Utilisation de la biologie synthétique à l'ingénieur cellules vivantes Interface avec les matériaux programmables

* These authors contributed equally
JoVE Journal
Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Ce document présente une série de protocoles pour le développement de cellules modifiées et des surfaces fonctionnalisés qui permettent synthétiquement par génie E. coli pour contrôler et manipuler les surfaces des matériaux programmables.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Heyde, K. C., Scott, F. Y., Paek, S. H., Zhang, R., Ruder, W. C. Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials. J. Vis. Exp. (121), e55300, doi:10.3791/55300 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Nous avons développé une interface abiotiques-biotiques qui permet aux cellules d'ingénierie pour contrôler les propriétés du matériau d'une surface fonctionnalisée. Ce système est réalisé par la création de deux modules: une souche synthétiquement modifié génétiquement de cellules de E. coli et une interface de matériau fonctionnalisé. Dans cet article, nous détaillons un protocole pour l' ingénierie génétique des comportements sélectionnés au sein d' une souche de E. coli en utilisant des stratégies de clonage moléculaire. Une fois développée, cette souche produit des niveaux élevés de la biotine lorsqu'il est exposé à un inducteur chimique. De plus, nous protocoles de détail pour la création de deux différentes surfaces fonctionnalisés, dont chacun est en mesure de répondre à la biotine synthétisé cellulaire. Pris ensemble, nous présentons une méthodologie pour la création d'un système abiotiques-biotiques lié qui permet aux cellules de contrôle de la composition des matériaux et de l'assemblage sur des substrats inanimés conçu.

Introduction

Ici, nous rapportons les procédures pour l'élaboration d'un substrat programmable apte à répondre à un signal chimique à partir d'une lignée cellulaire d'ingénierie. 1 Nous faisons cela en créant une interface de biotine-streptavidine qui répond à la biotine produite par Escherichia coli synthétiquement ingénierie (E. coli) des cellules. Auparavant, les surfaces programmables ont été conçus pour une large gamme d'applications de détection de la toxine 2 et le point-of-care diagnostic 3 à la défense et à la sécurité. 4 Alors que les surfaces programmables peuvent être utiles en tant que capteurs et actionneurs, ils peuvent être plus «intelligents» en les dotant de la capacité d'adaptation aux différents défis environnementaux. En revanche, même les micro - organismes simples, tels que E. coli, ont adaptabilité inhérente et sont capables de répondre aux problèmes des solutions complexes et souvent inattendues. Cette capacité d' adaptation a permis E.coli, les populations contrôlées par leurs réseaux de gènes complexes, de manière rentable d'obtenir des ressources, 5 créer des produits à valeur ajoutée, 6 et même puissance robotique micro-échelle. 7 En couplant les avantages adaptatifs de cellules vivantes avec l'utilisation de surfaces programmables, nous pouvons créer un substrat intelligent capable de répondre à différentes conditions environnementales.

La biologie synthétique a permis aux chercheurs de nouvelles capacités pour programmer le comportement des organismes vivants. En orchestrant les cellules pour contenir les réseaux de régulation nouveaux gènes, les chercheurs peuvent concevoir des cellules qui présentent une gamme de comportements programmés. 8, 9 Au - delà de la recherche fondamentale, ces comportements peuvent être utilisés pour des applications telles que le contrôle de l' assemblage des matériaux et la production biologique des produits à valeur ajoutée. 10 Ici, nous détaillons comment nous avons utilisé les outils de la biologie synthétique engineer une souche de E. coli qui synthétise la biotine lors de l' induction. Cette souche a été développée en utilisant des méthodes d'enzyme de restriction de clonage pour assembler un plasmide, pKE1-lad-bioB. Ce plasmide, lorsqu'il est transformé dans la souche E. coli K-12 MG1655, lui confère des cellules ayant la capacité d'exprimer des niveaux élevés de bioB, une enzyme essentielle pour la synthèse de la biotine. Lorsque les cellules transformées ont été induites avec de l'isopropyl β-D-thiogalactopyranoside 1 (IPTG) et muni d'un précurseur de la biotine, de la desthiobiotine (BTD), des taux élevés de biotine ont été produites.

l'interaction de liaison de biotine avec la streptavidine est l'une des plus fortes liaisons non covalentes trouvés dans la nature. A ce titre, l'interaction biotine-streptavidine est à la fois bien caractérisés et très utilisés dans la biotechnologie. 11 Dans ce manuscrit, nous présentons deux stratégies utilisant l'interaction biotine-streptavidine à détecter et à détecter la biotine produite cellulaire avec une surface fonctionnalisée. nousse référer à ces surfaces contrastées que les systèmes de contrôle "directs" "indirects" et. Dans le schéma de contrôle indirect, la biotine produite cellulaire est en concurrence avec la biotine qui a été conjugué et immobilisé sur une surface de polystyrène pour les sites de liaison streptavidine. En outre, la streptavidine est conjuguée à la peroxydase de raifort (HRP). HRP modifie 3, 3 ', 5, 5'-tétraméthylbenzidine (TMB), pour produire un signal optique, qui peut être 12 surveillée par la quantification de l'absorption spectrale ( par exemple, une densité optique) à 450 nm (DO 450). Ainsi, le système de contrôle indirect permet aux chercheurs de mesurer la biotine produite cellulaire en surveillant la attentuation du signal OD 450.

Le système de contrôle direct exploite l'événement streptavidine-biotine en immobilisant streptavidine directement à une surface du matériau et permettant la biotine produite cellulaire et HRP biotinylé à concourir pour les sites de liaison streptavidine. Encore une fois, lales niveaux relatifs de la biotine produite cellulaire sont surveillées en mesurant un signal OD 450.

Pris ensemble, les cellules modifiées et des surfaces fonctionnalisés nous permettent de contrôler les propriétés d'une surface programmable en induisant des réseaux dans les cellules vivantes. En d'autres termes, nous avons créé un système qui tire parti de la capacité d'adaptation des organismes vivants et la fiabilité et la spécification d'une interface de matériel d'ingénierie en reliant ces systèmes.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Médias et Culture Préparation

  1. Préparer le bouillon de lysogénie (LB) médias en mélangeant 25 g de poudre LB disponible avec 1 L d' eau désionisée (DI) et autoclavage la solution à 121 ° C pendant 20 min pour stériliser.
    1. Pour préparer des plaques LB, ajouter 15 g de gélose (1,5%) aux médias LB avant stérilisation
    2. Préparer des solutions mères de 1,000x carbénicilline (Cb) dans de l'eau DI (50 mg / mL).
    3. Si la préparation des milieux LB qui comprend un antibiotique pour la sélection des transformants résistants, attendre jusqu'à ce que la température du milieu LB stérilisé est inférieure à 60 ° C, puis ajouter 1 pl de stock antibiotique pour tous les médias 1 ml de LB.
  2. Pour M9 milieu minimal (tableau 1), préparer des solutions mères séparées des suivants: des sels 5X M9 (56,4 g / L), 1 M MgSO 4, 1 M CaCl 2, 20% de glucose et 2% d' acides casamino libre biotine.
    1. Dans une bouteille en toute sécurité de l'autoclave, mélanger 20 ml de 5x M9 sels, 200 &# 181; l de MgSO4 1 M, 10 pl de 1 M CaCl2, 2 ml de glucose à 20%, 1 ml de 2% d' acides casamino exempte de biotine et 76,8 ml d'eau déminéralisée.
    2. Autoclaver la solution préparée à l'étape 1.2.1 à 121 ° C pendant 20 min.
  3. Incuber toutes les cultures à 37 ° C sous agitation à 400 tours par minute. Les temps d'incubation varient en fonction de l'expérience et de la souche, mais durent généralement de 8 à 12 h.

2. Génération de Biotine E. coli producteur (plasmide pKE1-lad-bioB)

NOTE: Le circuit génétique comporte deux parties: un répresseur lacl, entraîné par un P L, tetO-1 promoteur entraînant l' expression constitutive du fait de l'absence d'une protéine répresseur TetR, ainsi qu'un système d'expression de la biotine contenant les P trc-2 promoteur suivi d'un site de liaison forte de ribosome (rbs) expression de bioB conduite. Tout le clonage a été exécuté dans une publicité, divisant rapidement E. coli stra. Le produit d' assemblage final a été transformé dans E. coli MG1655WT pour le test. Amorces (tableau 2) ont été achetés dans le commerce.

  1. Isoler le gène bioB du génome de E. coli en réalisant une réaction en chaîne de la polymérase de cellule entière (PCR):
    1. Cultiver les cellules E. coli MG 1655WT nuit à 37 ° C.
    2. Dans un tube de 0,2 ml PCR, mélanger 1 ul de la culture d'une nuit préparée à l'étape 2.1.1 avec 9 pi d'eau DI stérile.
    3. Incuber le tube à 95 ° C pendant 5 minutes dans un thermocycleur et transférer immédiatement le tube à un congélateur à -80 ° C pendant 10 min pour lyser les cellules. Ceci permet à l'ADN génomique de servir comme matrice de PCR.
    4. Décongeler la solution et d'ajouter: (i) 2,5 pi de chacune des amorces nBioB2-f1 et nBioB2-R, (ii) 5 ul de tampon de polymerase 5x ADN, (iii) 0,25 ul de l'ADN polymérase, (iv) 0,5 pi de mélange de dNTP et (v) 6,75 ul d'eau désionisée pour un volume réactionnel total de 25 ul(Tableau 4).
    5. Frappez le côté (c. -à- coup) le tube pour mélanger le contenu. Ensuite, immédiatement tourner rapidement dans le tube (~ 2 s) pour assurer que l'échantillon se trouve au fond du tube.
    6. Placer le tube dans un thermocycleur et en utilisant le programme décrit dans le tableau 3 , avec une étape supplémentaire de 3 minutes à 95 ° C au début du protocole.
    7. Valider avec succès par PCR en utilisant une électrophorèse sur gel (1,0 - 1,2% d'agarose dans de l'eau DI + bromure d'éthidium) dans la base de Tris, de l'acide acétique et du tampon EDTA (TAE). Le produit de PCR devrait être 1.070 paires de bases (pb) de long.
    8. En utilisant des kits commerciaux selon les instructions du fabricant pour extraire des fragments d'ADN à partir du gel de l'étape 2.1.7.
  2. Isoler le P trc-2 promoteur et l'opéron lad du plasmide pKDL071 13 (avec la permission du laboratoire de James Collins au MIT):
    1. Cultiver des cellules de E. coli contenantle plasmide pKDL071 nuit dans LB + Cb à 37 ° C.
    2. Extraire l'ADN plasmidique à partir des cellules en utilisant un kit miniprep commercial conformément aux instructions du fabricant. Le plasmide servira comme matrice de PCR.
    3. Suivre le protocole PCR à partir des étapes 2.1.4. à 2.1.8. avec les modifications suivantes:
    4. Remplacer des cellules lysées avec l'extrait du plasmide à l'étape 2.2.2.
    5. Utiliser 2,5 ul de chacune des amorces 1-f et 1-r pour l' extraction de la cassette lad. Vous pouvez également utiliser 2,5 ul de chacune des amorces nBioB1-f et nBioB1-r pour P trc-2 extraction.
    6. Effectuer une électrophorèse sur gel (étape 2.1.7) pour confirmer les produits de PCR sont la cassette lacl et P-2 trc site promoteur. Ils devraient être 1213 pb et 109 pb, respectivement.
  3. Utilisez l' épissage par extension de chevauchement (SOE) PCR pour construire la cassette bioB contenant P trc-2, un site de ribosome synthétique de liaison (RBS) dans l' amorce nBioB2-f2 et le bioB tableau 3.
  4. Constructions d'insertion (P L, tetO-1 + lad et P trc-2 + bioB) dans le pKE1-MCS vecteur plasmidique 13 squelette (avec la permission du laboratoire de James Collins au MIT) en digérant le vecteur et l' insérer avec des enzymes de restriction:
    1. Extraire des gènes en utilisant des enzymes de restriction et électrophorèse sur gel. Chaque réaction contient: (i) 5 ul de 10 x tampon de réaction, (ii) 1 pl de l'enzyme de restriction 1, (iii) 1 pl de l'enzyme de restriction 2, (iv) au moins 1 ug d'ADN, et (v) d'eau DI à amener le volume final à 50 pi (tableau 5). Digest avec des enzymes Aatll et EcoRI pour la cassette lad et avec les enzymes HindIII et SacII pour la cassette bioB.
    2. Après les réactions sont assemblés, eux et centrifuger brièvement (~ 2 s) vortex rapidement avant incubation pendant 1 h à 37 ° C.
    3. Pendantla digestion, préparer des gels d'électrophorèse selon des protocoles standards.
    4. Combiner l'ADN digéré avec le tampon de charge 6x électrophorèse sur gel.
    5. Utiliser une échelle de 2 log pour vérifier l'emplacement de la construction désirée, couper fragment d'ADN à partir du gel, et en utilisant des kits d'extraction de gel du commerce, selon les instructions du fabricant pour extraire des fragments d'ADN à partir du gel.
  5. Quantifier l'ADN en utilisant la spectroscopie et de calculer des volumes de 0: 1, 1: 1 et 3: 1 rapports insert molaires au vecteur en utilisant l'équation 1:
    L'équation 1 L' équation 1
    Dans l' équation 1, M est le rapport de l' insert au vecteur (0, 1, ou 3), X i est la quantité d'ADN d'insertion, Eb i est la longueur de l'insert en paires de bases pb v est la longueur du vecteur en paires de bases, et X c est la quantité de vecteurs (50 ng).
  6. Mélanger la réaction de ligature en combinant: (i) 1 pi 10X tampon Ligase, (ii)1 ul de ligase de T4, (iii) l' ADN du vecteur 50 ng, (iv) une masse d'ADN d'insertion spécifique à chaque réaction, et (v) de l' eau DI à 10 uL de volume de réaction total (tableau 6).
  7. Incuber à température ambiante (TA) pendant 1 h.
  8. Pendant l'incubation de ligature à l' étape 2.7, préparer des cellules chimiquement compétentes.
    1. Aliquoter 1 ml de cultures d'une nuit dans 1,5 ml des tubes de centrifugeuse.
    2. Centrifugeuse à 16.200 xg pendant 1 min.
    3. Décanter le surnageant et remettre le culot dans 200 ul de frais (sur la glace) 100 mM de CaCl2. Reprendre le culot en pipetant doucement. Ne pas vortex.
    4. Placer le tube de microcentrifugation sur la glace pendant 10 min.
    5. Centrifugeuse, retirer le surnageant, resuspendre le culot dans 100 pi de réfrigérés mM CaCl 2 100, et placer le tube sur la glace à nouveau.
    6. Centrifuger le tube une dernière fois et remettre en suspension le culot dans 50 ul de 100 mM refroidi CaCl 2.
    7. Endroitle tube sur la glace et utiliser immédiatement les cellules chimiquement compétentes.
  9. Ajouter 5 pi d'ADN ligaturé, préparé dans les étapes 2.6 et 2.7, à chaque tube de cellules compétentes préparées à l'étape 2.8.
  10. Agiter brièvement le tube en frappant le côté (ie chiquenaude) les tubes, puis placer les tubes sur la glace pendant 30 min.
  11. Choc thermique les tubes pendant 45 s à 42 ° C et retourner les tubes à la glace pendant 2 min.
  12. cellules pipettes sur gélose sélective LB + plaques antibiotiques et la propagation des cellules en utilisant des billes de placage de verre.
  13. Incuber les plaques pendant une nuit à 37 ° C.
  14. Le lendemain matin, ramasser des colonies de plaques d'insertion positive (ie, 1: 1 et 3: 1 plaques). Choisissez 3 colonies si le 0: négatif 1 plaque de contrôle ne montre aucune croissance, ou choisir 5-8 colonies si le 0: plaque 1 a une certaine croissance. Utiliser les colonies cueillies pour inoculer 5 ml de LB + antibiotique et croître pendant 8 h à 37 ° C sous agitation.
  15. Extraire l'ADN plasmidique à partir des cellules en utilisant un miniprkit ep, suivant les instructions du fabricant. Effectuer une coupe d'essai utilisant des enzymes de restriction (suivant la même procédure décrite à l'étape 2.4.1.).
  16. Identifier les cellules avec des constructions réussies en comparant la longueur des fragments d'ADN digérés avec les résultats attendus à partir d'un assemblage correct. Les cultures de plasmide portant les constructions réussies peuvent être conservées en mélangeant des parties égales de la culture avec une solution stérilisée par filtration, glycerol à 40% (dans de l'eau Dl) et de congélation du mélange à -80 ° C.
    NOTE: Les transformations des plasmides dans d' autres souches de E. coli (ie, MG1655WT) peut être accompli en suivant la procédure ci - dessus pour la fabrication de cellules chimiquement compétentes.

3. Cellule Caractérisation: Courbe de croissance et d'intervention Dose

  1. Cultivez souches modifiées pendant une nuit dans du milieu LB avec un antibiotique approprié.
  2. Pour les courbes de croissance, préparer 50 ml de milieu minimum M9 avec et sans IPTG (de 0,5 M stock) et / ou DTB (à partir de 500 pg / mL stock) comme suit:
    1. Préparer 0 ng / mL DTB (0 ul de stock) / 0 mM IPTG (0 ul de stock).
    2. Préparer 200 ng / mL DTB (200 pi de stock) / 0 mM IPTG (0 ul de stock).
    3. Préparer 0 ng / mL DTB (0 ul de stock) / IPTG 0,5 mM (50 pi de stock).
    4. Préparer 200 ng / mL DTB (200 pi de stock) / IPTG 0,5 mM (50 pi de stock).
    5. Inoculer avec la culture pendant une nuit à 1: 100 dans les médias indiqués ci-dessus.
    6. Dans une plaque de 96 puits, aliquote de 200 ul de la culture, en triple exemplaire, à chaque puits.
    7. Mesurer OD 600 toutes les 5 min pendant 24 h avec une agitation et une incubation continue à 37 ° C dans le lecteur de plaque.
  3. Pour les études de dose - réponse, remplacer le gène bioB dans pKE1-lad-bioB avec mCherry (une protéine fluorescente rouge) pour la quantification optique en temps réel.
  4. Ajouter des quantités d'IPTG allant de 0,1 mM à 5 mM pour induire l'expression variabledans du milieu LB.
  5. Inoculer la culture pendant une nuit à une dilution de 1: 100.
  6. Mesurer la fluorescence de toutes les 30 min pendant 15 h.

4. Induire biotine production à partir de cellules d'ingénierie et Surnageant Préparation

  1. Cultivez pKE1-lad-bioB dans la souche E. coli MG1655 pendant la nuit dans un milieu LB.
  2. Supplément milieu M9 avec DTB allant de 30 à 200 ng / ml.
  3. Ajouter 0,5 mM IPTG pour induire la synthèse de la biotine.
  4. Inoculer complétées, les médias M9 minimales sans biotine avec la culture pendant une nuit à 1: 100 dilution.
  5. Après 24 h de croissance, les cellules de centrifugation et recueillir le surnageant enrichi en biotine.
  6. Mesurer surnageant de biotine enrichi avec le contrôle indirect et le contrôle direct des surfaces fonctionnalisés. Utilisez le surnageant en place de l'échantillon de la biotine dans les étapes 5.23 et 6.12, respectivement.

5. Système de contrôle fonctionnalisés indirecte Préparation de la surface

  1. Préparer ee solutions suivantes.
    1. Préparer une solution consistant en le SMCC 20 mg / ml de succinimidyle trans-4- (maleimidylmethyl) cyclohexane-1-carboxylate (SMCC) dans du diméthylsulfoxyde (DMSO).
    2. Préparer une solution de SPDP consistant en 20 mg / ml de succinimidyl 3- (2-pyridyldithio) propionate (SPDP) dans du DMSO.
    3. Préparer 20 mg / mL LC-LC-biotine dans du DMSO.
    4. Préparer 10 mg / ml de peroxydase de raifort (HRP) dans du tampon phosphate salin (PBS).
    5. Préparer 10 mg / ml de streptavidine (SA) dans du PBS.
    6. Préparer 10 mg / ml de sérum-albumine bovine (BSA) dans du PBS.
    7. Préparer dithiothréitol 100 mM (DTT) dans de l'eau DI.
    8. Préparer l'acide 5 mM ethylenediaminetetaacetic (EDTA) dans du PBS.
    9. Préparer 0,5% de caséine dans du PBS.
    10. Préparer 20% Tween 80 actions dans l'eau DI.
    11. Préparer 0,05% de Tween 80 (de 20% stock) dans du PBS.
    12. Préparer 50 mM d'acétate de sodium dans de l'eau déminéralisée.
    13. Préparer 1% TMB dans le DMSO.
    14. Préparer 3% de H 2 O 2 in DI eau.
    15. Préparer 2 MH 2 SO 4 dans l' eau DI.
  2. Ajouter 1,4 ul de la solution de SPDP à 20 pi de solution SA.
  3. Incuber la solution de 5,2 pendant 1,5 h à température ambiante, enveloppé dans du papier d'aluminium pour éviter l'exposition à la lumière. Cette étape permet à l'agent de reticulation SPDP à se lier à SA par l'intermédiaire d'un groupe amino formant une SA pyridyldithio activée.
  4. Ajouter 2,4 ul de la solution de DDT à la solution issue de l'étape 5.3 et incuber pendant 1 h à température ambiante. Cela permet une pyridine thione-2 clivage, ce qui entraîne un rapport SA sulfhydryle activé.
  5. Ajouter 7,5 pi de solution SMCC à 72 pi de solution HRP et incuber pendant 1,5 h à la température ambiante, enveloppé dans du papier d'aluminium pour éviter l'exposition à la lumière. Il en résulte un HRP activée par maléimide lié par un groupe amino.
  6. Mélanger la solution 17 pi LC-LC-biotine avec 200 pi de solution de BSA et incuber pendant 1,5 h à température ambiante, enveloppé dans du papier d'aluminium pour éviter l'exposition à la lumière. Cette étape permet de biotine conjugué to BSA par l'intermédiaire d'une liaison amide.
  7. Transférer les solutions des étapes 5.4, 5.5 et 5.6 pour séparer les concentrateurs centrifuges dans les tubes de spin.
  8. Pour les tubes contenant SA-SPDP, à l'étape 5.4, centrifuger à 10 000 x g jusqu'à ce que le volume du tube atteigne 100 pi ou pendant 16 min. Remplir le tube de rotation à 500 ul avec du PBS-EDTA.
    1. Répétez l'étape 5.8 cinq fois. Rangez le stock à 4 ° C.
  9. Pour les tubes contenant HRP-SMCC, de l' étape 5.5, centrifugeuse à 10.000 xg jusqu'à ce que le volume atteint 25 pi ou pendant 16 min. Remplir le tube de rotation à 500 ul avec du PBS.
    1. Répétez l'étape 5.9 cinq fois. Rangez le stock à 4 ° C.
  10. Pour les tubes contenant BSA-biotine, de l' étape 5.6, centrifugeuse à 10.000 xg jusqu'à ce que le volume atteint 100 pi ou 12 min. Remplir le tube de rotation à 500 ul avec du PBS.
    1. Répétez l'étape 5.10 quatre fois.
    2. Centrifugeuse à 10.000 xg jusqu'à ce que le volume atteint 100 piou pendant 12 min. Ajouter 100 pi de PBS dans le tube. Rangez le stock à 4 ° C.
  11. Ajouter 25 ul de la solution de HRP 10 mg / mL avec 25 ul de 10 mg / ml de solution SA et conserver à 4 ° C pendant la nuit. Cela provoque la SA à devenir conjugué avec la HRP via une liaison thioéther.
    1. Préparer une solution 1: 4 de travail avec la solution pendant la nuit et magasin à 4 ° C réfrigérateur. solution restante de magasin à -20 ° C.
  12. Préparer deux solutions comprenant des BSA-biotine (ou BSA) dans du PBS, en ajoutant 10 pi d'actions BSA-biotine (ou 10 ul de BSA) à 490 ul de PBS.
  13. Ajouter 100 ul de la solution de l'étape 5.12 dans chaque puits d'une plaque de polystyrène à 96 puits.
  14. Incuber la plaque à 37 ° C pendant 1 h, enveloppé dans une feuille.
  15. Laver les puits de la plaque avec 0,05% de Tween 80.
    1. Ajouter 200 ul de 0,05% de PBS-Tween 80 dans les puits. Incuber pendant 2 minutes à température ambiante. Décanter le liquide.
    2. <li> Répétez l'étape 5.15.1 trois fois.
  16. Ajouter 200 ul de la solution de caséine à 0,5% pour chacun des puits dans la plaque à 96 puits.
  17. Incuber la plaque à 37 ° C pendant 1 h.
  18. Répétez l'étape 5.15 pour laver les puits trois fois.
  19. Préparer une solution en mélangeant 12 ml de solution de caséine à 0,5% avec 7,5 pi de 0,05% de Tween 80.
  20. Diluer le stock SA-HRP 1: 10.000 en utilisant la solution préparée à l'étape 5.19.
  21. Ajouter 80 ul de la solution préparée à l'étape 5.20 dans chaque puits d'une plaque à 96 puits.
  22. Ajouter 20 ul de l'échantillon de biotine disposé à chaque puits de la plaque de polystyrène. Le surnageant préparé à 4,6 peut être utilisé comme échantillon de biotine dans cette étape.
  23. Incuber la plaque à 37 ° C pendant 1 h. Cette étape permet la liaison compétitive entre la biotine libre et immobiliser BSA-biotine pour des sites de liaison SA-HRP.
  24. Répétez l'étape 5.15 pour laver les puits trois fois.
  25. Mélanger une solution d'acétate de sodium 50 mM, solution de TMB à 1%,et une solution à 3% de H 2 O 2 à 1000: le rapport 1 (20 ml de volume total): 10.
  26. Ajouter 200 ul de la solution de l'étape 5.25 à chaque puits et laisser reposer pendant 15 min à température ambiante, recouverts d'une feuille.
  27. Ajouter 50 pi de 2 MH 2 SO 4 à chaque puits pour arrêter la réaction. Mesurer OD 450 en utilisant un lecteur de plaque.

6. Contrôle direct Schéma fonctionnalisés Préparation de la surface

  1. Préparer les solutions suivantes.
    1. Préparer 20 mg / mL LC-LC-biotine dans du DMSO.
    2. Préparer 10 mg / mL HRP dans du PBS.
    3. Préparer 0,17 pg / ml dans du PBS SA.
    4. Préparer 0,5% de caséine dans du PBS.
    5. Préparer 20% Tween 80 actions dans l'eau DI.
    6. Préparer 0,05% de Tween 80 (de 20% stock) dans du PBS.
    7. Préparer 50 mM d'acétate de sodium dans de l'eau déminéralisée.
    8. Préparer 1% TMB dans le DMSO.
    9. Préparer 3% de H 2 O 2 dans de l' eau DI.
    10. Préparer 2 MH 2 SO 4 DI.
  2. Ajouter 7,5 pi LC-LC-biotine à 72 pi HRP et incuber à 1,5 h à température ambiante, enveloppé dans du papier d'aluminium pour éviter l'exposition à la lumière. Cette étape entraîne biotine conjugué à la HRP via une liaison amide.
  3. Transférer la solution de l' étape 6.2 vers un concentrateur centrifuge dans un tube à centrifuger
    1. Centrifuger la solution à 10.000 xg jusqu'à ce que le volume atteint 100 pi ou 12 min. Remplir le tube de rotation à 500 ul avec du PBS et répéter la centrifugation et l'addition PBS quatre fois. Rangez le stock à 4 ° C.
  4. Ajouter 100 ul de la solution de SA 6.1.3 à chaque puits dans une plaque à 96 puits en polystyrène.
  5. Incuber la plaque à 37 ° C pendant 1 h, enveloppé dans une feuille.
  6. Laver les puits de la plaque avec 0,05% de Tween 80.
    1. Ajouter 200 ul de 0,05% de Tween 80 dans les puits. Incuber pendant 2 minutes à température ambiante. Décanter le liquide.
    2. Répétez trois fois 6.6.1.
  7. Ajouter 200 ul de la solution de caséine à 0,5% pour chacun des puits dans la plaque à 96 puits.
  8. Incuber la plaque à 37 ° C pendant 1 h.
  9. Répétez l'étape 6.6 trois fois pour laver les puits.
  10. Diluer la biotine-HRP stock 1: 10.000 en utilisant la solution préparée à l'étape 6.3.
  11. Ajouter 80 ul de la solution préparée à l'étape 6.10 dans chaque puits d'une plaque à 96 puits.
  12. Ajouter 20 ul de l'échantillon de biotine disposé à chaque puits de la plaque de polystyrène. Le surnageant préparé à 4,6 peut être utilisé comme échantillon de biotine dans cette étape.
  13. Incuber la plaque à 37 ° C pendant 1 h. Cette étape permet la liaison compétitive entre la biotine libre et de la biotine-HRP pour les sites de liaison SA immobilisés.
  14. Répétez l'étape 6.6 pour laver les puits trois fois.
  15. Mélanger une solution 50 mM d'acétate de sodium, une solution de TMB à 1% et 3% de H 2 O 2 à une solution 1,000: 1 ratio (20 ml de volume total): 10.
  16. Ajouter 200 ul de la solution de l'étape 6.15 à chaque puits et incuber pendant 15 min à température ambiante, recouverts d'une feuille.
  17. Ajouter 50 pi de 2 MH 2 SO 4 solution à chaque puits pour arrêter la réaction. Mesurer OD 450 en utilisant un lecteur de plaque.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Les résultats représentatifs sont présentés dans les figures ci-jointes cinq. Tout d' abord, nous présentons le processus de clonage graphiquement (figure 1) , de sorte que le lecteur puisse suivre visuellement les étapes essentielles pour la création de la souche de E. coli synthétiquement ingénierie. Afin de caractériser la dynamique des populations des cellules, nous fournissons une courbe de croissance (Figure 2) générée en mesurant la densité optique à 600 nm (DO 600) de la population. Ensuite, nous montrons comment le réseau de gène régulateur est vérifiée, en utilisant mCherry comme un proxy pour bioB (Figure 3), ce qui nous permet de mesurer optiquement la quantité relative de bioB qui serait produite par la cellule lors de l' induction avec IPTG. Ensuite, nous présentons des données de réponse pour le indirecte contrôle et surfaces fonctionnalisés directe de contrôle. Ces parcelles de données (figure 4) ont été développés en utilisant des solutions de mesure du librebiotine pour caractériser les profils de réponse des surfaces fonctionnalisés. Enfin, nous présentons des données caractéristiques montrant comment les cellules modifiées sont amenés à produire de la biotine (figure 5), modifiant ainsi les surfaces fonctionnalisés.

Figure 1
Figure 1: Conception et construction de inductibles, les cellules modifiées. (A) Les amorces ont été conçues pour isoler le gène bioB à partir du génome de E. coli, qui code pour une enzyme cruciale dans la voie de synthèse de la biotine. (B) La P L, tetO-1 et P trc -lacI-2 , les séquences peuvent être isolées à partir d' un plasmide contenant un commutateur génétique avec des amorces correspondantes. (C) Le gène bioB extrait et les deux fragments de l'interrupteur à bascule peuvent ensuite être utilisées pour créer le circuit de gène. L'ajout d'IPTG peut alors indUCE l'expression de bioB et la synthèse de ce fait lors de la biotine DTB est ajouté en tant que substrat pour bioB. (D) Le plasmide assemblé a été transformé en K-12 MG1655 de E. coli. Cela a provoqué la présence d'IPTG pour induire l'expression et la synthèse de bioB ainsi biotine par la lignée cellulaire modifiée lors DTB a été fournie en tant que substrat. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 2
Figure 2: Courbes de croissance pour les cellules modifiées. Les cellules inductibles MG1655 ingénierie de type sauvage ont été cultivées et surveillées en milieu minimal (ie, sans biotine-M9 médias), ainsi que des milieux minimaux complété avec DTB (200 ng / ml) et / ou IPTG (0,5 mM). Les courbes montrent la DO 600 lecture, mesurée toutes les 5 mi n pendant 24 h. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

figure 3
Figure 3: Test du gène Réseau Engineered. La protéine fluorescente mCherry a été utilisé à la place de la gène bioB afin que nous puissions optiquement mesurer le profil d'induction lorsque les cellules modifiées ont été induites avec IPTG. Nous comparons les cellules induites avec IPTG (diamants rouges) avec les cellules non induites avec IPTG (diamants bleus). Ces résultats démontrent l'efficacité du réseau de gène inductible. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

/55300/55300fig4.jpg "/>
Figure 4: Vérification de l'Interface Material fonctionnalisés. En exposant notre surface fonctionnalisée à des concentrations de biotine différents, nous sommes capables de mesurer la réponse optique en mesurant la DO450 absorbance. Ces résultats permettent de générer une courbe d'étalonnage qui relie la concentration de la biotine à l'intensité optique de la réponse. Ici, nous présentons la biotine par rapport à des courbes de signaux optiques pour les deux régimes de surface indirecte (à gauche) et directe (à droite) fonctionnalisés. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 5
Figure 5: Engineered Control Cells Interface Material. En utilisant des sections de protocole 5 ou 6, nous sommes en mesure d'utiliser les produits de induite, c ingénierieaunes pour modifier chimiquement la surface fonctionnalisée. Nous pouvons surveiller ces réponses optiquement par la mesure de la DO 450. En outre, en utilisant la courbe d'étalonnage établie à la figure 4, on peut relier l'intensité optique de la réponse à la biotine à l'intérieur de la concentration. Nous présentons ici les différentes concentrations de biotine, mesurée par notre système fonctionnalisé surface de contrôle indirect, pour les cellules de type sauvage (blanc), des cellules non induites contenant le plasmide pKE1-lad-bioB (orange), et les cellules induites contenant le pKE1-lad-bioB plasmide (gris). S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Chimique La concentration finale Montant
sels 5x M9 1 fois 20 ml
1 M MgSÛ4 2 mM 200 ul
1 M CaCl2 0,1 mM 10 ul
20% de glucose 0,40% 2 ml
2% d'acide casamino sans biotine 0,02% 1 ml
DI eau N / A 76,8 mL

Tableau 1: Recette M9 Media.

prénom séquence d' amorce Usage
1-f CCGCCGGAATTCTCCCTATCAGTGATAGAGATT l'extraction de la cassette lad
1-r CCGACGTCTCACTGCCCGCTTTCCAGTC l'extraction de la cassette lad
nBioB1-f CCCAAGCTTCTGAAATGAGCTGTTGACAATTAATCAT P trc-2 extraction
nBioB1-r GGGGGGTTCTTTTAATAAAGGTACCGTGTGAAATTGTT P trc-2 extraction
nBioB2-f1 ACCCCCCTAAGGAGGTCATCATGGCTCACCGCCCACG extraction bioB
nBioB2-r TCCCCGCGGTCATAATGCTGCCGCGTTGTAATATTC extraction bioB
nBioB2-f2 ACGGTACCTTTATTAAAAGAACCCCCCTAAGGAGGTCATC plus synthétique RBS

Tableau 2: Liste des apprêts.

Étape 1
Étape 2 Étape 3 Étape 4 Etape 5 Etape 6 Etape 7 Etape 8 Etape 9
98 ° C, 98 ° C, 70 ° C, 72 ° C, 98 ° C, 60 ° C, 72 ° C, 72 ° C, 4 ° C
00h30 00h10 00h30 01: 00 / kb 00h10 00h30 01: 00 / kb 02h00
Répétez 12 fois Répétez 25 fois
-1 ° C / cycle de

Tableau 3: Programme de PCR.

prénom Le volume
Cellule Lysate (modèle) 10 ul
Primer (chaque) 0,625 pi (chaque)
un tampon 5x Q5 5 ul
Q5 Polymerase 0,25 pi
Mix dNTP 0,5 ul
DI eau 6,75 pi

Tableau 4: Réaction PCR Whole Cell (25 pi).

prénom Le volume
dixx tampon de réaction 5 ul
Enzyme 1 1 ul
Enzyme 2 1 ul
Patron de l'ADN 1 pg
DI eau 43 pi - volume d'ADN

Tableau 5: Restriction Enzyme Digestion Reaction (50 pi).

prénom Le volume
ADN 50 pg vecteur + X pg insert
10x Ligase Buffer 1 ul
T4 Ligase 1 ul
DI eau 8 pi - volume d'ADN

Tableau 6: Ligation Reaction (10 pi).

prénom Concentration Remarques
CaCl2 100 mM
Carbeniccilin 50 mg / mL (1000x)
DTB 50 pg / ml
IPTG 0,5 M
SMCC 20 mg / mL 2 mg dans 100 ul de DMSO
SPDP 20 mg / mL 2 mg dans 100 ul de DMSO
LC-LC-biotine 20 mg / mL 2 mg dans 100 ul de DMSO
HRP 10 mg / mL dans du PBS
SA (indirecte) 10 mg / mL dans du PBS
SA (directe) 0,17 pg / ml dans du PBS
BSA 20 mg / mL dans du PBS
TNT 100mM Dans DI Eau
EDTA 5 mM 18,6 mg dans 10 ml de PBS
Caséine 0,50% dans du PBS
Tween 80 20% Dans DI Eau
Tween 80 dans du PBS 0,05%
L'acétate de sodium 50 mM, Dans DI eau, Ajuster à 5,1 pH en utilisant HCl 3 M
TMB 1% Dans le DMSO
H 2 O 2 3% Dans DI Eau
H 2 SO 4 2 M Dans DI Eau

Tableau 7: Liste des réactifs Solutions.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Nous avons présenté une nouvelle stratégie pour l'interfaçage des cellules modifiées vivant avec une surface de matériau fonctionnalisé. Ceci a été accompli en mettant au point une lignée de cellules capables de synthétiser des taux élevés de la biotine lors de l'induction avec de l'IPTG. Les niveaux élevés de biotine peuvent ensuite être utilisés pour modifier la surface fonctionnalisée. Les protocoles détaillés comment ingénieur de la lignée cellulaire E. coli et comment créer deux surfaces fonctionnalisés différents.

Les étapes critiques de ce protocole se produisent tout au long de la construction de la lignée cellulaire d'ingénierie. Pour éviter les problèmes en aval, caractérisant les souches de cellules modifiées avec les deux courbes de croissance (Figure 2) et de réponse fluorescente (figure 3) est encouragée. Si les questions de procédure se poser, d' autres stratégies de clonage moléculaire, tels que l' extraction PCR et Gibson ensemble 14, peut être remplacé par des mesures le cas échéant. Pour optimiser la yie biotineld de la lignée cellulaire modifiée, il est essentiel de s'assurer qu'une quantité suffisante de DTB est fourni aux cellules. Dans nos études, nous avons constaté que 200 ng / ml DTB a provoqué une augmentation substantielle et statistiquement significative dans la production de biotine, lorsque les cellules ont été induites avec de l'IPTG. En outre, la conjugaison réussie de BSA-biotine, SA-HRP, et biotine-HRP est crucial pour la réalisation et le suivi des programmes directs et indirects de contrôle efficace. Prenez soin d'éviter toute exposition inutile à la lumière et permettre aux conjugués à incuber une nuit à 4 ° C pour assurer un conjugué efficace est formé.

Notre protocole offre des avantages par rapport à d' autres méthodes 15 en raison de sa capacité à détecter de petites quantités de biotine qui sont biologiquement pertinents (p échelle / mL) par rapport à disponibles dans le commerce des kits de détection de la biotine, tels que ceux à base d'acide 4'-hydroxyazobenzène-2-carboxylique stratégies de liaison compétitive. Bien que l'utilisation de la streptavidine-biosystème d' étain est commun en biotechnologie 16, 17, la capacité de notre système à répondre à de petites quantités de biotine nous permet de relier directement notre lignée cellulaire génétiquement modifiée avec la surface fonctionnalisés.

Une limitation potentielle de notre protocole est la gamme dynamique résultant de la détection de la biotine. Dans les schémas directs et indirects de contrôle, nous sommes en mesure de détecter la biotine entre 10 2 -10 3 et 10 4 -10 6 pg / mL, respectivement (figure 4). Heureusement, le bas de gamme du système de contrôle indirect nous permet de détecter facilement la production de biotine à partir de cellules modifiées. Cependant, la bande étroite de la plage dynamique de contrôle indirect limite sa capacité à détecter des changements importants (100 fois) à des concentrations de biotine. Modification de la plage dynamique pour les deux régimes indirects et directs de contrôle nécessiterait ingénierie supplémentaire. Toutefois, si la détection de cellules produisentd biotine est un problème, la préparation des dilutions du surnageant biotine à l' étape 4.6 devrait permettre au chercheur de cibler la gamme dynamique du système de contrôle indirect (figure 5). Nous avons constaté qu'une dilution 1: 5 du surnageant nous a permis de cibler la plage dynamique du système de contrôle indirect de manière efficace. Cette stratégie de dilution devrait réduire la nécessité de modifier directement la plage dynamique.

Les deux parties, le système cellulaire matériel présenté ici permet de cellules conçu pour modifier la composition d'une surface fonctionnalisée. cellules dynamiques, vivantes peuvent interpréter leur environnement chimique pour produire une réponse génétique. En orchestrant cette réponse génétique pour augmenter la production de la biotine, nous pouvons doter des cellules vivantes d'ingénierie avec la capacité de contrôler et de manipuler une surface fonctionnalisés. En suivant les protocoles présentés, les cellules modifiées sont capables d'agir en tant que capteurs dynamiques, capables de lire, le traitement et l'enregistrement des conditions autour de them via des interfaces fonctionnalisés. Cette technologie pourrait avoir un impact des domaines allant de la médecine moléculaire pour la détection d'analyte pour l'assainissement de l'environnement.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs n'ont rien à dévoiler.

Acknowledgments

Les auteurs remercient le soutien de l'attribution FA9550-13-1-0108 de l'Air Force Office de la recherche scientifique des Etats-Unis. Les auteurs reconnaissent en outre le soutien de l'attribution N00014-15-1-2502 de l'Office of Naval Research des Etats-Unis, le financement de l'Institut de technologie de critique et de sciences appliquées à Virginia Polytechnic Institute et l'Université d'Etat, et de la National Science Foundation Graduate Research Programme de bourses, le numéro d'attribution 1607310.

Materials

Name Company Catalog Number Comments
LB Broth, Miller  Fisher Scientific 12-795-027
Agar Fisher Scientific BP9744500
Carbenicillin  Fisher Scientific BP26481
M9, Minimimal Salts, 5x Sigma-Aldrich M6030
Casamino Acids  Fisher Scientific BP1424-100
Magnesium Sulfate, Anhydrous Fisher Scientific M65-500
Calcium Chloride, Dihydrate Fisher Scientific C79-500
Dextrose (D-Glucose), Anhydrous Fisher Scientific D16-1
NEB Turbo Cell Line New England Biolabs C2984l
Oligonucleotide Primers Thermo Fisher Scientific N/A 25N synthesis, DSL purification
Q5 High-Fidelity Polymerase New England Biolabs M0491S
Q5 Reaction Buffer New England Biolabs B9027S
dNTP Solution Mix New England Biolabs N0447S
Agarose Bioexpress E-3120-125
Ethidium Bromide, 1% Fisher Scientific BP1302-10
Gel Extraction Kits Epoch Biolabs 2260250
GenCatch Plasmid DNA Miniprep Kit Epoch Biolabs 2160250
AatII New England Biolabs R0117S
SacII New England Biolabs R0157S
HindIII-HF New England Biolabs R3104S
EcoRI-HF New England Biolabs R3101S
Cutsmart Buffer New England Biolabs B7204S
T4 DNA Ligase New England Biolabs M0202S
T4 DNA Ligase Reaction Buffer New England Biolabs B0202S
ColiRolle Glass Plating Beads  EMD Millipore 7101-3
Glycerol Fisher Scientific BP229-1
Isopropyl β-D-1-thiogalactopyranoside (IPTG) Fisher Scientific BP1755-10
NHS-Desthiobiotin (DTB) Thermo Fisher Scientific 16129
Succinimidyl Trans-4-(maleimidylmethyl) Cyclohexane-1-Carboxylate (SMCC)  Thermo Fisher Scientific S1534
Dimethyl Sulfoxide (DMSO)  Fisher Scientific BP231-100
Succinimidyl 3-(2-pyridyldithio) Propionate (SPDP)  Thermo Fisher Scientific S1531
NHS-LC-LC-biotin Thermo Fisher Scientific 21343
Horseradish Peroxidase (HRP)  Thermo Fisher Scientific 31490
Phosphate Buffered Saline (PBS), 10x Solution Fisher Scientific BP399500
Streptavidin (SA)  Thermo Fisher Scientific 21145
Bovine Serum Albumin (BSA) Fisher Scientific BP1600-100
Dithiothreitol (DTT) Fisher Scientific BP172-5
Ethylenediaminetetaacetic acid (EDTA)  Fisher Scientific S311-500
Tween 80  Fisher Scientific T164-500
Hydrogen Peroxide Fisher Scientific H325-4
3, 3', 5, 5'-tetramethylbenzidine (TMB) Fisher Scientific AC229280050
Vivaspin 500 Centrifugal Concentrators  Viva Products VS0192
Sodium Acetate, Anhydrous Fisher Scientific BP333-500
96-Well Polystyrene Plates Thermo Fisher Scientific 266120

DOWNLOAD MATERIALS LIST

References

  1. Zhang, R., Heyde, K. C., Scott, F. Y., Paek, S. -H., Ruder, W. C. Programming Surface Chemistry with Engineered Cells. ACS Synth. Biol. (2016).
  2. Zhou, X., et al. Reduced graphene oxide films used as matrix of MALDI-TOF-MS for detection of octachlorodibenzo-p-dioxin. Chem. Commun. 46, 6974-6976 (2010).
  3. Pardee, K., et al. Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components. Cell. 165, 1255-1266 (2016).
  4. Bähring, S., et al. Design and Sensing Properties of a Self-Assembled Supramolecular Oligomer. Chem. Eur. J. 22, 1958-1967 (2016).
  5. Nicolau Jr, D. V., Armitage, J. P., Maini, P. K. Directional persistence and the optimality of run-and-tumble chemotaxis. Comp. Biol. Chem. 33, 269-274 (2009).
  6. Du, J., Shao, Z., Zhao, H. Engineering microbial factories for synthesis of value-added products. J. Ind. Microbiol. Biotechnol. 38, 873-890 (2011).
  7. Kim, H., Kim, M. J. Electric Field Control of Bacteria-Powered Microrobots Using a Static Obstacle Avoidance Algorithm. IEEE Trans. Rob. 32, 125-137 (2016).
  8. Gardner, T. S., Cantor, C. R., Collins, J. J. Construction of a genetic toggle switch in Escherichia coli. Nature. 403, 339-342 (2000).
  9. Heyde, K. C., Ruder, W. C. Exploring Host-Microbiome Interactions using an in Silico Model of Biomimetic Robots and Engineered Living Cells. Sci. Rep. 5, 11988 (2015).
  10. Rice, M. K., Ruder, W. C. Creating biological nanomaterials using synthetic biology. Sci. Tech. Adv. Mater. 15, 014401 (2014).
  11. Green, N. M. Avidin. 3. The nature of the biotin-binding site. Biochem. J. 89, 599-609 (1963).
  12. Mesulam, M. M. Tetramethyl benzidine for horseradish peroxidase neurohistochemistry: a non-carcinogenic blue reaction product with superior sensitivity for visualizing neural afferents and efferents. J Histochem. Cytochem. 26, 106-117 (1978).
  13. Litcofsky, K. D., Afeyan, R. B., Krom, R. J., Khalil, A. S., Collins, J. J. Iterative plug-and-play methodology for constructing and modifying synthetic gene networks. Nat. Meth. 9, 1077-1080 (2012).
  14. Gibson, D. G., et al. Complete Chemical Synthesis, Assembly, and Cloning of a Mycoplasma genitalium Genome. Science. 319, 1215-1220 (2008).
  15. Diamandis, E. P., Christopoulos, T. K. The biotin-(strept)avidin system: principles and applications in biotechnology. Clin. Chem. 37, 625-636 (1991).
  16. Nerurkar, L. S., Namba, M., Brashears, G., Jacob,, Lee, A. J., Sever, Y. J., L, J. Rapid detection of herpes simplex virus in clinical specimens by use of capture biotin-streptavidin enzyme-linked immunosorbent assay. J. Clin. Micro. 20, 109-114 (1984).
  17. Cui, Y., Wei, Q., Park, H., Lieber, C. M. Nanowire Nanosensors for Highly Sensitive and Selective Detection of Biological and Chemical Species. Science. 293, 1289-1292 (2001).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics