ה

Published 2/13/2017
0 Comments
  CITE THIS  SHARE 
Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





By clicking "Submit", you agree to our policies.

 

Summary

Cite this Article

Copy Citation

Udden, S. M., Waliullah, S., Harris, M., Zaki, H. The Ex Vivo Colon Organ Culture and Its Use in Antimicrobial Host Defense Studies. J. Vis. Exp. (120), e55347, doi:10.3791/55347 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

המעי מציג ארכיטקטורה של מבנים הקריפטה חוזרים המורכבים מסוגים שונים של תאי אפיתל, שכבת רירית מיוחדת המכילה תאים חיסוניים, ו stroma. כל תאים הטרוגניים אלו תורמים הומאוסטזיס מעיים ולהשתתף הגנה מארחת מיקרוביאלית. לכן, זיהוי מודל פונדקאי ללימוד תגובה חיסונית ופעילות מיקרוביאלית של המעי בסביבה במבחנה הוא מאוד מאתגר. במחקרים במבחנה באמצעות שורות תאים אפיתל במעי הנציחו או אפילו הקריפטה עיקרי organoid תרבות אינו מייצגים את הפיסיולוגיה המדויקת של מעי נורמלי microenvironment שלה. כאן, אנו דנים בשיטה של רקמת מעי גסת עכבר culturing בצלחת התרבות וכיצד מערכת ההתרבות לשעבר vivo האיבר הזה יכול להיות מיושמת במחקרים הקשורים תגובות הגנה מארחות מיקרוביאלית. בניסויי נציג, הראינו כי נקודות בתרבות איבר לבטא פפטידים מיקרוביאלית שו"תonse IL-1β אקסוגניים ו- IL-18. יתר על כן, מולקולות מפעיל מיקרוביאלית המיוצר על ידי רקמות המעי הגס בתרבות איבר ביעילות להרוג coli Escherichia במבחנה. גישה זו, אם כן, יכולה להיות מנוצלת כדי לנתח את התפקיד של דפוסים מולקולריים pathogen- וסכנה הקשורים ואת הקולטנים הסלולרי שלהם בויסות תגובה חיסונית מולדת מעיים ותגובות הגנה מארחות מיקרוביאלית.

Introduction

המעי מייצג מערכת דינאמית כי משמשת כמחסום עבור מיקרואורגניזמים commensal, נלחם נגד פתוגנים פולשים, ומסדיר את רכב חיידקי 1. תאי אפיתל במעי, מורכב enterocytes, תאי גביע, תאי פנט ותאי enteroendocrine, הוא אוכלוסיות התאים העיקריות המספקות תשובות הגנה מארחות נגד חיידקים במעיים. תאי הגביע לייצר מוקיוס יוצרים מפורזים על גבי שכבת אפיתל 2. התאים ו enterocytes פנט לייצר פפטידים מיקרוביאלית, ציטוקינים, ומיני חמצן וחנקן תגובתי המהווים תגובות הגנה מארחות מיקרוביאלית לתרום לעיצוב בהרכב המיקרוביאלי במעיים 3, 4. בנוסף לתאי אפיתל, תאי מערכת החיסון כולל מקרופאגים, תאים דנדריטים, נויטרופילים, תאי הרג טבעיים, לימפוציטים, ואינה תאי הלימפה טה שכבת הרירית המיוחדת ואת submucosa לשחק תפקיד קריטי בתגובות ההגנה המארחת מיקרוביאלית מעיים על ידי ציטוקינים ייצור, כמוקינים, ומתווכים אחרים 5 - 7. כדי להבין איך המערכת החיסונית ברירית מסדיר חיידקים ומספקת הגנה מפני זיהום מיקרוביאלי, חשוב לשקול את יחסי הגומלין המורכבים של אוכלוסיות תאים הטרוגנית של המעי. עם זאת, מודל במבחנה שמקיף את כל התכונות של המעי אינו זמין. לכן, מחקרים מולקולריים על אינטראקצית מארח הפתוגן במעי הם מאוד מאתגרים.

במהלך השנים האחרונות, מערכות מודל מספר המחקים ההיבטים של רירית המעי פותחו על חקירת תהליכים פתופיזיולוגיים המעורבים במחלות מעי דלקתיות (IBD) והפרעות במערכת העיכול אחרים 8 -= "Xref"> 14. הונצחו שורות תאים אפיתל במעי משמשות לעתים קרובות כדי ללמוד מענה ספציפי תא אפיתל. עם זאת, בגלל ביטוי גנים ההפרש ותפקוד בתאים הנציח, את הנתונים המתקבלים באמצעות תאים אלה אינם לעיתים קרובות להתאים עם אלו שנצפו במחקרים in vivo. הקריפטה מעי organoid התרבות התפתח לאחרונה ככלי פוטנציאל להערכת התגובה של האפיתל במעי לגירויים שונים 13. במערכת זו, תאי גזע הקריפטה מותר לגדול ולהתפתח מבנה organoid 3D. בעוד מערכת התרבות organoid מאוד שימושי לחקר היבטים רבים של האפיתל במעי, זה לא לחקות את האינטראקציה המורכבת של תאי מערכת החיסון, תאי אפיתל ומוצרים מיקרוביאלי. תרבות vivo לשעבר של רקמת המעי מציעה ייצוג טוב יותר של תגובות הגנה מארחות in vivo. בשיטה זו, חלק של המעי הוא בתרבית שנינות צלחת תרבית תאיםתקשורת h המתאימה המאפשרת את הסוגים השונים של אוכלוסיות תאים במעי להיות פעילה מבחינה מטבולית עבור h 48 לפחות. לפיכך, תרבות vivo לשעבר של האיבר יכול לשמש כדי למדוד את הביטוי של גנים מיקרוביאלית והתגובות ההגנה המארחת של המעי לגירוי מסוים.

חוקרים כבר משתמשים במערכת תרבות איבר vivo לשעבר ללמוד תגובות הגנה מארחות נגד זיהום מיקרוביאלי במעי 15 - 21. לאחרונה אמצו את מערכת התרבות האיבר כדי ללמוד את התפקיד של inflammasome בתגובות הגנה מארחת מיקרוביאלית נקודות עכבר 22. Inflammasome היא פלטפורמה מולקולרית עבור הפעלת caspase-1, אשר נדרש לייצור התבגר IL-1β ו- IL-18. הראינו כי IL-1β ו- IL-18 להשרות פפטידים מיקרוביאלית אשר למעשה להרוג pathobionts commensal כגון E. coli coli גדילת א ב 22 נקודות עכבר פגום-inflammasome. מערכת זו ולכן ניתן להשתמש כדי ללמוד את התפקיד של קולטנים זיהוי תבניות (PRRs) ומולקולות חיסון מולדות אחרות בתגובות הגנה מארחת מיקרוביאלית מעיים וכן בפתוגנזה של הפרעות במערכת עיכול כגון מחלות מעי דלקתיות (IBD) וסרטן מעי גס (CRC). ישנם יותר מ -200 גני רגישות IBD, ומוטציות רבות מאותם גנים המשויכים רכב חיידקים שינה במעיים. זה הוא בעל משמעות קלינית רבה לקבוע את המנגנון המדויק שדרכו גני IBD-הרגישות להסדיר חיידקים במעיים. המטרה הכללית של שיטה זו היא להציג את פרוטוקול בסיסי בתרבות איבר vivo לשעבר מעי גס להדגים כיצד שיטת התרבות זו יכולה לשמש כדי לחקור תגובות הגנה מארחת מיקרוביאלית של המעי.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

כל הניסויים שתוארו כאן בוצעו באמצעות wild-type גבר בן 6-8 שבועות (C57BL6 / J) עכברים נשמרו מתקן חינם ספציפי פתוגן (SPF) במרכז משאבי בעלי החיים (ARC), המרכז הרפואי Southwestern UT. כל המחקרים אושרו על ידי ועדת טיפול בבעלי חיים מוסדיים השתמש (IACUC) ו נערכו בהתאם להנחיות IACUC לבין המכון הלאומי של מדריך הבריאות לטיפול ושימוש בחיות מעבדה.

1. איסוף והכנה של קולון

  1. להרדים עכברים עם מחנק 2 CO ואחריו נקע בצוואר הרחם.
  2. ריסוס עכברים עם 70% אתנול ו להצמיד גפיים ללוח מצמיד שמירה בצד הגבי עכבר למטה על הלוח.
  3. שימוש מראש מעוקר לנתח מספרי מלקחיים, לעשות חתך אונליין באמצע הצפק של הבטן. פתח את הבטן על ידי קיפול הצפק עם מלקחיים.
  4. הסר את המעי מן wi חלל הבטןה לנתח מלקחיים ומספריים. הפרד את המעי הגס מן המעי הדק באמצעות חיתוך בתחתית של cecum ואת הקצה השני בבית הרקטום.
  5. מניחים את המעי הגס בצלחת פטרי סטרילית המכילה קר כקרח PBS. לרוקן את התוכן של לומן של המעי הגס עם קרים כקרח PBS באמצעות מזרק 20 מ"ל מחזיק מחט 20 G או מחט gavage הפה עד שרפרף בתוך לומן של המעי הגס יוסר כליל.
  6. חותכים את המעי הגס עם מספריים longitudinally. שטפו את המעי הגס על ידי רועדת במרץ קר כקרח PBS בצלחת פטרי סטרילית.
  7. חותכים את רקמת המעי הגס לחתיכות כ 1 ס"מ באמצעות אזמל או מספריים סטריליות.
  8. רשום את המשקל של החלקים המעי הגס.
    הערה: כל השלבים המפורטים בסעיף 1 יכול להתבצע גם בתוך או מחוץ ארון בטיחות ביולוגית. לאחר נקודות מוכנות תרבות, כל הצעדים חייבים להתבצע בתוך ארון בטיחות ביולוגי כדי לשמור על סטריליות.

2. קולון Orgתרבות

  1. מניחים מסננת תא (100 מיקרומטר) על צלחת תרבית תאים 6 באר. להעביר את כל חלקי המעי הגסים שנאספו עכבר אחד לתוך מסננת התא.
  2. הוסף 5 מ"ל DMEM / בינוני F12 המכיל 5% FBS, פניצילין, סטרפטומיצין (1x), ו gentamycin (20 מיקרוגרם / מ"ל). מכסות לחלוטין את חתיכות המעי הגס עם התקשורת.
  3. דגירה עבור שעה 2 ב 37 מעלות צלזיוס באינקובטור עם 5% CO 2 ואוויר 95%.
  4. הרם את מסננת התא לשאוב התקשורת.
  5. מניחים מסננת התא בחזרה על היטב ומוסיפים 5 מ"ל התקשורת טריים ללא אנטיביוטיקה. הרם את מסננת התא לשאוב התקשורת.
  6. חזור על שלב הכביסה מעל (שלב 2.5) עוד פעמים (3x הכל) כדי להסיר את כל האנטיביוטיקה שיורית.
  7. מעבירים את חתיכות המעי הגס מן מסננת תא בודד לתוך הבאר אחד של צלחת תרבית תאים סטריליים 12 גם.
  8. הוסף בינוני DMEM / F12 המכיל FBS 5% (ללא אנטיביוטיקה). כוון את עוצמת הקול של המדיום עם weight של חתיכות המעי הגס, למשל, 1 בינוני מ"ל עבור 100 מ"ג של רקמת גוף. דגירה במשך 12 שעות ב 37 מעלות צלזיוס באינקובטור הזרקת אוויר 5% CO 2 ו -95%.
  9. אסוף את supernatant תרבות צינור 1.5 מ"ל סטרילי.
  10. צנטריפוגה ב XG 12,000 ב 4 מעלות צלזיוס למשך 5 דקות. הפרד את supernatant לתוך צינור 1.5 מ"ל חדש לשימוש חיידקים הרג assay ו / או מבחני אחרים של מערכת החיסון. את supernatant ניתן לאחסן ב -80 ° C עד assay.
  11. לאסוף את השברים המעי הגס בתוך שפופרת עבור בידוד RNA

3. חיידק הריגת Assay

  1. לחסן בחיידק הזה 5 מ"ל לוריא- Bertani (LB) מרק בתוך שפופרת 15 מ"ל לדגור על 37 מעלות צלזיוס עם רועד ב 200 סל"ד לילה. שמור את הכובע של צינור התרבות מעט רופף.
  2. צנטריפוגה צינור תרבות חיידקי 1,200 XG במשך 10 דקות ב 4 °. הסר את supernatant ו resuspend גלולה חיידקים לתוך 5 מ"ל קר כקרח PBS.
  3. העברת 1 מ"ל של bactההשעיה erial לתוך OD קובט ולמדוד ב 600 ננומטר. השתמש PBS כמו ריק.
  4. חשב את יחידת המושבה להרכיב (CFU) באמצעות עקומת סטנדרט קבוע מראש. הנה, להניח 1 OD = 2 x 10 9 CFU / ml (כ).
  5. לדלל את השעית החיידקים כדי להפוך את השעית מניית 1 x 10 5 CFU / mL.
  6. מעביר את supernatant תרבות איבר המעי הגס (500 μl / טוב) שנאסף בסעיף 2.10 לתוך בארות כפולות של צלחת תרבית תאי 24 גם.
  7. הוסף 10 תרבות coli μL E. (1000 CFU) לתוך supernatant תרבות איבר המעי הגס אחד היטב המכיל 500 μL. השאר הבאר השנייה ללא כל חיסון חיידק כדי לאשר את supernatant תרבות איבר המעי הגס אינו מכיל כל זיהום.
  8. דגירה אותו המספר של חיידקים (1,000 CFU) בתקשורת התרבות (FBS DMEM / F12 בתוספת 5%) ללא אנטיביוטיקה כביקורת.
  9. לדגור על 37 מעלות צלזיוס במשך שעה 1.
  10. מניחים 50 μL של כל דגימה ירידה-wise על צלחות אגר MacConkey. דגירה צלחות אגר MacConkey ב 37 מעלות צלזיוס למשך הלילה.
  11. ספירת מושבות לחשב את CFU / ml.

4. השפעת חיצונית ו גורמים פנימיים על תגובות הגנה מארחות גס Antimicrobial

הערה: assay הרג מיקרוביאלית כמתוארת כאן ניתן לאמץ כדי לבחון את השפעת דפוסים מולקולריים הקשורים הפתוגן (PAMPs) וציטוקינים על פעילות bactericidal של supernatant תרבות איברים. דוגמא ניסוי כזה באמצעות IL-1β ו- IL-18 מתוארת להלן.

  1. אסוף נקודתיים מעכברים כמתואר בסעיף 1.
  2. מניחים את המעי הגס על מגבת נייר סטרילי. חותכים את המעי הגס longitudinally לשלושה חלקים באמצעות מספריים (איור 2).
  3. לשטוף כל חלק של המעי הגס ב קר כקרח PBS כמתואר בסעיף 1.
  4. חותכים כל חלק של המעי הגס לחתיכות קטנות ולשקול בסביבה נקייה מחיידקים. מעביר את החתיכות של כל חלקשל המעי הגס לשלוש מסננות בתא נפרדות (100 מיקרומטר) הניחו על שלוש בארות צלחת תרבית תאי 6-היטב (איור 2).
  5. הוסף 2 מ"ל בינוני DMEM / F12 המכיל 5% FBS, פניצילין, סטרפטומיצין (1x), ו gentamycin (20 מיקרוגרם / מ"ל).
  6. דגירה של 2 שעות ב 37 מעלות צלזיוס באינקובטור הזרקת אוויר 5% CO 2 ו -95%.
  7. שטוף את חלקי נקודות כמתוארים 2.4-2.6. מעבירים את חתיכות המעי הגס של מסננת תא בודד לתוך הבאר אחד של צלחת תרבית תאים סטריליים 12 גם. השלוש הבארות המכילות שלושה חלקים של המעי הגס מתוך עכבר אחת צריכות להיות מיועדות מטופל, IL-1β, ו- IL-18 (איור 2).
  8. הוסף בינוני DMEM / F12 המכיל FBS 5% (ללא אנטיביוטיקה). כוון את עוצמת הקול של המדיום עם משקל של חתיכות המעי הגס, למשל, 1 בינוני מ"ל עבור 100 מ"ג של רקמת גוף.
  9. לעורר את תרבות איבר המעי הגס עם IL-1β (20 ng / mL) או IL-18 (20 ng / mL) במשך 12 שעות. נקודות המטופל תרבות איבר משמשת שליטה.
  10. לאחר 12 הדגירה שעות ב 37 מעלות צלזיוס באינקובטור הזרקת 5% CO 2 ו -95 אוויר%, לאסוף את supernatant תרבות צינור 1.5 מ"ל סטרילי.
  11. העבר 500 μL supernatant התרבות לתוך בארות כפולות של צלחת 24 גם.
  12. לחסן E. coli (1,000 CFU) ב supernatant תרבות איבר המעי הגס כמתואר בסעיף 3. עבור כל תנאי, לחסן בחיידק הזה באר יחיד. שני היטב המכיל אותו האיבר supernatant התרבות ללא אי-קולי ישמש כשלט עבור זיהום חיידקים.
  13. דגירה את אותה כמות של חיידקים בתקשורת תרבות ללא אנטיביוטיקה כביקורת.
  14. לדגור על 37 מעלות צלזיוס במשך שעה 1.
  15. מניחים 50 μL של כל דגימה-חכם טיפה על צלחות אגר MacConkey. דגירה צלחות אגר MacConkey עבור לילה בשעה 37 ° C.
  16. ספירת מושבות לחשב את CFU / mL (איור 4).
e_title "> 5. מדידה של הביטוי של גנים Antimicrobial

  1. לאחר הדגירה לילה (12 שעות) של התרבות איבר הגס כמתואר בסעיפים 2 ו -4, לשטוף את חתיכות המעי הגס עם 2 מ"ל PBS קר כקרח (2x).
  2. לאסוף את השברים המעי הגס לתוך צינור בורג מכסה חינם 2 מ"ל RNase / DNase. מניחים את הצינורות על הקרח.
  3. הוסף 1 מ"ל מסחרי מגיב Trizol וחרוזים מטריקס lysing לתוך הצינור.
  4. Lyse הרקמה באמצעות homogenizer רקמות אוטומטיות.
  5. אסוף את lysate רקמה לתוך צינור microcentrifuge חדש.
  6. לבודד RNA באמצעות פרוטוקול סטנדרטי.
  7. מדוד ריכוז RNA.
  8. לדלל RNA כראוי עם מים ללא יונים ולהשתמש 500 RNA ng לסנתז cDNA.
  9. השתמש cDNA לניתוח בזמן אמת RT-PCR של גנים מיקרוביאלית ממוקד, ציטוקינים, כמוקינים, וגנים אחרים בעלי עניין.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

תמונה מייצגת של נקודות בתרבות איבר מוצגת באיור 1. חתיכות המעי הגס בתרבות להישאר מבחינה מטבולית ופעיל מבחינה פיזיולוגית. הם מגיבים ביעילות לגירויים חיצוניים מתווספים התקשורת והתרבות. זרם עבודה סכמטית של הכנת הרקמה המעי הגס לתרבות vivo לשעבר וגירוי עם גירויים חיצוניים, כגון IL-1β ו- IL-18, מוצג באיור 2. הנתונים נציג להראות איור 3 כי נקודתיים בתרבות איבר לבטא פפטידים מיקרוביאלית כגון β-defensin 2 (BD2), Reg3γ, S100a8, S100a9, ו אינוס בתגובה IL-1β ו- IL-18.

המתווכים שפורסמו על ידי שתלים המעי הגס מפגינים אפקט הרג מיקרוביאלית כפי שהודגם על ידי צמיחה משמעותית של E. coli מודגרות עם supernatant תרבות איבר ( -4). פעילות הרג E. coli כזו potentiated עוד יותר על ידי גירוי של IL-1β ו- IL-18 (איורים 4 א ו -4). Supernatants תרבות איבר קולון וטופח ללא חיידק מראה התפתחות חיידקים הבאים תרבות על MacConkey אגר (4C דמויות 4D). תוצאות אלו עוד יותר מראות כי inflammasome ממלא תפקיד חשוב בהגנה המארחת מיקרוביאלית המעיים.

בסך הכל, הנתונים המוצגים כאן מראים כי vivo לשעבר תרבות איבר גסה היא טכניקה יעילה מאוד ללמוד תגובות חיסוניות מיקרוביאלית מעיים במבחנה.

GAPDH_F TGGCAAAGTGGAGATTGTTGCC
GAPDH_R AAGATGGTGATGGGCTTCCC G
β-defensin 2 (BD2) _F TGACCACTGCCACACCAATG
β-defensin 2 (BD2) _R CCTGGCAGAAGGAGGACAAA
Reg3γ_F CAAGGTGAAGTTGCCAAGAA
Reg3γ_R CCTCTGTTGGGTTCATAGCC
S100a8_F TGTCCTCAGTTTGTGCAGAATATAAA
S100a8_R TCACCATCGCAAGGAACTCC
S100a9_F GGTGGAAGCACAGTTGGCA
S100a9_R GTGTCCAGGTCCTCCATGATG
iNOS_F TGTGACACACAGCGCTACAACA
iNOS_R GAAACTATGGAGCACAGCCACAT

טבלה 1: רשימת פריימרים בעכבר בזמן אמת PCR.

ge = "1"> איור 1
איור 1: תמונה מייצגת של חתיכות מעי גסות עכבר בתרבות. (א) דגירה של חתיכות המעי הגס על מסננת תא (100 מיקרומטר) הניח על צלחת 6 באר. חתיכות קולון שקועות 2 תקשורת ותרבות מיליליטר השלימה עם אנטיביוטיקה. (ב) בעקבות 2 דגירת h, חתיכות מעי גסות מועברות לתוך הבאר של צלחת תרבית תאים חדשה 12-היטב המכילה בינוני אנטיביוטיקה ללא. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 2
איור 2: מצגת סכמטי של השלבים להכנת ברקמות המעי הגס לשעבר גירוי vivo עם IL-1β ו- IL-18. הנקודות מעכבר אחד היא Longi tudinally גזור לשלושה חלקים. כל חלק נחתך לחתיכות קטנות ומשקל. חתיכות המעי הגס מכל קטע של המעי הגס מועברים על גבי מסננות תא דגש על בארות צלחת 6-היטב המכיל 2 מ"ל DMEM / F12 בינוני פלוס 5% FBS ואנטיביוטיקה. בעקבות דגירת 2 שעות, חתיכות מעי גסות מן מסננת תא בודדת מועברות לתוך באר אחד של צלחת תרבית תאים של 12 באר. DMEM / F12 בתוספת 5% FBS (ללא אנטיביוטיקה) מתווסף לבאר כל והיקף המדיום מותאם על פי המשקל של הרקמה (מדיה 1 מ"ל ל -100 רקמות מ"ג). רקמות קולון הם מגורה עם IL-1β (20 ng / ml) ו- IL-18 (20 ng / ml) עבור 12 שעות. Supernatants תרבות הם centrifuged המשמש assay הרג החיידק ו / או מבחני אחרים של מערכת החיסון. רקמות המעי הגס נאספים לתוך מגיב טריפסין מסחרי עבור בידוד RNA ו ניתוחים שלאחר מכן של ביטוי גנים מיקרוביאלית ידי PCR בזמן אמת..jpg "target =" _ blank "> לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 3
איור 3: רקמות המעי הגס עכבר לבטא ציטוקינים פפטידים מיקרוביאלית בתגובה IL-1β או IL-18 במהלך התרבות vivo לשעבר. תרבויות איבר קולון היו מגורה עם IL-1β (20 ng / ml) או IL-18 (20 ng / ml) עבור 12 שעות. הביטוי של BD2, Reg3γ, S100a8, S100a9, ו אינוס נמדדה על ידי בזמן אמת RT-PCR (טבלה 1). הנתונים מייצגים אמצעי ± סטיית תקן; * P <0.05, ** p <0.01. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 4
איור 4: Supernatant של כת איבר המעי גס עכבריור מפגין פעילות bactericidal. חתיכות קולון היו בתרבית vivo לשעבר בנוכחות או העדר-1β IL (20 ng / mL) או IL-18 (20 ng / mL) במשך 12 שעות. 500 μl של supernatants תרבות הודגרו עם E. coli (1,000 CFU) במשך שעה 1 ב 37 מעלות צלזיוס. Supernatant תרבות איבר קולון ללא E. coli גם הודגר כביקורת. בעקבות 1 הדגירה h, 50 μL של כל דגימה הוצב dropwise על צלחות אגר MacConkey וטופחו על 37 מעלות צלזיוס למשך הלילה. (א) תמונה של E. coli מושבת על אגר MacConkey מראה פעילות מיקרוביאלית של תרבות איבר המעי הגס. (ב) ספירת החיידק מראה הרג יעיל של IL-1β- ו- IL-18 שטופלה נקודות איבר תרבות supernatant. (C) תמונה של צלחת אגר MacConkey מראה שום התפתחות חיידקים בתרבות איבר המעי הגס וטופחו ללא E. coli. (ד) מושבות coli אין א אותרו ג איבר המעי הגסulture וטופח ללא E. coli, המציין בהיעדר חיידקי זיהום במדגם. הנתונים מייצגים אמצעי ± סטיית תקן; ** P <0.01, *** p <0.001. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

תאי אפיתל המעי רגישים מאוד מבחינת דרישות הצמיחה שלהם ולכן קשים תרבות. תאי אפיתל מבודדים על ידי טיפול EDTA אינם שורד תרבית תאי תקשורת קונבנציונלית כגון DMEM 8. לכן, מחקרי אינטראקציה לפתוגן מארח באמצעות הקריפטה מבודד או תאי אפיתל עיקריים הם מאוד מאתגרים. לאחרונה, סאטו ואח. תיאר מערכת התרבות organoid הקריפטה שהוא מבטיח מאוד שימושי עבור מחקרים הקשורים פתופיזיולוגיה מעיים 13. בעוד organoids מייצגים תכונות רבות של הקריפטה מעיים, ישנם חששות באשר ליכולתה של התגובה החיסונית של תאי organoid, אשר הם גדלו להיות בסביבה סטרילית, לשחזר את התגובות של תאי האפיתל במעי in vivo. הטכניקות המדויקות הנדרשות עבור בידוד וההתרבות של תאי גזע אפיתל דרישה של ריאגנטים יקרים לתרבות organoids למנוע maNY מעבדת מלנצל של מערכת זו. בעוד השימוש תרבות איבר vivo לשעבר אינו תחליף לתרבות organoid, מערכת זו מציעה שיטה קלה וזולה ללמוד התגובות מיקרוביאלית של אפיתל המעי.

היתרון העיקרי של שיטה זו הוא כי מבנה הרקמה של המעי נשמר תוך culturing את הכלים. הבחנו כי ברקמות המעי הגס הם פעילים מבחינה פיזיולוגית לפחות 24 שעות לאחר תרבותם. במהלך התרבות של המעי הגס, לתאי האפיתל במעי הגס מגיבים לגירויים חיצוניים, כפי שהיא נמדדת על ידי ביטוי של ציטוקינים פפטידים מיקרוביאלית. הכדאיות של תאי אפיתל של הרקמה השלמה יכולה להיות עוד יותר משופרת על ידי התוספת של גורמי גדילה מתאימים ומעכבים של מוות של תאים במדיום התרבות. דיווחים קודמים מראים כי איבר הרקמה גס האדם הנורמלי יכול להישמר vivo לשעבר במשך כמה ימים 8 sup>, 23, 24.

הפרוטוקול לתרבות vivo לשעבר של איבר העכבר גס יכול להיות יישומים רבים במחקרים הקשורים תגובות חיסוניות מיקרוביאלית של האפיתל במעי. הפתוגנים ו PAMPs שלהם מוכרים על ידי PRRs כגון קולטנים דמוי אגרה (TLRs) ואת הקולטנים דמוי NOD (NLRs) נוכחים תאי אפיתל החיסונית. ביטוי פגום ותפקוד של רבי TLRs ו NLRs המשויכים רגיש IBD, tumorigenesis הגס, וזיהומים חיידקיים. מאז שורות תאי אפיתל הנציחו אינן מייצגות את כל התכונות של נישת המעיים, תרבות איבר המעי גס vivo לשעבר הוא כלי ניסיוני מאוד שימושי. באמצעות מערכת זו, אנו יכולים לבחון את השפעת PAMPs או גירויים שונים על אינדוקציה של מולקולות מפעיל מיקרוביאלית בתאים האפיתל במעי. בניסוי הנציג, הראינו כי ציטוקינים אוהביםIL-1β ו- IL-18 הדק הביטוי של פפטידים מיקרוביאלית (איור 3). כמו כן, אנו מראים כאן כי פפטידים מיקרוביאלית המיוצר על ידי רקמת המעי הגס יכול למעשה להרוג E. coli (איור 4). טכניקות אלו יכולים להיות מיושמים על מנת לבחון את ההשפעה של lipopolysaccharide (LPS), פפטידוגליקן (PGN), muramyldipeptide (MDP), ו PAMPs אחרים בתגובות ההגנה המארחת מיקרוביאלית במעיים.

יש לנו שונה מעט פרוטוקול תרבות איבר המעי הגס כפי שתואר לעיל 12, 16, 20, 25. אנחנו מתורבתי המעי הגס בשני שלבים. בתחילה, אנו מודגרות רקמת המעי הגס אנטיביוטיקה המכיל בינוני עבור 2 שעות. אנחנו מסירים את האנטיביוטיקה עם כביסה חוזרת ונשנית של חתיכות המעי הגסות ואחריו דגירה עם תקשורת חופשית אנטיביוטיקה. לפיכך, supernatant התרבות המתקבל תרבות הלילה שלתערוכות המעי הגס רק את ההשפעה של פפטידים מיקרוביאלית מופרש כאשר מודגרות עם E. coli. גישה זו יכולה להיות מנוצלת כדי לראות את השפעת bactericidal של מעי גס או פפטידים מיקרוביאלית נגזר מעי על כל חיידקים של עניין. לתקשורת אגרה סלקטיבית מתאימה צריכה לשמש כדי לתרבת את החיידקים.

כמו רוב הטכניקות, יש מגבלות של מערכת התרבות איבר vivo לשעבר. ראשית, בניגוד תרבית תאים או תרבות organoid, האיברים לא גדלים מתרבים ולכן לא ניתן להרחיבו. שנית, תאי האפיתל במעי רגישים מאוד והם מתים מהר יחסית ללא גורמי גדילה נוספים ומעכבי אפופטוזיס, אשר משמשים תרבות organoid הקריפטה. שלישית, התגובה החיסונית ציינה מתרבה האיבר היא תגובה קולקטיבית של סוגים שונים של אוכלוסיות תאים. לכן תפקידו של סוג תא יחיד בביטוי של גנים מיקרוביאלית מפעיל לא ניתן להעריך. additionally, בניגוד בשורות תאים ותרבות organoid, הביטוי של פפטידים מיקרוביאלית ומולקולות מפעיל אחרים הנקודות עשוי להשתנות מעכבר כדי עכבר מאותו הרקע גנטי.

לסיכום, אנו מתארים כאן פרוטוקול פשוט לתרבות איבר vivo לשעבר גסה כי הוא מאוד שימושי לחקר תגובות חיסוניות מיקרוביאלית מעיים. גישה זו יכולה להיות מועסקת על מנת לבדוק את התפקיד של גני חיסון מולדים מגוונים בביטוי של פפטידים מיקרוביאלית על ידי culturing נקודות מעכברי מוטציה גנטיים של עניין. יתר על כן, פרוטוקול זה יכול להיות מותאם לשימוש במחקרים קליניים לבחון את התגובות מיקרוביאלית מעיים של חולי IBD ידי ביצוע תרבות איבר של דגימות ביופסיה של מעי גס.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgements

עבודה זו נתמכה על ידי מימון קרוהן קוליטיס קרן של אמריקה, (CCFA; 3711) מניעת סרטן לבין מכון המחקר של טקסס (CPRIT; RP160169), ו UT Southwestern Medical Center שניתנה MHZ

Materials

Name Company Catalog Number Comments
Advanced DMEM/ F12 Life Technologies 12634-010
Dulbecco's phosphate buffered saline, modified, w/o Calcium chloride & Magnesium chloride Sigma 5634
FBS, heat inactivated Sigma F4135
Penicillin-Streptomycin Life Technologies 15070063
Gentamicin solution Sigma G1272
Mouse IL-1b recombinan Reprokine RKP10749
Mouse IL-18 recombinant Reprokine RKP70380
TRIzol Reagent Thermo Fisher Scientific 15596018
Difco Luria-Bertani Broth  BD Bioscience 244620
BD Difco Dehydrated Culture Media: MacConkey Agar Fisher Scientific DF0075-17-1
NanoDrop 1000 Spectrophotometer Thermo Scientific Uded to measure RNA concentration
UV/Vis Spectrophotometer BECKMAN DU 530 Used to determine E. coli count
iScript RT Supermix, 100 rxns Bio-Rad 1708841
iTaq Univer SYBR Green Supermix  Bio-Rad 1725125 
Lysing Matrix S (1/8"), 2 ml Tube MP Biomedicals 116925500 Used to homgenize colon organ for RNA isolation
FastPrep-24 5G System Bio-Rad 116005500
100 mm x 15 mm Petri Dish Falcon 5687
Plate 6 well ps TC CS100, Cellstar, 6w, tc, F-bottom (Flat), w/lid, sterile Cellstar 5085
100 μm cell strainer Falcon 5698
Sorvall Legend Micro 21R Centrifuge Thermo Fisher Scientific
Sorvall ST40R Centrifuge Thermo Fisher Scientific
Forma Scientific orbital shaker Thermo Fisher Scientific

DOWNLOAD MATERIALS LIST

References

  1. Maloy, K. J., Powrie, F. Intestinal homeostasis and its breakdown in inflammatory bowel disease. Nature. 474, 298-306 (2011).
  2. Hooper, L. V., Macpherson, A. J. Immune adaptations that maintain homeostasis with the intestinal microbiota. Nat Rev Immunol. 10, 159-169 (2010).
  3. Vaishnava, S., Behrendt, C. L., Ismail, A. S., Eckmann, L., Hooper, L. V. Paneth cells directly sense gut commensals and maintain homeostasis at the intestinal host-microbial interface. Proc Natl Acad Sci U S A. 105, 20858-20863 (2008).
  4. Kamada, N., Chen, G. Y., Inohara, N., Nunez, G. Control of pathogens and pathobionts by the gut microbiota. Nat Immunol. 14, 685-690 (2013).
  5. Wu, H. J., Wu, E. The role of gut microbiota in immune homeostasis and autoimmunity. Gut Microbes. 3, 4-14 (2012).
  6. Zimmerman, N. P., Vongsa, R. A., Wendt, M. K., Dwinell, M. B. Chemokines and chemokine receptors in mucosal homeostasis at the intestinal epithelial barrier in inflammatory bowel disease. Inflamm Bowel Dis. 14, 1000-1011 (2008).
  7. Elliott, D. E., Siddique, S. S., Weinstock, J. V. Innate immunity in disease. Clin Gastroenterol Hepatol. 12, 749-755 (2014).
  8. Chopra, D. P., Dombkowski, A. A., Stemmer, P. M., Parker, G. C. Intestinal epithelial cells in vitro. Stem Cells Dev. 19, 131-142 (2010).
  9. Autrup, H. Explant culture of human colon. Methods Cell Biol. 21, 385-401 (1980).
  10. Qin, J., et al. A human gut microbial gene catalogue established by metagenomic sequencing. Nature. 464, 59-65 (2010).
  11. Wildenberg, M. E., vanden Brink, G. R. A major advance in ex vivo intestinal organ culture. Gut. 61, 961-962 (2012).
  12. Leushacke, M., Barker, N. Ex vivo culture of the intestinal epithelium: strategies and applications. Gut. 63, 1345-1354 (2014).
  13. Sato, T., et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459, 262-265 (2009).
  14. Tsilingiri, K., et al. Probiotic and postbiotic activity in health and disease: comparison on a novel polarised ex-vivo organ culture model. Gut. 61, 1007-1015 (2012).
  15. Haque, A., et al. Early interactions of Salmonella enterica serovar typhimurium with human small intestinal epithelial explants. Gut. 53, 1424-1430 (2004).
  16. Hicks, S., Candy, D. C., Phillips, A. D. Adhesion of enteroaggregative Escherichia coli to pediatric intestinal mucosa in vitro. Infect Immun. 64, 4751-4760 (1996).
  17. Knutton, S., Lloyd, D. R., Candy, D. C., McNeish, A. S. In vitro adhesion of enterotoxigenic Escherichia coli to human intestinal epithelial cells from mucosal biopsies. Infect Immun. 44, 514-518 (1984).
  18. Senior, P. V., Pritchett, C. J., Sunter, J. P., Appleton, D. R., Watson, A. J. Crypt regeneration in adult human colonic mucosa during prolonged organ culture. J Anat. 134, 459-469 (1982).
  19. Smollett, K., Shaw, R. K., Garmendia, J., Knutton, S., Frankel, G. Function and distribution of EspG2, a type III secretion system effector of enteropathogenic Escherichia coli. Microbes Infect. 8, 2220-2227 (2006).
  20. Bareiss, P. M., et al. Organotypical tissue cultures from adult murine colon as an in vitro model of intestinal mucosa. Histochem Cell Biol. 129, 795-804 (2008).
  21. Tsilingiri, K., Sonzogni, A., Caprioli, F., Rescigno, M. A novel method for the culture and polarized stimulation of human intestinal mucosa explants. J Vis Exp. e4368 (2013).
  22. Hu, S., et al. The DNA Sensor AIM2 Maintains Intestinal Homeostasis via Regulation of Epithelial Antimicrobial Host Defense. Cell Rep. 13, 1922-1936 (2015).
  23. Moorghen, M., Chapman, M., Appleton, D. R. An organ-culture method for human colorectal mucosa using serum-free medium. J Pathol. 180, 102-105 (1996).
  24. Dame, M. K., et al. Human colon tissue in organ culture: preservation of normal and neoplastic characteristics. In Vitro Cell Dev Biol Anim. 46, 114-122 (2010).
  25. Grant, A. J., Woodward, J., Maskell, D. J. Development of an ex vivo organ culture model using human gastro-intestinal tissue and Campylobacter jejuni. FEMS Microbiol Lett. 263, 240-243 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Video Stats