enzym 2 1 pi
template-DNA 1 ug
DI Water 43 uL - volumen af ​​DNA

Tabel 5: restriktionsenzymfordøjelse Reaktion (50 pi).

Navn Bind
DNA 50 ug vektor + X ug insert
10x ligasebuffer 1 pi
T4 Ligase 1 pi
DI Water 8 pi - volumen af ​​DNA

Tabel 6: ligeringsreaktion (10 uL).

Navn Koncentration Noter
CaCl2 100 mM
Carbeniccilin 50 mg / ml (1000x)
DTB 50 ug / ml
IPTG 0,5 M
SMCC 20 mg / ml 2 mg i 100 pi DMSO
SPDP 20 mg / ml 2 mg i 100 pi DMSO
LC-LC-biotin 20 mg / ml 2 mg i 100 pi DMSO
HRP 10 mg / ml i PBS
SA (indirekte) 10 mg / ml i PBS
SA (direkte) 0,17 ug / ml i PBS
BSA 20 mg / ml i PBS
DTT 100mM I DI Water
EDTA 5 mM 18,6 mg i 10 ml PBS
Kasein 0,50% i PBS
Tween 80 20% I DI Water
Tween 80 i PBS 0,05%
Natriumacetat 50 mM I DI Vand, Juster til 5,1 pH ved hjælp 3 M HCI
TMB 1% i DMSO
H 2 O 2 3% I DI Water
H 2 SO 4 2 M I DI Water

Tabel 7: Liste over Reagens Solutions.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Vi har præsenteret en ny strategi for sammenknytning manipuleret levende celler med et funktionaliseret materiale overflade. Dette blev opnået ved at udvikle en cellelinie stand til at syntetisere forøgede niveauer af biotin ved induktion med IPTG. De forhøjede niveauer af biotin kan derpå anvendes til at modificere den funktionaliserede overflade. Protokollerne detaljeret hvordan at ingeniør E. coli cellelinje og hvordan man skaber to forskellige funktionaliserede overflader.

Kritiske trin i denne protokol forekomme i hele konstruktionen af ​​manipulerede cellelinje. For at undgå efterfølgende problemer, der kendetegner de konstruerede cellestammer med både vækstkurver (figur 2) og fluorescerende respons (figur 3) er fremmes. Skulle procedurespørgsmål opstå, andre molekylær kloning strategier, såsom PCR ekstraktion og Gibson samling 14, kan erstatte foranstaltninger, hvis det er relevant. Til optimering af biotin Yield af den konstruerede cellelinje, er det vigtigt at sikre, at en tilstrækkelig mængde DTB leveres til cellerne. I vores undersøgelser fandt vi, at 200 ng / mL DTB fremkaldte en væsentlig og statistisk signifikant stigning i biotin produktionen, når cellerne blev induceret med IPTG. Derudover vellykket konjugation af BSA-biotin, SA-HRP, og biotin-HRP er afgørende for effektivt at udføre og overvåge de indirekte og direkte kontrol ordninger. Sørge for at undgå unødig udsættelse for lys og tillade konjugaterne at inkubere natten over ved 4 ° C for at sikre en effektiv konjugat dannes.

Vores protokol giver fordele i forhold til alternative metoder 15 på grund af sin evne til at detektere små mængder biotin, som er biologisk relevant (pg / mL skala) sammenlignet med kommercielt tilgængelige biotin afsløring kits, såsom sådanne baseret på 4'-hydroxyazobenzene-2-carboxylsyre kompetitiv binding strategier. Selv ved anvendelse af streptavidin-biotin system er almindelig i bioteknologi 16, 17, vores systemets evne til at reagere på små mængder af biotin giver os mulighed for direkte linke vores genetisk manipuleret celle linje med funktionaliserede overflade.

En mulig begrænsning af vores protokol er den resulterende dynamiske område af biotin-detektion. I de indirekte og direkte kontrolordninger, er vi i stand til at opdage biotin mellem 10 2 -10 3 og 10 4 -10 6 pg / mL (figur 4). Heldigvis det lave område af den indirekte kontrol ordningen giver os mulighed for let at detektere biotin produktion fra manipulerede celler. Men den stramt bånd af den indirekte kontrol dynamikområde begrænser dets evne til at fornemme store ændringer (100 gange) i biotin koncentrationer. Ændring af dynamiske område for både indirekte og direkte kontrol ordninger ville kræve yderligere teknik. Men hvis påvisning af celle-producered biotin er et problem, forbereder fortyndinger af biotin supernatant i trin 4.6 bør tillade forskeren at målrette det dynamiske område af den indirekte kontrol (figur 5). Vi fandt, at en 1: 5 fortynding af supernatanten tilladt os at målrette indirekte kontrol ordningens dynamikområde effektivt. Denne fortynding strategi bør mindske behovet for at ændre det dynamiske område direkte.

Den todelte, celle-materiale systemet præsenteres her tillader manipulerede celler til at ændre sammensætningen af ​​en funktionaliseret overflade. Dynamiske, levende celler kan fortolke deres kemiske omgivelser til at producere en genetisk reaktion. By engineering denne genetiske reaktion på forøgelse biotin produktion, kan vi udstyre manipulerede levende celler med evnen til at kontrollere og manipulere en funktionaliseret overflade. Ved at følge protokollerne præsenteret, manipulerede celler er i stand til at fungere som dynamiske sensorer, der kan læse, forarbejdning, og optage forholdene omkring them via funktionaliserede interfaces. Denne teknologi kan påvirke områder, der spænder fra molekylær medicin til analytdetektion for udbedring af miljøskader.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har intet at afsløre.

Acknowledgments

Forfatterne takker støtte fra award FA9550-13-1-0108 fra Air Force Office of Scientific Research i USA. Forfatterne derudover anerkender støtte fra award N00014-15-1-2502 fra Office of Naval Research i USA, finansiering fra Institut for Kritisk Teknologi og Applied Science på Virginia Polytechnic Institute og State University, og fra National Science Foundation Graduate Research Fellowship Program, tildeling nummer 1.607.310.

Materials

Name Company Catalog Number Comments
LB Broth, Miller  Fisher Scientific 12-795-027
Agar Fisher Scientific BP9744500
Carbenicillin  Fisher Scientific BP26481
M9, Minimimal Salts, 5x Sigma-Aldrich M6030
Casamino Acids  Fisher Scientific BP1424-100
Magnesium Sulfate, Anhydrous Fisher Scientific M65-500
Calcium Chloride, Dihydrate Fisher Scientific C79-500
Dextrose (D-Glucose), Anhydrous Fisher Scientific D16-1
NEB Turbo Cell Line New England Biolabs C2984l
Oligonucleotide Primers Thermo Fisher Scientific N/A 25N synthesis, DSL purification
Q5 High-Fidelity Polymerase New England Biolabs M0491S
Q5 Reaction Buffer New England Biolabs B9027S
dNTP Solution Mix New England Biolabs N0447S
Agarose Bioexpress E-3120-125
Ethidium Bromide, 1% Fisher Scientific BP1302-10
Gel Extraction Kits Epoch Biolabs 2260250
GenCatch Plasmid DNA Miniprep Kit Epoch Biolabs 2160250
AatII New England Biolabs R0117S
SacII New England Biolabs R0157S
HindIII-HF New England Biolabs R3104S
EcoRI-HF New England Biolabs R3101S
Cutsmart Buffer New England Biolabs B7204S
T4 DNA Ligase New England Biolabs M0202S
T4 DNA Ligase Reaction Buffer New England Biolabs B0202S
ColiRolle Glass Plating Beads  EMD Millipore 7101-3
Glycerol Fisher Scientific BP229-1
Isopropyl β-D-1-thiogalactopyranoside (IPTG) Fisher Scientific BP1755-10
NHS-Desthiobiotin (DTB) Thermo Fisher Scientific 16129
Succinimidyl Trans-4-(maleimidylmethyl) Cyclohexane-1-Carboxylate (SMCC)  Thermo Fisher Scientific S1534
Dimethyl Sulfoxide (DMSO)  Fisher Scientific BP231-100
Succinimidyl 3-(2-pyridyldithio) Propionate (SPDP)  Thermo Fisher Scientific S1531
NHS-LC-LC-biotin Thermo Fisher Scientific 21343
Horseradish Peroxidase (HRP)  Thermo Fisher Scientific 31490
Phosphate Buffered Saline (PBS), 10x Solution Fisher Scientific BP399500
Streptavidin (SA)  Thermo Fisher Scientific 21145
Bovine Serum Albumin (BSA) Fisher Scientific BP1600-100
Dithiothreitol (DTT) Fisher Scientific BP172-5
Ethylenediaminetetaacetic acid (EDTA)  Fisher Scientific S311-500
Tween 80  Fisher Scientific T164-500
Hydrogen Peroxide Fisher Scientific H325-4
3, 3', 5, 5'-tetramethylbenzidine (TMB) Fisher Scientific AC229280050
Vivaspin 500 Centrifugal Concentrators  Viva Products VS0192
Sodium Acetate, Anhydrous Fisher Scientific BP333-500
96-Well Polystyrene Plates Thermo Fisher Scientific 266120

DOWNLOAD MATERIALS LIST

References

  1. Zhang, R., Heyde, K. C., Scott, F. Y., Paek, S. -H., Ruder, W. C. Programming Surface Chemistry with Engineered Cells. ACS Synth. Biol. (2016).
  2. Zhou, X., et al. Reduced graphene oxide films used as matrix of MALDI-TOF-MS for detection of octachlorodibenzo-p-dioxin. Chem. Commun. 46, 6974-6976 (2010).
  3. Pardee, K., et al. Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components. Cell. 165, 1255-1266 (2016).
  4. Bähring, S., et al. Design and Sensing Properties of a Self-Assembled Supramolecular Oligomer. Chem. Eur. J. 22, 1958-1967 (2016).
  5. Nicolau Jr, D. V., Armitage, J. P., Maini, P. K. Directional persistence and the optimality of run-and-tumble chemotaxis. Comp. Biol. Chem. 33, 269-274 (2009).
  6. Du, J., Shao, Z., Zhao, H. Engineering microbial factories for synthesis of value-added products. J. Ind. Microbiol. Biotechnol. 38, 873-890 (2011).
  7. Kim, H., Kim, M. J. Electric Field Control of Bacteria-Powered Microrobots Using a Static Obstacle Avoidance Algorithm. IEEE Trans. Rob. 32, 125-137 (2016).
  8. Gardner, T. S., Cantor, C. R., Collins, J. J. Construction of a genetic toggle switch in Escherichia coli. Nature. 403, 339-342 (2000).
  9. Heyde, K. C., Ruder, W. C. Exploring Host-Microbiome Interactions using an in Silico Model of Biomimetic Robots and Engineered Living Cells. Sci. Rep. 5, 11988 (2015).
  10. Rice, M. K., Ruder, W. C. Creating biological nanomaterials using synthetic biology. Sci. Tech. Adv. Mater. 15, 014401 (2014).
  11. Green, N. M. Avidin. 3. The nature of the biotin-binding site. Biochem. J. 89, 599-609 (1963).
  12. Mesulam, M. M. Tetramethyl benzidine for horseradish peroxidase neurohistochemistry: a non-carcinogenic blue reaction product with superior sensitivity for visualizing neural afferents and efferents. J Histochem. Cytochem. 26, 106-117 (1978).
  13. Litcofsky, K. D., Afeyan, R. B., Krom, R. J., Khalil, A. S., Collins, J. J. Iterative plug-and-play methodology for constructing and modifying synthetic gene networks. Nat. Meth. 9, 1077-1080 (2012).
  14. Gibson, D. G., et al. Complete Chemical Synthesis, Assembly, and Cloning of a Mycoplasma genitalium Genome. Science. 319, 1215-1220 (2008).
  15. Diamandis, E. P., Christopoulos, T. K. The biotin-(strept)avidin system: principles and applications in biotechnology. Clin. Chem. 37, 625-636 (1991).
  16. Nerurkar, L. S., Namba, M., Brashears, G., Jacob,, Lee, A. J., Sever, Y. J., L, J. Rapid detection of herpes simplex virus in clinical specimens by use of capture biotin-streptavidin enzyme-linked immunosorbent assay. J. Clin. Micro. 20, 109-114 (1984).
  17. Cui, Y., Wei, Q., Park, H., Lieber, C. M. Nanowire Nanosensors for Highly Sensitive and Selective Detection of Biological and Chemical Species. Science. 293, 1289-1292 (2001).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics