Utilizzando biologia sintetica per Ingegnere cellule viventi che si interfacciano con materiali programmabili

* These authors contributed equally
JoVE Journal
Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Questo documento presenta una serie di protocolli per lo sviluppo di cellule ingegnerizzate e superfici funzionalizzate che consentono sinteticamente progettati E. coli di controllare e manipolare superfici materiche programmabili.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Heyde, K. C., Scott, F. Y., Paek, S. H., Zhang, R., Ruder, W. C. Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials. J. Vis. Exp. (121), e55300, doi:10.3791/55300 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Abbiamo sviluppato un'interfaccia abiotico-biotici che permette alle cellule ingegnerizzate per controllare le proprietà del materiale di una superficie funzionalizzata. Questo sistema è composto creando due moduli: un ceppo sinteticamente stratificato di cellule di E. coli e un'interfaccia materiale funzionalizzato. All'interno di questo documento, i dettagli di un protocollo per l'ingegneria genetica comportamenti selezionati all'interno di un ceppo di E. coli che utilizzano strategie di clonazione molecolare. Una volta sviluppato, questo ceppo produce livelli elevati di biotina quando esposti ad un induttore chimico. Inoltre, noi dettaglio protocolli per creare due superfici funzionalizzate differenti, ognuno dei quali è in grado di rispondere alla biotina cellule sintetizzato. Nel loro insieme, presentiamo una metodologia per la creazione di un sistema collegato, abiotici-biotici che permette progettato cellule per controllare la composizione dei materiali e il montaggio su substrati non viventi.

Introduction

Qui, si riportano le procedure per sviluppare un substrato programmabile capace di rispondere ad un segnale chimico da una linea cellulare ingegnerizzata. 1 Facciamo questo con la creazione di una interfaccia biotina-streptavidina che risponde alla biotina prodotta da coli sinteticamente ingegnerizzato Escherichia (E. coli) cellule. In precedenza, le superfici programmabili sono stati progettati per una vasta gamma di applicazioni, dalla rilevazione della tossina 2 e point-of-care diagnosi 3 di difesa e sicurezza. 4 Mentre superfici programmabili possono essere utili come sensori e attuatori, possono essere fatti "intelligenti" di dotandoli la capacità di adattarsi a differenti sfide ambientali. Al contrario, anche microrganismi semplici, come E. coli, hanno adattabilità intrinseca e sono in grado di rispondere alle sfide con soluzioni sofisticate e spesso inaspettati. Questa capacità di adattamento ha permesso E.popolazioni coli, controllate dai loro reti geniche complesse, a costi contenuti cercare risorse, 5 creare prodotti a valore aggiunto, 6 e perfino la robotica micro-scala di potenza. 7 Accoppiando i vantaggi adattivi di cellule viventi con l'uso di superfici programmabili, possiamo creare un substrato intelligente in grado di rispondere alle diverse condizioni ambientali.

Biologia sintetica ha dato ricercatori nuove capacità di programmare il comportamento degli organismi viventi. Da Engineering cellule di contenere reti di regolazione nuovo gene, i ricercatori possono progettare le cellule che presentano una serie di comportamenti programmati. 8, 9 Al di là della ricerca di base, questi comportamenti possono essere utilizzati per applicazioni come il controllo assemblaggio materiale e biologicamente la produzione di prodotti a valore aggiunto. 10 Qui, abbiamo dettaglio come abbiamo utilizzato gli strumenti della biologia sintetica per itgineer un ceppo di E. coli che sintetizza biotina su di induzione. Questo ceppo è stato sviluppato utilizzando metodi enzima di restrizione di clonazione per assemblare un plasmide, pKE1-lacI-bioB. Questo plasmide, quando trasformato in ceppo di E. coli K-12 MG1655, conferisce cellule con la capacità di esprimere livelli elevati di bioB, un enzima essenziale per la sintesi biotina. Quando le cellule trasformate sono state indotte con isopropil β-D-1-thiogalactopyranoside (IPTG) e provvisto di un precursore biotina, desthiobiotin (DTB), sono stati prodotti livelli elevati di biotina.

interazione Legame di biotina con streptavidina è uno dei più forti legami non covalenti presenti in natura. Come tale, l'interazione biotina-streptavidina è sia ben caratterizzati e altamente impiegati in biotecnologia. 11 All'interno di questo manoscritto, presentiamo due strategie che impiegano l'interazione biotina-streptavidina per rilevare e rilevare biotina cellule-prodotto con una superficie funzionalizzata. Noifare riferimento a queste superfici contrastanti come schemi di controllo "diretto" "indiretti" e. Nello schema controllo indiretto, biotina cellule prodotte compete con biotina che è stato coniugato e immobilizzato su una superficie polistirolo da streptavidina siti di legame. Inoltre, la streptavidina è coniugato con perossidasi di rafano (HRP). HRP modifica 3, 3 ', 5, 5'-tetrametilbenzidina (TMB), per produrre un segnale ottico, 12 che possono essere monitorato quantificando l'assorbanza spettrale (cioè, densità ottica) a 450 nm (OD 450). Così, il sistema di controllo indiretto consente ai ricercatori di misurare biotina cellule-prodotto dal monitoraggio del attentuation del segnale OD 450.

Lo schema di controllo diretto sfrutta l'evento streptavidina-biotina immobilizzando streptavidina direttamente ad una superficie del materiale e consentendo biotina cellule prodotte e HRP biotinilato a competere per streptavidina siti di legame. Ancora una volta, lalivelli relativi di biotina cellule prodotte sono monitorati misurando un segnale OD 450.

Nel loro insieme, le cellule ingegnerizzate e le superfici funzionalizzate ci permettono di controllare le proprietà di una superficie programmabili inducendo reti nelle cellule viventi. In altre parole, abbiamo creato un sistema che sfrutta l'adattabilità degli organismi viventi e l'affidabilità e la specificazione di un'interfaccia materiale ingegnerizzato collegando questi sistemi.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Media e Cultura Preparazione

  1. Preparare il brodo lisogenia (LB) supporti miscelando 25 g di polvere stock LB con 1 L di acqua deionizzata (DI) e sterilizzazione in autoclave la soluzione a 121 ° C per 20 minuti per sterilizzare.
    1. Per preparare piastre LB, aggiungere 15 g di agar (1,5%) per il supporto LB prima della sterilizzazione
    2. Preparare soluzioni di 1,000x carbenicillina (Cb) in acqua deionizzata (50 mg / ml).
    3. Se la preparazione di supporti LB che include un antibiotico per la selezione dei trasformanti resistenti, attendere fino a quando la temperatura del supporto LB sterilizzato è inferiore a 60 ° C, e quindi aggiungere 1 ml di magazzino antibiotico per ogni 1 ml di LB media.
  2. Per M9 terreno minimo (Tabella 1), preparare le soluzioni di magazzino separata dei seguenti: sali 5X M9 (56,4 g / l), 1 M MgSO 4, 1 M CaCl 2, il 20% di glucosio, e 2% di acidi Casamino senza biotina.
    1. In una bottiglia di sicurezza autoclave, unire 20 ml di 5x M9 sali, 200 &# 181; L di 1M MgSO 4, 10 ml di 1 M CaCl 2, 2 ml di 20% di glucosio, 1 mL di acidi Casamino privo di biotina 2% e 76,8 mL di acqua deionizzata.
    2. Autoclavare soluzione preparata al punto 1.2.1 a 121 ° C per 20 min.
  3. Incubare tutte le colture a 37 ° C con agitazione a 400 rpm. I tempi di incubazione variano a seconda della sperimentazione e la tensione, ma in genere dura 8-12 ore.

2. Generazione di biotina E. coli produttori (plasmidi pKE1-lacI-bioB)

NOTA: Il circuito genetico contiene due parti: un repressore lacI, mosso da una P L, teto-1 promotore conseguente espressione costitutiva per l'assenza di una proteina repressore tetR, nonché un sistema di espressione biotina, contenente la P trc-2 promotore seguito da un sito di legame forte ribosoma (RBS) espressione di bioB guida. Tutti clonazione è stato eseguito in una, in rapida divisione E. coli Stra commercialein. Il costrutto finale è stato trasformato in E. coli MG1655WT per il test. Primer (Tabella 2) sono stati acquistati in commercio.

  1. Isolare bioB gene da E. coli genoma eseguendo cellula intera reazione a catena della polimerasi (PCR):
    1. Crescere le cellule di E. coli MG 1655WT notte a 37 ° C.
    2. In un tubo di 0,2 ml PCR, unire 1 ml di cultura durante la notte preparato al punto 2.1.1 con 9 ml di acqua deionizzata sterile.
    3. Incubare la provetta a 95 ° C per 5 minuti in un termociclatore e trasferire immediatamente il tubo fino a C freezer -80 ° per 10 minuti per lisare le cellule. Ciò consente DNA genomico per servire come modello PCR.
    4. Scongelare la soluzione e aggiungere (i) 2,5 microlitri ciascuno dei primer nBioB2-f1 e nBioB2-r, (ii) 5 ml di tampone polimerasi 5x DNA, (iii) 0,25 ml di DNA polimerasi, (iv) 0,5 ml di miscela dNTP e (v) 6.75 ml di acqua deionizzata per un volume di reazione totale di 25 microlitri(Tabella 4).
    5. Sciopero lato (cioè, flick) la provetta per mescolare il contenuto. Successivamente, girare immediatamente nel tubo rapidamente (~ 2 s) per garantire il campione è al fondo della provetta.
    6. Posizionare il tubo in un termociclatore PCR e utilizzare il programma descritto in Tabella 3 con una fase addizionale di 3 min a 95 ° C all'inizio del protocollo.
    7. Conferma successo PCR usando elettroforesi su gel (1.0 - 1,2% agarosio in acqua deionizzata + bromuro di etidio) in Tris base, acido acetico, e tampone EDTA (TAE). Il prodotto di PCR dovrebbe essere 1.070 paia di basi (bp) di lunghezza.
    8. Utilizzare kit commerciali in base alle istruzioni del produttore per estrarre frammenti di DNA da gel dal punto 2.1.7.
  2. Isolare la P TRC-2 promotore e l'operone lacI dal plasmide pKDL071 13 (per gentile concessione del laboratorio di James Collins al MIT):
    1. Crescere le cellule di E. coli contenentiil plasmide pKDL071 pernottamento in LB + Cb a 37 ° C.
    2. Estrarre il DNA plasmide dalle cellule utilizzando un kit commerciale miniprep secondo le istruzioni del produttore. Il plasmide servirà come modello PCR.
    3. Seguire il protocollo di PCR da gradini 2.1.4. a 2.1.8. con le seguenti modifiche:
    4. Sostituire cellule lisate con l'estratto plasmide al punto 2.2.2.
    5. Utilizzare 2,5 ml ciascuno di primer 1-F e 1-R per l'estrazione lacI cassetta. In alternativa, utilizzare 2,5 ml ciascuna di primer nBioB1-F e nBioB1-R per la P TRC-2 estrazione.
    6. Eseguire elettroforesi su gel (fase 2.1.7) per confermare i prodotti di PCR sono la cassetta lacI e P sito promotore TRC-2. Essi dovrebbero essere 1213 bp e 109 bp lunga rispettivamente.
  3. Utilizzare splicing per estensione sovrapposizione (SOE) PCR per costruire la cassetta contenente bioB P TRC-2, un sito ribosoma sintetico di legame (RBS) in fondo nBioB2-f2, e il bioB tabella 3.
  4. Costrutti INSERT (P L, teto-1 + lacI e P TRC-2 + bioB) nel pKE1-MCS vettore plasmidico 13 spina dorsale (per gentile concessione del laboratorio di James Collins al MIT) per digerire il vettore e inserire con enzimi di restrizione:
    1. Estrarre geni usando enzimi di restrizione e elettroforesi su gel. Ogni reazione contiene (i) 5 ml di 10x tampone di reazione, (ii) 1 ml di enzima di restrizione 1, (iii) 1 ml di enzima di restrizione 2, (iv) almeno 1 mg di DNA, e (v) acqua deionizzata per portare il volume finale a 50 microlitri (Tabella 5). Digest con gli enzimi AatII e EcoRI per la cassetta lacI e con gli enzimi HindIII e SacII per il cassetto bioB.
    2. Dopo le reazioni sono assemblati, li e centrifugare brevemente (~ 2 s) vortice velocemente prima incubazione per 1 ora a 37 ° C.
    3. Durantela digestione, preparare gel per elettroforesi secondo protocolli standard.
    4. Combinare DNA digerito con elettroforesi su gel di buffer 6x carico.
    5. Utilizzare una scala 2-log per verificare posizione del costrutto desiderata, tagliare frammento di DNA dal gel, e utilizzare i kit di estrazione gel commerciali in base alle istruzioni del produttore per estrarre frammenti di DNA dal gel.
  5. Quantificare il DNA utilizzando la spettroscopia e calcolare i volumi per 0: 1, 1: 1, e 3: 1 rapporti molari Inserisci per vettore con l'equazione 1:
    Equazione 1 Equazione 1
    Nell'equazione 1, M è il rapporto tra inserto vettore (0, 1 o 3), X i è la quantità di DNA dell'inserto, bp i è la lunghezza dell'inserto in paia di basi, bp v è la lunghezza del vettore in paia di basi, e X v è la quantità di vettore (50 ng).
  6. Mescolare reazione legatura combinando (i) 1 ml 10X Ligase Buffer, (ii)1 ml T4 ligasi, (iii) 50 ng del DNA vettoriale, (iv) una massa di inserto di DNA specifiche per ogni reazione, e (v) acqua deionizzata a 10 microlitri volume totale di reazione (Tabella 6).
  7. Incubare a temperatura ambiente (RT) per 1 h.
  8. Durante l'incubazione legatura al punto 2.7, preparare le cellule chimicamente competenti.
    1. Aliquota 1 ml di culture durante la notte in provette da 1,5 ml per centrifuga.
    2. Centrifugare a 16.200 g per 1 min.
    3. Decantare il surnatante e risospendere il pellet in 200 ml di acqua refrigerata (su ghiaccio) 100 mM CaCl 2. Risospendere il pellet pipettando delicatamente. Non farlo vortice.
    4. Posizionare la provetta in ghiaccio per 10 min.
    5. Centrifuga, rimuovere il surnatante, risospendere il pellet in 100 ml di acqua refrigerata 100 mM CaCl 2, e posizionare nuovamente la provetta in ghiaccio.
    6. Centrifugare il tubo un'ultima volta e risospendere il pellet in 50 ml di acqua refrigerata 100 mM CaCl 2.
    7. Postola provetta in ghiaccio e utilizzare immediatamente le cellule chimicamente competenti.
  9. Aggiungere 5 ml di DNA legatura, preparati in passi 2.6 e 2.7, ad ogni provetta di cellule competenti, preparati al punto 2.8.
  10. Agitare la provetta brevemente colpendo il lato (cioè flicking) i tubi e quindi posizionare i tubi in ghiaccio per 30 min.
  11. Heat Shock i tubi per 45 s a 42 ° C e tornare i tubi in ghiaccio per 2 minuti.
  12. cellule pipette Onto selettivo agar LB + piastre antibiotici e diffondere le cellule utilizzando perline di placcatura di vetro.
  13. Incubare le piastre per una notte a 37 ° C.
  14. La mattina seguente, scegliere colonie da lastre inserto-positivo (cioè, 1: 1 e 3: 1 piastre). Scegli 3 colonie se la 0: piastra di controllo negativo 1 mostra nessuna crescita, o pick 5-8 colonie se la 0: 1 piatto ha una certa crescita. Utilizzare le colonie raccolte per inoculare 5 ml di LB + antibiotico e crescere per 8 ore a 37 ° C con agitazione.
  15. Estrarre il DNA plasmide dalle cellule utilizzando un miniprKit di ep, seguendo le istruzioni del produttore. Eseguire un taglio di prova usando enzimi di restrizione (seguendo la stessa procedura descritta al punto 2.4.1.).
  16. Identificare cellule con costrutti successo confrontando la lunghezza dei frammenti di DNA digerito con i risultati attesi da una corretta costrutto. Culture trasportano costrutti plasmidici riuscite possono essere conservati mescolando cultura parti uguali con una soluzione sterile filtrata, 40% glicerolo (in acqua deionizzata) e congelare la miscela a -80 ° C.
    NOTA: Trasformazioni di plasmidi in altri ceppi di E. coli (cioè, MG1655WT) può essere realizzato seguendo la procedura di cui sopra per rendere le cellule chimicamente competenti.

3. Caratterizzazione delle cellule: la crescita della curva dose-risposta e

  1. Crescere ceppi ingegnerizzati pernottamento in LB media con un antibiotico appropriato.
  2. Per le curve di crescita, preparare 50 ml di terreno minimo M9 con e senza IPTG (da 0,5 M stac) e / o DTB (da 500 mg / mL archivio) come segue:
    1. Preparare 0 ng / mL DTB (0 ml di magazzino) / 0 mm IPTG (0 ml di magazzino).
    2. Preparare 200 ng / mL DTB (200 ml di magazzino) / 0 mm IPTG (0 ml di magazzino).
    3. Preparare 0 ng / mL DTB (0 ml di magazzino) / 0,5 mM IPTG (50 ml di magazzino).
    4. Preparare 200 ng / mL DTB (200 ml di magazzino) / 0,5 mM IPTG (50 ml di magazzino).
    5. Seminare con la cultura durante la notte a 1: 100 nei mezzi di cui sopra.
    6. In una piastra da 96 pozzetti, un'aliquota di 200 ml di cultura, in triplice copia, in ciascun pozzetto.
    7. Misurare OD 600 ogni 5 minuti su 24 ore con agitazione continua e incubazione a 37 ° C in lettore di piastre.
  3. Per gli studi di dose-risposta, sostituire il gene bioB in pKE1-lacI-bioB con mCherry (una proteina fluorescente rossa) per la quantificazione ottica in tempo reale.
  4. Aggiungere quantità variabili di IPTG vanno da 0,1 mm a 5 mM per indurre l'espressionein LB media.
  5. Seminare con la cultura durante la notte a una diluizione di 1: 100.
  6. Misurare la fluorescenza ogni 30 min per 15 ore.

4. Indurre biotina produzione di cellule ingegnerizzate ed un surnatante Preparazione

  1. Grow pKE1-lacI-bioB nel ceppo di E. coli MG1655 pernottamento in LB media.
  2. Supplemento supporti M9 con DTB che vanno da 30 a 200 ng / mL.
  3. Aggiungere 0,5 mM IPTG per indurre la sintesi di biotina.
  4. Seminare integrati, media M9 minimale senza biotina con la cultura durante la notte a 1: 100 diluizione.
  5. Dopo 24 ore di crescita, le cellule centrifuga e raccogliere il surnatante biotina arricchito.
  6. Misurare surnatante biotina arricchita con il controllo indiretto e il controllo diretto superfici funzionalizzate. Utilizzare il surnatante al posto del campione di biotina in passi rispettivamente 5.23 e 6.12,.

5. indiretto di controllo Schema funzionalizzato Preparazione della superficie

  1. preparare °e le seguenti soluzioni.
    1. Preparare una soluzione SMCC costituito da 20 mg / mL di succinimidil trans-4- (maleimidylmethyl) cicloesano-1-carbossilato (SMCC) in dimetil solfossido (DMSO).
    2. Preparare una soluzione SPDP costituito da 20 mg / mL di succinimidil 3- (2-piridilditio) propionato (SPDP) in DMSO.
    3. Preparare 20 mg / mL LC-LC-biotina in DMSO.
    4. Preparare 10 mg / mL perossidasi di rafano (HRP) in tampone fosfato (PBS).
    5. Preparare 10 mg / mL streptavidina (SA) in PBS.
    6. Preparare 10 mg / ml di albumina di siero bovino (BSA) in PBS.
    7. Preparare 100 mM ditiotreitolo (DTT) in acqua deionizzata.
    8. Preparare 5 mM acido ethylenediaminetetaacetic (EDTA) in PBS.
    9. Preparare 0,5% di caseina in PBS.
    10. Preparare 20% Tween 80 azionario in acqua deionizzata.
    11. Preparare 0,05% Tween 80 (dal 20% stock) in PBS.
    12. Preparare 50 mm di acetato di sodio in acqua deionizzata.
    13. Preparare 1% TMB in DMSO.
    14. Preparare 3% H 2 O 2 iacqua DI n.
    15. Preparare 2 MH 2 SO 4 in acqua deionizzata.
  2. Aggiungere 1,4 microlitri della soluzione SPDP di 20 microlitri soluzione SA.
  3. Incubare la soluzione da 5,2 a 1,5 ore a temperatura ambiente, avvolto in un foglio di alluminio per evitare l'esposizione alla luce. Questa fase consente il reticolante SPDP di legarsi a SA tramite un gruppo amminico che forma un SA piridilditio attivato.
  4. Aggiungere 2,4 ml della soluzione DDT alla soluzione dal punto 5.3 e incubare per 1 ora a RT. Ciò consente una piridina 2-tione clivaggio, con un conseguente SA sulfidrilici attivato.
  5. Aggiungere 7,5 microlitri soluzione SMCC per 72 microlitri soluzione HRP e incubare per 1,5 ore a temperatura ambiente, avvolti in un foglio di alluminio per evitare l'esposizione alla luce. Ciò comporta una HRP maleimmide attivato vincolato da un gruppo amminico.
  6. Mescolare soluzione 17 ml LC-LC-biotina con 200 microlitri soluzione BSA e incubare per 1,5 ore a temperatura ambiente, avvolto in un foglio di alluminio per evitare l'esposizione alla luce. Questo passaggio consente di biotina coniugato to BSA attraverso un legame ammidico.
  7. Trasferire le soluzioni da piazza di 5.4, 5.5 e 5.6 per separare concentratori centrifughe all'interno di tubi di spin.
  8. Per provette contenenti SA-SPDP, dal punto 5.4, centrifugare a 10.000 xg fino a quando il volume di tubo raggiunge i 100 ml o per 16 min. Riempire il tubo di selezione per 500 ml con PBS-EDTA.
    1. Ripetere il passaggio 5,8 cinque volte. Conservare il titolo a 4 ° C.
  9. Per provette contenenti HRP-SMCC, dal punto 5.5, centrifugare a 10.000 xg fino a quando il volume raggiunge 25 ml o 16 min. Riempire il tubo di rotazione a 500 ml con PBS.
    1. Ripetere il passaggio 5,9 cinque volte. Conservare il titolo a 4 ° C.
  10. Per provette contenenti BSA-biotina, dal punto 5.6, centrifugare a 10.000 xg fino a quando il volume raggiunge 100 ml o 12 min. Riempire il tubo di rotazione a 500 ml con PBS.
    1. Ripetere il passaggio 5.10 quattro volte.
    2. Centrifugare a 10.000 xg finché il volume raggiunge 100 microlitrio per 12 min. Aggiungere 100 ml di soluzione salina in tubo. Conservare il titolo a 4 ° C.
  11. Aggiungere 25 ml di / soluzione HRP ml 10 mg con 25 ml di 10 mg / ml soluzione SA e conservare a 4 ° C durante la notte. Questo fa sì che la SA a diventare coniugato con HRP tramite un legame tioetere.
    1. Preparare una 1: soluzione di lavoro 4 con la soluzione durante la notte e conservare in 4 ° C frigo. Conservare la soluzione restante a -20 ° C.
  12. Preparare due soluzioni costituite da BSA-biotina (o BSA) in PBS, con l'aggiunta di 10 ml di brodo BSA-biotina (o 10 ml di BSA magazzino) per 490 ml di PBS.
  13. Aggiungere 100 ml di soluzione dal punto 5.12 a ciascun pozzetto di una piastra di polistirene a 96 pozzetti.
  14. Incubare la piastra a 37 ° C per 1 h, avvolto in carta stagnola.
  15. Lavare i pozzetti della piastra con 0,05% Tween 80.
    1. Aggiungere 200 ml di 0,05% PBS-Tween 80 ai pozzetti. Incubare per 2 minuti a temperatura ambiente. Versare il liquido.
    2. <li> Ripetere il passaggio 5.15.1 tre volte.
  16. Aggiungere 200 microlitri della soluzione di caseina 0,5% a ciascuno dei pozzetti della piastra a 96 pozzetti.
  17. Incubare la piastra a 37 ° C per 1 h.
  18. Ripetere il passaggio 5.15 per lavare i pozzetti tre volte.
  19. Preparare una soluzione miscelando 12 ml di soluzione di caseina 0,5% con 7,5 ml di 0,05% Tween 80.
  20. Diluire il magazzino SA-HRP 1: 10.000 con la soluzione preparata al punto 5.19.
  21. Aggiungere 80 ml di soluzione preparata al punto 5.20 a ciascun pozzetto di una piastra da 96 pozzetti.
  22. Aggiungere 20 ml di campione biotina disposta a ciascun pozzetto della piastra di polistirene. Il supernatante preparato in 4.6 può essere utilizzato come campione biotina in questa fase.
  23. Incubare la piastra a 37 ° C per 1 h. Questo passaggio consente per il legame concorrenziale tra biotina libera e immobilizzare BSA-biotina per siti di legame SA-HRP.
  24. Ripetere il passaggio 5.15 per lavare i pozzetti tre volte.
  25. Mescolare 50 mM soluzione di sodio acetato, 1% soluzione TMB,e 3% soluzione di H 2 O 2 a 1.000: rapporto 1 (20 ml di volume totale): 10.
  26. Aggiungere 200 microlitri della soluzione proveniente dal passaggio 5,25 a ciascun pozzetto e lasciar riposare per 15 minuti a RT, coperto con un foglio.
  27. Aggiungere 50 ml di 2 MH 2 SO 4 a ciascun pozzetto per arrestare la reazione. Misurare OD 450 utilizzando un lettore di piastre.

6. diretto controllo Schema funzionalizzato Preparazione della superficie

  1. Preparare le seguenti soluzioni.
    1. Preparare 20 mg / mL LC-LC-biotina in DMSO.
    2. Preparare 10 mg / ml di HRP in PBS.
    3. Preparare 0,17 mg / ml SA in PBS.
    4. Preparare 0,5% di caseina in PBS.
    5. Preparare 20% Tween 80 azionario in acqua deionizzata.
    6. Preparare 0,05% Tween 80 (dal 20% stock) in PBS.
    7. Preparare 50 mm di acetato di sodio in acqua deionizzata.
    8. Preparare 1% TMB in DMSO.
    9. Preparare 3% H 2 O 2 in acqua deionizzata.
    10. Preparare 2 MH 2 SO 4 deionizzata.
  2. Aggiungere 7,5 microlitri LC-LC-biotina per 72 microlitri HRP e incubare a per 1,5 ore a temperatura ambiente, avvolto in un foglio di alluminio per evitare l'esposizione alla luce. Questo passaggio fa sì che la biotina per coniugato a HRP attraverso un legame ammidico.
  3. Trasferire la soluzione proveniente dal passaggio 6.2 ad un concentratore centrifuga in un tubo di spin
    1. Centrifugare la soluzione a 10.000 xg finché il volume raggiunge 100 microlitri o per 12 min. Riempire il tubo di selezione per 500 ml con PBS e ripetere la centrifugazione e l'aggiunta PBS quattro volte. Conservare il titolo a 4 ° C.
  4. Aggiungere i 100 ml di soluzione SA da 6.1.3 a ciascun pozzetto all'interno di una piastra da 96 pozzetti in polistirene.
  5. Incubare la piastra a 37 ° C per 1 h, avvolto in carta stagnola.
  6. Lavare i pozzetti della piastra con 0,05% Tween 80.
    1. Aggiungere 200 ml di 0,05% Tween 80 ai pozzetti. Incubare per 2 minuti a temperatura ambiente. Versare il liquido.
    2. Ripetere 6.6.1 tre volte.
  7. Aggiungere 200 microlitri della soluzione di caseina 0,5% a ciascuno dei pozzetti della piastra a 96 pozzetti.
  8. Incubare la piastra a 37 ° C per 1 h.
  9. Ripetere il punto 6.6 tre volte per lavare i pozzi.
  10. Diluire lo stock biotina-HRP 1: 10.000 con la soluzione preparata al punto 6.3.
  11. Aggiungere 80 ml di soluzione preparata al punto 6.10 a ciascun pozzetto di una piastra da 96 pozzetti.
  12. Aggiungere 20 ml di campione biotina disposta a ciascun pozzetto della piastra di polistirene. Il supernatante preparato in 4.6 può essere utilizzato come campione biotina in questa fase.
  13. Incubare la piastra a 37 ° C per 1 h. Questo passaggio consente per il legame concorrenziale tra biotina libera e biotina-HRP per immobilizzati siti di legame SA.
  14. Ripetere il passaggio 6.6 per lavare i pozzetti tre volte.
  15. Mescolare 50 mM soluzione di acetato di sodio, 1% di soluzione TMB e 3% H 2 O 2 soluzione ad una 1,000: rapporto 1 (20 ml di volume totale): 10.
  16. Aggiungere 200 ml di soluzione dal punto 6.15 in ciascun pozzetto ed incubare per 15 minuti a RT, coperto con un foglio.
  17. Aggiungere 50 ml di 2 MH 2 SO 4 a ciascun pozzetto per arrestare la reazione. Misurare OD 450 utilizzando un lettore di piastre.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Risultati rappresentativi sono presentati nelle cinque figure allegate. In primo luogo, vi presentiamo il processo di clonazione verrà visualizzata graficamente (figura 1), in modo che il lettore possa seguire visivamente i passaggi critici per la creazione del sinteticamente ingegnerizzato ceppo di E. coli. Per caratterizzare la dinamica di popolazione delle cellule, forniamo una curva di crescita (figura 2) generato misurando la densità ottica a 600 nm (OD 600) della popolazione. Poi, si mostra come la rete gene regolatore è verificato, utilizzando mCherry come proxy per bioB (Figura 3), che permette di misurare otticamente la quantità relativa di bioB che sarebbe prodotta dalla cellula su induzione con IPTG. In seguito, presentiamo dati di risposta per l'indiretto di controllo e le superfici funzionalizzate-controllo diretto. Questi grafici dei dati (Figura 4) sono stati sviluppati utilizzando soluzioni misurati del liberobiotina per caratterizzare i profili di risposta delle superfici funzionalizzate. Infine, presentiamo dati caratteristici che mostrano come le cellule ingegnerizzate sono indotte a produrre biotina (Figura 5), modificando così le superfici funzionalizzate.

Figura 1
Figura 1: Progettazione e Costruzione di inducibili, cellule ingegnerizzate. (A) I primer sono stati progettati per isolare il gene bioB dal genoma di E. coli, che codifica un enzima cruciale nella via di sintesi biotina. (B) Il P L, teto-1 e P -lacI sequenze TRC-2 può essere isolato da un plasmide contenente un interruttore genetico con primer corrispondenti. (C) Il gene bioB estratto e due frammenti del commutatore possono essere utilizzati per creare il circuito gene. L'aggiunta di IPTG possono poi indUCE l'espressione di bioB e sintesi così biotina quando viene aggiunto DTB come substrato per bioB. (D) Il plasmide assemblata è stata trasformata in K-12 MG1655 E. coli. Questo ha causato la presenza di IPTG per indurre l'espressione di bioB e sintesi così biotina dalla linea cellulare ingegnerizzata quando DTB è stato fornito come substrato. Clicca qui per vedere una versione più grande di questa figura.

figura 2
Figura 2: curve di crescita per cellule ingegnerizzate. I, inducibili MG1655 cellule wild-type ingegnerizzati sono state coltivate e monitorate nei media minima (cioè, senza biotina M9 media), così come i media minime integrato con DTB (200 ng / mL) e / o di IPTG (0,5 mm). I grafici mostrano la lettura OD 600, misurata ogni 5 mi n per 24 h. Clicca qui per vedere una versione più grande di questa figura.

Figura 3
Figura 3: Test del Gene Network Engineered. La proteina fluorescente mCherry stato utilizzato al posto del bioB gene in modo da poter otticamente misurare il profilo di induzione quando le cellule ingegnerizzate sono state indotte con IPTG. Ci confrontiamo le cellule indotte con IPTG (diamanti rossi) con le cellule non indotte con IPTG (diamanti blu). Questi risultati dimostrano l'efficacia della rete gene inducibile. Clicca qui per vedere una versione più grande di questa figura.

/55300/55300fig4.jpg "/>
Figura 4: Verifica della funzionalizzato materiale di interfaccia. Esponendo nostra superficie funzionalizzata a concentrazioni variabili di biotina, siamo in grado di misurare la risposta ottica misurando OD 450 assorbanza. Questi risultati ci permettono di generare una curva di calibrazione, che collega la concentrazione di biotina all'intensità ottica della risposta. Qui, vi presentiamo la biotina contro le curve dei segnali ottici per entrambi i regimi di superficie indiretta (a sinistra) e diretta (a destra) funzionalizzati. Clicca qui per vedere una versione più grande di questa figura.

Figura 5
Figura 5: Engineered cellule di controllo di interfaccia materiale. Utilizzando sezioni di protocollo 5 o 6, siamo in grado di utilizzare i prodotti di indotto, ingegnerizzato cells di modificare chimicamente la superficie funzionalizzata. Siamo in grado di monitorare queste risposte otticamente misurando OD 450. Inoltre, utilizzando la curva di taratura sviluppata nella figura 4, possiamo collegare l'intensità ottica della risposta alla biotina all'interno della concentrazione. Presentiamo qui le diverse concentrazioni di biotina, misurate dal nostro schema funzionalizzata superficie di controllo indiretto, per le cellule wild-type (bianco), cellule non indotte contenenti il ​​plasmide pKE1-lacI-bioB (arancione), e le cellule indotte contenenti il ​​pKE1-lacI-bioB plasmide (grigio). Clicca qui per vedere una versione più grande di questa figura.

chimico Concentrazione finale Quantità
sali 5x M9 1x 20 mL
1 M MgSO 4 2 mm 200 ml
1 M CaCl 2 0,1 mm 10 microlitri
20% di glucosio 0,40% 2 ml
L'acido Casamino senza biotina 2% 0,02% 1 mL
DI acqua N / A 76,8 mL

Tabella 1: M9 media ricetta.

Nome Sequenza Primer uso
1-F CCGCCGGAATTCTCCCTATCAGTGATAGAGATT Estrazione cassetta lacI
1-r CCGACGTCTCACTGCCCGCTTTCCAGTC Estrazione cassetta lacI
nBioB1-f CCCAAGCTTCTGAAATGAGCTGTTGACAATTAATCAT P TRC-2 di estrazione
nBioB1-r GGGGGGTTCTTTTAATAAAGGTACCGTGTGAAATTGTT P TRC-2 di estrazione
nBioB2-f1 ACCCCCCTAAGGAGGTCATCATGGCTCACCGCCCACG estrazione bioB
nBioB2-r TCCCCGCGGTCATAATGCTGCCGCGTTGTAATATTC estrazione bioB
nBioB2-f2 ACGGTACCTTTATTAAAAGAACCCCCCTAAGGAGGTCATC Inoltre RBS sintetico

Tabella 2: Elenco di primer.

Fase 1
Passo 2 fase 3 fase 4 fase 5 passo 6 passo 7 step 8 passo 9
98 ° C 98 ° C 70 ° C 72 ° C 98 ° C 60 ° C 72 ° C 72 ° C 4 ° C
00:30 00:10 00:30 01: 00 / kb 00:10 00:30 01: 00 / kb 02:00
Ripetere 12 volte Ripetere 25 volte
-1 ° C / ciclo

Tabella 3: programma PCR.

Nome Volume
Lisato (template) 10 microlitri
Primer (ciascuno) 0,625 ml (ciascuno)
tampone Q5 5x 5 ml
Q5 polimerasi 0,25 ml
dNTP Mix 0,5 ml
DI acqua 6.75 ml

Tabella 4: Tutta la cella PCR Reazione (25 mL).

Nome Volume
10x tampone di reazione 5 ml
Enzyme 1 1 ml
Enzyme 2 1 ml
DNA template 1 mcg
DI acqua 43 ml - volume di DNA

Tabella 5: enzimi di restrizione di reazione (50 mL).

Nome Volume
DNA 50 mcg vettore + X mcg inserto
10x Ligase Buffer 1 ml
T4 ligasi 1 ml
DI acqua 8 ml - volume di DNA

Tabella 6: legatura di reazione (10 ml).

Nome Concentrazione Gli appunti
CaCl 2 100 mM
Carbeniccilin 50 mg / ml (1000x)
DTB 50 mg / ml
IPTG 0.5 M
SMCC 20 mg / ml 2 mg in 100uL DMSO
SPDP 20 mg / ml 2 mg in 100uL DMSO
LC-LC-biotina 20 mg / ml 2 mg in 100uL DMSO
HRP 10 mg / ml in PBS
SA (indiretto) 10 mg / ml in PBS
SA (diretta) 0,17 mg / mL in PBS
BSA 20 mg / ml in PBS
digitale terrestre 100mM In DI Acqua
EDTA 5 mM 18,6 mg in 10 ml di PBS
Caseina 0,50% in PBS
Tween 80 20% In DI Acqua
Tween 80 in PBS 0,05%
Acetato di sodio 50 mm In DI Acqua, Regolare al 5,1 pH con 3 M HCl
TMB 1% In DMSO
H 2 O 2 3% In DI Acqua
H 2 SO 4 2 M In DI Acqua

Tabella 7: Elenco dei reagenti Solutions.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Abbiamo presentato una nuova strategia per l'interfacciamento cellule ingegnerizzate vive con una superficie del materiale funzionalizzato. Ciò è stato realizzato attraverso lo sviluppo di una linea cellulare in grado di sintetizzare livelli elevati di biotina quando indotta con IPTG. Gli elevati livelli di biotina possono poi essere utilizzati per modificare la superficie funzionalizzata. I protocolli dettagliati come ingegnere alla linea di cellule di E. coli e come creare due superfici funzionalizzate differenti.

Passaggi critici in questo protocollo si presentano durante la costruzione della linea cellulare ingegnerizzata. Per evitare problemi a valle, che caratterizzano i ceppi cellulari ingegnerizzate con entrambe le curve di crescita (figura 2) e di risposta fluorescente (Figura 3) è incoraggiata. Dovrebbero sorgere questioni procedurali, altre strategie di clonazione molecolare, come l'estrazione PCR e Gibson assemblaggio 14, possono essere sostituiti per i passi, se del caso. Per ottimizzare il Yie biotinald della linea cellulare ingegnerizzata, è fondamentale per garantire che una quantità sufficiente di DTB viene fornito alle cellule. Nei nostri studi, abbiamo scoperto che 200 ng / mL DTB suscitato un sostanziale e statisticamente significativo aumento della produzione di biotina quando le cellule sono state indotte con IPTG. Inoltre, il successo coniugazione di BSA-biotina, SA-HRP, e biotina-HRP è di fondamentale importanza per l'esecuzione e il monitoraggio dei sistemi di controllo indiretti e diretti in modo efficace. Fare attenzione per evitare l'esposizione inutile alla luce e consentire ai coniugati di incubare una notte a 4 ° C al fine di garantire un efficace coniugato è formato.

Il nostro protocollo offre vantaggi rispetto ai metodi alternativi 15 grazie alla sua capacità di rilevare piccole quantità di biotina che sono biologicamente rilevanti (pg scala / mL) rispetto al kit di rilevazione biotina disponibili in commercio, come quelli a base di acido 4'-hydroxyazobenzene-2-carbossilico strategie di legame competitivo. Sebbene l'utilizzo della streptavidina-bioSistema di stagno è comune nel settore delle biotecnologie 16, 17, la capacità del nostro sistema di rispondere a piccole quantità di biotina ci permette di collegare direttamente la nostra linea di cellule geneticamente modificato con la superficie funzionalizzata.

Una potenziale limitazione del nostro protocollo è la gamma dinamica risultante di rilevamento biotina. Negli schemi di controllo indiretti e diretti, siamo in grado di rilevare la biotina tra i 10 -10 2 3 4 e 10 -10 6 pg / mL, rispettivamente (Figura 4). Fortunatamente, la gamma bassa dello schema di controllo indiretto permette di rilevare facilmente la produzione di biotina da cellule ingegnerizzate. Tuttavia, la stretta fascia della gamma dinamica controllo indiretto limita la sua capacità di percepire grandi variazioni (100 volte) in concentrazioni di biotina. Alterare la gamma dinamica per entrambi gli schemi di controllo diretti e indiretti richiederebbe engineering addizionale. Tuttavia, se il rilevamento di cellule produconod biotina è un problema, preparare diluizioni del surnatante biotina al punto 4.6 dovrebbe consentire al ricercatore di indirizzare la gamma dinamica del sistema di controllo indiretto (Figura 5). Abbiamo scoperto che una diluizione 1: 5 del surnatante ci ha permesso di raggiungere in modo efficace la gamma dinamica del sistema di controllo indiretto. Questa strategia diluizione deve alleviare la necessità di modificare direttamente la gamma dinamica.

Le due parti, sistema cellulare materiale qui presentato permette ingegnerizzato cellule di modificare la composizione di una superficie funzionalizzata. , le cellule viventi dinamici in grado di interpretare l'ambiente circostante chimici per produrre una risposta genetica. Mediante ingegneria genetica questa risposta per aumentare la produzione di biotina, possiamo dotare cellule viventi ingegnerizzate con la capacità di controllare e manipolare una superficie funzionalizzata. Seguendo i protocolli presentati, cellule ingegnerizzate sono in grado di agire sensori dinamici, capaci di lettura, elaborazione e registrazione delle condizioni intorno them tramite interfacce funzionalizzate. Questa tecnologia potrebbe avere un impatto campi che vanno dalla medicina molecolare per il rilevamento analiti per la bonifica ambientale.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori non hanno nulla da rivelare.

Acknowledgments

Gli autori ringraziano il sostegno di premio FA9550-13-1-0108 dall'Ufficio Air Force di ricerca scientifica degli Stati Uniti. Gli autori inoltre riconoscono il sostegno di premio N00014-15-1-2502 dal Office of Naval Research degli Stati Uniti, il finanziamento dell'Istituto per Critical Tecnologia e Scienza Applicata presso Virginia Polytechnic Institute e State University, e dal National Science Foundation Graduate Research Fellowship Program, il numero di riconoscimento 1.607.310.

Materials

Name Company Catalog Number Comments
LB Broth, Miller  Fisher Scientific 12-795-027
Agar Fisher Scientific BP9744500
Carbenicillin  Fisher Scientific BP26481
M9, Minimimal Salts, 5x Sigma-Aldrich M6030
Casamino Acids  Fisher Scientific BP1424-100
Magnesium Sulfate, Anhydrous Fisher Scientific M65-500
Calcium Chloride, Dihydrate Fisher Scientific C79-500
Dextrose (D-Glucose), Anhydrous Fisher Scientific D16-1
NEB Turbo Cell Line New England Biolabs C2984l
Oligonucleotide Primers Thermo Fisher Scientific N/A 25N synthesis, DSL purification
Q5 High-Fidelity Polymerase New England Biolabs M0491S
Q5 Reaction Buffer New England Biolabs B9027S
dNTP Solution Mix New England Biolabs N0447S
Agarose Bioexpress E-3120-125
Ethidium Bromide, 1% Fisher Scientific BP1302-10
Gel Extraction Kits Epoch Biolabs 2260250
GenCatch Plasmid DNA Miniprep Kit Epoch Biolabs 2160250
AatII New England Biolabs R0117S
SacII New England Biolabs R0157S
HindIII-HF New England Biolabs R3104S
EcoRI-HF New England Biolabs R3101S
Cutsmart Buffer New England Biolabs B7204S
T4 DNA Ligase New England Biolabs M0202S
T4 DNA Ligase Reaction Buffer New England Biolabs B0202S
ColiRolle Glass Plating Beads  EMD Millipore 7101-3
Glycerol Fisher Scientific BP229-1
Isopropyl β-D-1-thiogalactopyranoside (IPTG) Fisher Scientific BP1755-10
NHS-Desthiobiotin (DTB) Thermo Fisher Scientific 16129
Succinimidyl Trans-4-(maleimidylmethyl) Cyclohexane-1-Carboxylate (SMCC)  Thermo Fisher Scientific S1534
Dimethyl Sulfoxide (DMSO)  Fisher Scientific BP231-100
Succinimidyl 3-(2-pyridyldithio) Propionate (SPDP)  Thermo Fisher Scientific S1531
NHS-LC-LC-biotin Thermo Fisher Scientific 21343
Horseradish Peroxidase (HRP)  Thermo Fisher Scientific 31490
Phosphate Buffered Saline (PBS), 10x Solution Fisher Scientific BP399500
Streptavidin (SA)  Thermo Fisher Scientific 21145
Bovine Serum Albumin (BSA) Fisher Scientific BP1600-100
Dithiothreitol (DTT) Fisher Scientific BP172-5
Ethylenediaminetetaacetic acid (EDTA)  Fisher Scientific S311-500
Tween 80  Fisher Scientific T164-500
Hydrogen Peroxide Fisher Scientific H325-4
3, 3', 5, 5'-tetramethylbenzidine (TMB) Fisher Scientific AC229280050
Vivaspin 500 Centrifugal Concentrators  Viva Products VS0192
Sodium Acetate, Anhydrous Fisher Scientific BP333-500
96-Well Polystyrene Plates Thermo Fisher Scientific 266120

DOWNLOAD MATERIALS LIST

References

  1. Zhang, R., Heyde, K. C., Scott, F. Y., Paek, S. -H., Ruder, W. C. Programming Surface Chemistry with Engineered Cells. ACS Synth. Biol. (2016).
  2. Zhou, X., et al. Reduced graphene oxide films used as matrix of MALDI-TOF-MS for detection of octachlorodibenzo-p-dioxin. Chem. Commun. 46, 6974-6976 (2010).
  3. Pardee, K., et al. Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components. Cell. 165, 1255-1266 (2016).
  4. Bähring, S., et al. Design and Sensing Properties of a Self-Assembled Supramolecular Oligomer. Chem. Eur. J. 22, 1958-1967 (2016).
  5. Nicolau Jr, D. V., Armitage, J. P., Maini, P. K. Directional persistence and the optimality of run-and-tumble chemotaxis. Comp. Biol. Chem. 33, 269-274 (2009).
  6. Du, J., Shao, Z., Zhao, H. Engineering microbial factories for synthesis of value-added products. J. Ind. Microbiol. Biotechnol. 38, 873-890 (2011).
  7. Kim, H., Kim, M. J. Electric Field Control of Bacteria-Powered Microrobots Using a Static Obstacle Avoidance Algorithm. IEEE Trans. Rob. 32, 125-137 (2016).
  8. Gardner, T. S., Cantor, C. R., Collins, J. J. Construction of a genetic toggle switch in Escherichia coli. Nature. 403, 339-342 (2000).
  9. Heyde, K. C., Ruder, W. C. Exploring Host-Microbiome Interactions using an in Silico Model of Biomimetic Robots and Engineered Living Cells. Sci. Rep. 5, 11988 (2015).
  10. Rice, M. K., Ruder, W. C. Creating biological nanomaterials using synthetic biology. Sci. Tech. Adv. Mater. 15, 014401 (2014).
  11. Green, N. M. Avidin. 3. The nature of the biotin-binding site. Biochem. J. 89, 599-609 (1963).
  12. Mesulam, M. M. Tetramethyl benzidine for horseradish peroxidase neurohistochemistry: a non-carcinogenic blue reaction product with superior sensitivity for visualizing neural afferents and efferents. J Histochem. Cytochem. 26, 106-117 (1978).
  13. Litcofsky, K. D., Afeyan, R. B., Krom, R. J., Khalil, A. S., Collins, J. J. Iterative plug-and-play methodology for constructing and modifying synthetic gene networks. Nat. Meth. 9, 1077-1080 (2012).
  14. Gibson, D. G., et al. Complete Chemical Synthesis, Assembly, and Cloning of a Mycoplasma genitalium Genome. Science. 319, 1215-1220 (2008).
  15. Diamandis, E. P., Christopoulos, T. K. The biotin-(strept)avidin system: principles and applications in biotechnology. Clin. Chem. 37, 625-636 (1991).
  16. Nerurkar, L. S., Namba, M., Brashears, G., Jacob,, Lee, A. J., Sever, Y. J., L, J. Rapid detection of herpes simplex virus in clinical specimens by use of capture biotin-streptavidin enzyme-linked immunosorbent assay. J. Clin. Micro. 20, 109-114 (1984).
  17. Cui, Y., Wei, Q., Park, H., Lieber, C. M. Nanowire Nanosensors for Highly Sensitive and Selective Detection of Biological and Chemical Species. Science. 293, 1289-1292 (2001).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics