De

Published 2/13/2017
0 Comments
  CITE THIS  SHARE 
Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





By clicking "Submit", you agree to our policies.

 

Summary

Cite this Article

Copy Citation

Udden, S. M., Waliullah, S., Harris, M., Zaki, H. The Ex Vivo Colon Organ Culture and Its Use in Antimicrobial Host Defense Studies. J. Vis. Exp. (120), e55347, doi:10.3791/55347 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

De darm toont een architectuur van repetitieve crypt die bestaan ​​uit verschillende epitheelcellen, lamina propia met immuuncellen en stroma. Al deze heterogene cellen bijdragen tot intestinale homeostase en deelnemen aan antimicrobiële afweer. Daarom identificeren van een surrogaat model voor de studie immuunrespons en antimicrobiële activiteit van de darm in een in vitro omgeving is zeer uitdagend. In vitro studies met onsterfelijk intestinale epitheliale cellijnen of zelfs primaire crypt organoïde cultuur niet de exacte fysiologie van de normale darm en de micro-omgeving vertegenwoordigen. Hier bespreken we een methode voor het kweken van de muis colon weefsel in een cultuur schotel en hoe deze ex vivo orgelcultuur systeem kan in studies met betrekking tot antimicrobiële afweer reacties worden uitgevoerd. In representatieve experimenten, hebben we laten zien dat dubbele punten in orgelcultuur uitdrukken antimicrobiële peptiden in response exogene IL-1β en IL-18. Verder kan de antimicrobiële effector moleculen door de colon weefsels in de orgaankweek efficiënt doden Escherichia coli in vitro. Deze benadering kan dus worden gebruikt om de rol van pathogeen en gevaar geassocieerde moleculaire patronen en hun cellulaire receptoren ontleden reguleren intestinale aangeboren immuunresponsen en antimicrobiële afweer reacties.

Introduction

De darm is een dynamisch systeem dat fungeert als een barrière voor commensale microörganismen, vecht tegen binnendringende pathogenen, en regelt de microbiële samenstelling 1. De intestinale epitheelcellen, bestaande uit enterocyten, goblet cellen, Paneth cellen en entero-endocriene cellen, zijn de belangrijkste cel populaties die afweer responsen tegen darmmicrobiota bieden. De slijmbekercellen mucinen produceren dat een gedemilitariseerde zone aan de bovenkant van de epitheellaag 2 maken. De Paneth cellen en enterocyten produceren antimicrobiële peptiden, cytokinen en reactieve zuurstof en stikstof soorten die antimicrobiële afweer reacties vormen en bijdragen aan het vormgeven van de intestinale microbiële samenstelling 3, 4. Naast epitheelcellen, de immuuncellen zoals macrofagen, dendritische cellen, neutrofielen, NK cellen, lymfocyten en inna te lymfoïde cellen in de lamina propria en submucosa spelen een cruciale rol in de intestinale antimicrobiële afweer reacties door het produceren van cytokines, chemokines, en andere bemiddelaars 5-7. Om te begrijpen hoe het mucosale immuunsysteem reguleert microbiota en biedt bescherming tegen microbiële infectie, is het belangrijk om de complexe interactie van de heterogene celpopulaties van de darm te overwegen. Echter, een in vitro model dat alle functies van de darm omvat niet beschikbaar. Daarom moleculaire studies op gastheer-pathogeen interactie in de darm zeer uitdagend.

In de afgelopen jaren hebben verschillende modelsystemen die aspecten van het darmslijmvlies nabootsen ontwikkeld voor het onderzoeken van de pathofysiologische processen die betrokken zijn bij inflammatoire darmziekten (IBD) en andere gastro-intestinale aandoeningen 8 -= "xref"> 14. Geïmmortaliseerde intestinale epitheliale cellijnen worden vaak gebruikt om epitheelcellen specifieke responsen bestuderen. Vanwege differentiële genexpressie en functie in geïmmortaliseerde cellen, de gegevens van het gebruik van die cellen niet vaak overeenkomen met die waargenomen bij in vivo studies. Intestinale crypte organoïde cultuur recentelijk naar voren gekomen als een potentieel middel voor het beoordelen van de respons van het darmepitheel verschillende stimuli 13. In dit systeem worden crypte stamcellen kunnen groeien en ontwikkelen een 3D organoïde structuur. Terwijl het organoïde kweeksysteem is zeer nuttig voor het bestuderen van verschillende aspecten van het darmepitheel, is het niet de complexe interactie van immune cellen, epitheelcellen en microbiële producten imiteren. De ex vivo cultuur van het darmweefsel biedt een betere vertegenwoordiging van in vivo afweer reacties. In deze werkwijze wordt een deel van de darm wordt gekweekt in een celcultuur plaat with geschikte media waardoor de verschillende celpopulaties in de darm metabolisch actief gedurende ten minste 48 uur. Aldus kan een ex vivo kweek van het orgaan worden gebruikt om de expressie van antimicrobiële genen en de afweer reacties van de darm aan een bepaalde stimulus te meten.

De onderzoekers zijn met behulp van het ex vivo orgelcultuur systeem om de afweer responsen tegen microbiële infectie te bestuderen in de darm 15-21. We hebben onlangs de orgelcultuur systeem goedgekeurd om de rol van de inflammasoom in antimicrobiële afweer reacties in muizen dubbele punten 22 bestuderen. De inflammasoom is een moleculaire platform voor de activering van caspase-1, die nodig is voor de productie van gerijpte IL-1β en IL-18. We toonden aan dat IL-1β en IL-18 induceren antimicrobiële peptiden die effectief commensale pathobionts doden zoals E. coli E. coli lasten in inflammasoom-defecte muis dubbele punten 22. Dit systeem kan daarom worden gebruikt om de rol van receptoren patroonherkenning (PRRS) en andere aangeboren immuunsysteem moleculen in intestinale antimicrobiële afweer reacties en pathogenese van intestinale aandoeningen te bestuderen zoals ontstekingsdarmziekte (IBD) en colorectale kanker (CRC). Er zijn meer dan 200 IBD gevoelige genen en mutaties in veel van deze genen zijn geassocieerd met veranderde microbiële samenstelling in de darm. Het is van groot klinisch belang om het precieze mechanisme waardoor het IBD-gevoelige genen reguleren darmflora te bepalen. Het algemene doel van deze methode is om een basisprotocol van ex vivo colon orgaankweek introduceren en te demonstreren hoe dit kweekmethode kan worden gebruikt voor antimicrobiële afweer reacties van de darm te bestuderen.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle hier beschreven experimenten werden uitgevoerd met behulp van 6-8 weken oude mannelijke wild-type (C57BL6 / J) muizen gehouden in een specifiek pathogeenvrije (SPF) faciliteit in de Animal Resource Center (ARC), UT Southwestern Medical Center. Alle studies werden goedgekeurd door de Institutional Animal Care en gebruik Comite (IACUC) en werden uitgevoerd in overeenstemming met de IACUC richtlijnen en de National Institutes of Health Guide voor de zorg en het gebruik van proefdieren.

1. Verzameling en bereiding van de Colon

  1. Euthanaseren muizen met CO 2 stikken, gevolgd door cervicale dislocatie.
  2. Spray muizen met 70% ethanol en speld ledematen naar een pinning boord houden van de muis dorsale kant naar beneden op het bord.
  3. Met vooraf gesteriliseerde ontleden schaar en forceps, maak een middellijn incisie in het buikvlies van de buik. Open de buik door het vouwen van het buikvlies met een tang.
  4. Verwijder de ingewanden uit de buikholte with ontleden pincet en een schaar. Scheid de dikke darm van de dunne darm door te snijden onder aan de blindedarm en het andere uiteinde van de endeldarm.
  5. Plaats de dikke darm in een steriele petrischaal met ijskoude PBS. Spoel de inhoud van het lumen van het colon met ijskoude PBS met behulp van een 20 ml spuit met een 20 G naald of orale gavage naald tot de ontlasting in het lumen van het colon volledig verwijderd.
  6. Snijd de dikke darm met een schaar in de lengte. Was de colon door krachtig schudden in ijskoud PBS in een steriele petrischaal.
  7. Snijd de dikke darm weefsel in stukken van ongeveer 1 cm lang met een steriele scalpel of schaar.
  8. Noteer het gewicht van de colon stukken.
    Opmerking: Alle stappen in de sectie 1 kan worden uitgevoerd binnen of buiten een biologische veiligheidskast. Zodra dubbele punten zijn klaar voor cultuur, moeten alle stappen worden uitgevoerd in een biologische veiligheid kabinet om de steriliteit te behouden.

2. Colon Orgeen cultuur

  1. Plaats een cel zeef (100 pm) op een 6-well celkweek plaat. Breng alle van de dikke darm stukken verzameld uit één muis in de cel zeef.
  2. Voeg 5 ml DMEM / F12 medium met 5% FBS, penicilline-streptomycine (1x) en gentamycine (20 ug / ml). Bedek de colon stukken met de media.
  3. Incubeer gedurende 2 uur bij 37 ° C in een incubator met 5% CO2 en 95% lucht.
  4. Til de cel zeef en zuig de media.
  5. Plaats de cel zeef terug de put en voeg 5 ml vers medium zonder antibiotica. Til de cel zeef en zuig de media.
  6. Herhaal deze wasstap (stap 2,5) tweemaal (totaal 3x) om alle resterende antibiotica verwijderen.
  7. Breng de colon stukken uit een enkele cel zeef in een enkel putje van een steriele 12-puts celkweekplaat.
  8. Voeg DMEM / F12 medium met 5% FBS (zonder antibiotica). Pas het volume van het medium met de Weight van de colon stukken, bijvoorbeeld 1 ml medium voor 100 mg weefsel. Incubeer gedurende 12 uur bij 37 ° C in een incubator injecteren van 5% CO2 en 95% lucht.
  9. Verzamel de kweeksupernatant in een steriele 1,5 ml buis.
  10. Centrifugeer bij 12.000 xg bij 4 ° C gedurende 5 minuten. Scheid de supernatant naar een nieuwe 1,5 ml buis voor toepassing in de bacteriedodende assay en / of andere immunologische testen. Het supernatant kan worden opgeslagen bij -80 ° C tot de analyse.
  11. Verzamel de colon stukken in een rol voor RNA-isolatie.

3. E. coli Killing Assay

  1. Enten E. coli in 5 ml Luria-Bertani (LB) bouillon in een 15 ml buis en incubeer bij 37 ° C onder schudden bij 200 rpm overnacht. Houd de dop van de cultuur buis iets los.
  2. Centrifugeer de bacteriekweek buis bij 1200 xg gedurende 10 min bij 4 ° C. Verwijder het supernatant en resuspendeer de bacteriële pellet in 5 ml ijskoude PBS.
  3. Breng 1 ml van de bacterial suspensie in een cuvet en meet OD bij 600 nm. Gebruik PBS als een blanco.
  4. Bereken de kolonievormende eenheid (CFU) volgens een vooraf bepaalde standaardcurve. Hier wordt aangenomen dat 1 OD = 2 x 10 9 cfu / ml (ongeveer).
  5. Verdun de bacteriële suspensie om de voorraad schorsing maken 1 x 10 5 kve / ml.
  6. Breng de dikke darm orgel kweeksupernatant (500 ul / putje) in paragraaf 2.10 verzameld in duplo putjes van een 24-well celkweek plaat.
  7. Voeg 10 ul E. coli cultuur (1000 kve) in een putje met 500 pi colon orgelcultuur supernatant. Laat de andere goed zonder E. coli inenting te bevestigen dat de dikke darm orgelcultuur bovenstaande verontreinigingen bevat.
  8. Incubeer hetzelfde aantal bacteriën (1000 cfu) in het kweekmedium (DMEM / F12 plus 5% FBS) zonder antibiotica als controle.
  9. Incubeer bij 37 ° C gedurende 1 uur.
  10. Plaats 50 pi van elk monster drop-wise op MacConkey agarplaten. Incubeer de MacConkey agarplaten bij 37 ° C overnacht.
  11. Tel het aantal kolonies en berekening van de cfu / ml.

4. Het effect van extrinsieke en intrinsieke factoren op de dikke darm Antimicrobial Host Defense Responses

LET OP: De antimicrobiële moord assay zoals hier beschreven kunnen worden genomen om het effect van de pathogeen geassocieerde moleculaire patronen (PAMPs) en cytokines op de bacteriedodende activiteit van de orgelcultuur bovenstaande onderzoeken. Een voorbeeld van een dergelijk experiment met behulp van IL-1β en IL-18 wordt hieronder beschreven.

  1. Verzamel dubbele punten van muizen zoals beschreven in paragraaf 1.
  2. Leg de dikke darm op een steriele papieren handdoek. Snijd de colon langsrichting in drie delen met een schaar (figuur 2).
  3. Was elk deel van de colon in ijskoud PBS zoals beschreven in paragraaf 1.
  4. Snijd elk deel van de dikke darm in kleine stukjes en weeg aseptisch. Breng de stukken van elk onderdeelvan de colon in drie afzonderlijke cel zeven (100 um) geplaatst op drie putjes van een 6-well celcultuur plaat (figuur 2).
  5. Voeg 2 ml DMEM / F12 medium met 5% FBS, penicilline-streptomycine (1x) en gentamycine (20 ug / ml).
  6. Incubeer gedurende 2 uur bij 37 ° C in een incubator injecteren van 5% CO2 en 95% lucht.
  7. Was de colon stukken zoals in 2,4-2,6. Breng de colon stukken van een enkele cel zeef in een enkel putje van een steriele 12-puts celkweekplaat. De drie putjes die drie delen van de colon van een muis worden aangewezen als onbehandeld, IL-1β en IL-18 (figuur 2).
  8. Voeg DMEM / F12 medium met 5% FBS (zonder antibiotica). Het volume van het medium met het gewicht van de colon stukken, bijvoorbeeld 1 ml medium voor 100 mg weefsel.
  9. Stimuleren van de colon orgaankweek met IL-1β (20 ng / ml) of IL-18 (20 ng / ml) gedurende 12 h. De onbehandelde colon orgaankweek dient als controle.
  10. Na 12 uur incubatie bij 37 ° C in een incubator injecteren van 5% CO2 en 95% lucht, verzamel de kweeksupernatant in een steriele 1,5 mL buis.
  11. Transfer 500 pi kweeksupernatant in duplicaat putjes van een 24-wells plaat.
  12. Inoculeren E. coli (1000 cfu) in colon orgaan kweeksupernatant zoals beschreven in sectie 3. Voor elke voorwaarde, enten E. coli in een enkel putje. De andere goed met hetzelfde orgaan kweeksupernatant zonder E. coli zal dienen als controle voor bacteriële besmetting.
  13. Incubeer dezelfde hoeveelheid bacteriën in kweekmedium zonder antibiotica als controle.
  14. Incubeer bij 37 ° C gedurende 1 uur.
  15. Plaats 50 pi van elk monster druppelsgewijs op MacConkey agarplaten. Incubeer de MacConkey agarplaten gedurende de nacht bij 37 ° C.
  16. Tel het aantal kolonies en berekening van de cfu / ml (Figuur 4).
e_title "> 5. Meting van de expressie van genen Antimicrobial

  1. Na incubatie gedurende de nacht (12 uur) van het colon orgelcultuur, zoals beschreven in de artikelen 2 en 4, was de dikke darm stukken met 2 ml ijskoude PBS (2x).
  2. Verzamel de dikke darm stukken in een 2 ml RNase / DNase gratis schroefdop buis. Plaats de buizen op ijs.
  3. Voeg 1 mL commerciële Trizol reagens en lyseren matrix kralen in de buis.
  4. Lyse het weefsel met behulp van een geautomatiseerde weefsel homogenisator.
  5. Verzamel het weefsel lysaat in een nieuwe microcentrifugebuis.
  6. Isoleer RNA met een standaardprotocol.
  7. Meet RNA-concentratie.
  8. Verdun RNA adequaat met gedeïoniseerd water en gebruik 500 ng RNA te synthetiseren cDNA.
  9. Met het cDNA voor real-time RT-PCR analyse van gerichte antimicrobiële genen, cytokines, chemokines, en andere genen van belang.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Een representatief beeld van dubbele punten in orgaankweek is weergegeven in figuur 1. De dubbele punt stukken in de cultuur blijven metabool en fysiologisch actief. Ze reageren efficiënt exogene stimuli toegevoegd aan het kweekmedium. Een schematische workflow van de voorbereiding van het colon weefsel voor ex vivo kweken en stimulatie met exogene stimuli, zoals IL-1β en IL-18, is weergegeven in figuur 2. De representatieve gegevens in figuur 3 laten zien dat dubbele punten in orgelcultuur uiten antimicrobiële peptiden, zoals β-defensine 2 (BD2), Reg3γ, S100A8, S100A9 en iNOS in reactie op IL-1β en IL-18.

De mediatoren vrijgesteld door de colon implantaten vertonen een antimicrobiële dodende werking zoals blijkt uit de aanzienlijk verminderde groei van E. coli geïncubeerd met het orgel kweeksupernatant ( 4B). Dergelijke E. coli dodende activiteit wordt verder versterkt door de stimulatie van IL-1β en IL-18 (Figuren 4A en 4B). Colon orgel kweeksupernatanten geincubeerd zonder E. coli tonen geen bacteriegroei volgende cultuur op MacConkey agar (figuren 4C en 4D). Deze resultaten suggereren dat de inflammasoom een ​​belangrijke rol in de intestinale antimicrobiële afweer speelt.

Kortom, de hier gepresenteerde gegevens suggereren dat ex vivo colon orgelcultuur is een zeer bruikbare techniek intestinale antimicrobiële immuunresponsen in vitro bestuderen.

GAPDH_F TGGCAAAGTGGAGATTGTTGCC
GAPDH_R AAGATGGTGATGGGCTTCCCG
β-defensine 2 (BD2) _F TGACCACTGCCACACCAATG
β-defensine 2 (BD2) _R CCTGGCAGAAGGAGGACAAA
Reg3γ_F CAAGGTGAAGTTGCCAAGAA
Reg3γ_R CCTCTGTTGGGTTCATAGCC
S100a8_F TGTCCTCAGTTTGTGCAGAATATAAA
S100a8_R TCACCATCGCAAGGAACTCC
S100a9_F GGTGGAAGCACAGTTGGCA
S100a9_R GTGTCCAGGTCCTCCATGATG
iNOS_F TGTGACACACAGCGCTACAACA
iNOS_R GAAACTATGGAGCACAGCCACAT

Tabel 1: Lijst van muis primers voor real-time PCR.


Figuur 1: representatief beeld van de muis dikke stukken in de cultuur. (A) Incubatie van dikke stukken op een cel zeef (100 pm) aangebracht op een 6-wells plaat. Colon stukken worden ondergedompeld in 2 ml kweekmedium aangevuld met antibiotica. (B) Na 2 h incubatie worden colon stukken overgebracht in het putje van een nieuwe 12-well celkweek plaat antibiotica-vrij medium. Klik hier om een grotere versie van deze figuur te bekijken.

Figuur 2
Figuur 2: Schematische weergave van de stappen voor de bereiding van dikke darm weefsel en ex vivo stimulatie met IL-1β en IL-18. De dubbele punt van de ene muis longi tudinally ontleed in drie delen. Elk deel werd in kleine stukjes gesneden en gewogen. De dubbele punt stukken uit elk deel van de dikke darm worden overgebracht naar cel zeven geplaatst op putjes van een 6-wells plaat met 2 ml DMEM / F12 medium met 5% FBS en antibiotica. Na een 2 uur incubatie worden colon stukken uit een enkele cel zeef overgebracht naar een enkel putje van een 12-well celcultuur plaat. DMEM / F12 plus 5% FBS (zonder antibiotica) wordt toegevoegd aan elk putje en de hoeveelheid van het medium wordt aangepast aan het gewicht van het weefsel (1 ml media 100 mg weefsel). Colon weefsels gestimuleerd met IL-1β (20 ng / ml) en IL-18 (20 ng / ml) gedurende 12 h. Kweek supernatant gecentrifugeerd en gebruikt voor E. coli doden assay en / of andere immunologische testen. De colon weefsel worden verzameld in commerciële trypsine reagens voor RNA-isolatie en daaropvolgende analyse van antimicrobiële genexpressie door real-time PCR..jpg "target =" _ blank "> Klik hier om een ​​grotere versie van deze figuur te bekijken.

figuur 3
Figuur 3: Muis colon weefsels tot expressie cytokines en antimicrobiële peptiden in respons op IL-1β of IL-18 tijdens het ex vivo kweken. Colon orgaan kweken werden gestimuleerd met IL-1β (20 ng / ml) of IL-18 (20 ng / ml) gedurende 12 h. De expressie van BD2, Reg3γ, S100A8, S100A9 en iNOS werd gemeten door real-time RT-PCR (tabel 1). De gegevens geven gemiddelden ± SD; * P <0,05, ** p <0,01. Klik hier om een grotere versie van deze figuur te bekijken.

figuur 4
Figuur 4: Supernatant van de muis colon orgel culture vertoont bacteriedodende werking. Colon stukken werden gekweekt ex vivo in de aanwezigheid of afwezigheid van IL-1β (20 ng / ml) of IL-18 (20 ng / ml) gedurende 12 h. 500 pl van de kweeksupernatanten werden geïncubeerd met E. coli (1000 cfu) gedurende 1 uur bij 37 ° C. Colon orgaan kweeksupernatant zonder E. coli werd ook geïncubeerd als controle. Na 1 uur incubatie werd 50 ul van elk monster druppelsgewijs op MacConkey agar platen gebracht en geïncubeerd bij 37 ° C overnacht. (A) Foto van E. coli kolonies op MacConkey agar zien antimicrobiële werking van de dikke darm orgelcultuur. (B) E. coli telling geeft dodingefficiëntie van IL-1β- en IL-18 behandelde colon orgaan kweeksupernatant. (C) Foto van MacConkey agar plaat toont geen groei van bacteriën in de dikke darm orgelcultuur bebroede zonder E. coli. (D) nr E. coli kolonies werden geïdentificeerd colon orgaan cultuur bebroede zonder E. coli, met vermelding van de afwezigheid van besmetting van bacteriën in het monster. De gegevens geven gemiddelden ± SD; ** P <0,01, *** p <0,001. Klik hier om een grotere versie van deze figuur te bekijken.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

De intestinale epitheliale cellen zeer gevoelig wat betreft hun groei eisen en derhalve moeilijk te kweken. De epitheelcellen geïsoleerd door EDTA behandeling niet overleven in de conventionele celcultuur media, zoals DMEM 8. Daarom gastheer-pathogeen interactie studies met behulp van geïsoleerde crypte of primaire epitheliale cellen zijn zeer uitdagend. Onlangs, Sato et al. beschreef een crypte organoïde cultuur systeem dat is veelbelovend en nuttig voor studies met betrekking tot intestinale pathofysiologie 13. Terwijl organoids vertegenwoordigen vele kenmerken van intestinale crypte zijn er zorgen of de immuunresponsen van het organoïde cellen die worden gekweekt in een steriele omgeving, herhalen de reacties van intestinale epitheliale cellen in vivo. De precieze technieken die nodig zijn voor het kweken van epitheliale stamcellen en vereiste dure reagentia voor de cultuur van organoids voorkomen many laboratoria uit te maken van dit systeem. Hoewel het gebruik van ex vivo orgaankweek is geen alternatief voor organoïde cultuur, biedt dit systeem een eenvoudige en goedkope methode om de antimicrobiële reacties van darmepitheel bestuderen.

Het grote voordeel van deze techniek is dat de weefselarchitectuur van de darm wordt gehandhaafd tijdens het kweken in de gerechten. We zagen dat de colon weefsels fysiologisch actieve minstens 24 uur na de kweek. Tijdens het kweken van de dikke darm, de colon epitheelcellen reageren op exogene stimuli, zoals gemeten door expressie van cytokines en antimicrobiële peptiden. De levensvatbaarheid van de epitheelcellen van het intacte weefsel kan verder worden verbeterd door de toevoeging van geschikte groeifactoren en remmers van celdood in het kweekmedium. Eerdere rapporten suggereren dat de normale menselijke colon weefsel orgaan ex vivo kan worden gedurende verscheidene dagen 8 sup>, 23, 24.

Het protocol voor de ex vivo cultuur van de muis colon orgaan kan vele toepassingen in studies met betrekking tot antimicrobiële immuunrespons van het darmepitheel te hebben. De ziekteverwekkers en hun PAMPs worden erkend door PRRS zoals Toll-like receptoren (TLR) en NOD-like receptoren (NLR) aanwezig in epitheel en immuuncellen. Defecte expressie en functie van vele TLRs en NLR zijn geassocieerd met gevoeligheid voor IBD, colorectale tumorigenese en bacteriële infecties. Sinds onsterfelijk epitheliale cellijnen niet alle functies van de intestinale niche vertegenwoordigen, de ex vivo colon orgelcultuur is een zeer nuttig experimentele tool. Met dit systeem kunnen we het effect van verschillende PAMPs stimuli of op de inductie van antimicrobiële effector moleculen in de intestinale epitheelcellen onderzocht. In de representatieve experiment, hebben we aangetoond dat cytokines graagIL-1β en IL-18 trekker de expressie van antimicrobiële peptiden (figuur 3). We hier laten zien dat antimicrobiële peptiden door colonweefsel effectief kan doden E. coli (Figuur 4). Deze technieken kunnen worden toegepast om de invloed van lipopolysaccharide (LPS), peptidoglycaan (PGN), muramyldipeptide (MDP) en andere PAMPs in antimicrobiële afweer reacties in de darm te testen.

We hebben enigszins gewijzigde colon orgaan cultuurprotocol zoals eerder 12, 16, 20, 25 beschreven. We gekweekt het colon in twee fasen. Aanvankelijk we geïncubeerd colon weefsel in antibiotica bevattend medium gedurende 2 uur. We vervolgens verwijderd antibiotica met herhaalde wassen van de colon stukken gevolgd door incubatie met antibiotica vrije media. Dus de kweeksupernatant verkregen overnachtcultuur van decolon vertoont slechts toe uitgescheiden antimicrobiële peptiden geïncubeerd met E. coli. Deze benadering kan worden gebruikt om het bactericide effect van colon of darm afgeleide antimicrobiële peptiden see on bacteriën plaats. Een geschikte selectieve agar media moeten worden gebruikt om de kweken bacteriën.

Net als de meeste technieken zijn er beperkingen van de ex vivo orgaan kweeksysteem. Ten eerste, in tegenstelling celkweek of organoïde cultuur, de organen niet groeien en prolifereren en daarom kan niet worden uitgebreid. Anderzijds darmepitheelcellen zeer gevoelig en zij sterven relatief snel en zonder bijkomende groeifactoren en apoptose remmers, die worden gebruikt voor crypt organoïde cultuur. Ten derde, de immuunrespons waargenomen vanuit de orgelcultuur een gezamenlijke reactie van verschillende celpopulaties. Daarom kan de rol van individuele celtype in de expressie van antimicrobiële effector en genen niet worden beoordeeld. addititionaal, anders dan in cellijnen en organoïde cultuur, de expressie van antimicrobiële peptiden en andere effector moleculen in de darmen kan variëren van muis tot muis van dezelfde genetische achtergrond.

Samengevat beschrijven we hier een eenvoudig protocol voor ex vivo colon orgaankweek dat zeer nuttig voor het bestuderen van intestinale antimicrobiële immuunrespons. Deze benadering kan worden gebruikt om de rol van diverse innate immune genen in de expressie van antimicrobiële peptiden getest door het kweken van zuilen genetische mutante muizen plaats. Verder kan dit protocol worden aangepast voor gebruik in klinische studies naar de intestinale antimicrobiële reacties van IBD patiënten onderzocht door het uitvoeren orgelcultuur colon biopsiemonsters.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgements

Dit werk werd ondersteund door de financiering van de Crohn en Colitis Foundation of America, (CCFA; 3711) Cancer Prevention and Research Institute of Texas (CPRIT; RP160169) en UT Southwestern Medical Center gegeven aan MHZ

Materials

Name Company Catalog Number Comments
Advanced DMEM/ F12 Life Technologies 12634-010
Dulbecco's phosphate buffered saline, modified, w/o Calcium chloride & Magnesium chloride Sigma 5634
FBS, heat inactivated Sigma F4135
Penicillin-Streptomycin Life Technologies 15070063
Gentamicin solution Sigma G1272
Mouse IL-1b recombinan Reprokine RKP10749
Mouse IL-18 recombinant Reprokine RKP70380
TRIzol Reagent Thermo Fisher Scientific 15596018
Difco Luria-Bertani Broth  BD Bioscience 244620
BD Difco Dehydrated Culture Media: MacConkey Agar Fisher Scientific DF0075-17-1
NanoDrop 1000 Spectrophotometer Thermo Scientific Uded to measure RNA concentration
UV/Vis Spectrophotometer BECKMAN DU 530 Used to determine E. coli count
iScript RT Supermix, 100 rxns Bio-Rad 1708841
iTaq Univer SYBR Green Supermix  Bio-Rad 1725125 
Lysing Matrix S (1/8"), 2 ml Tube MP Biomedicals 116925500 Used to homgenize colon organ for RNA isolation
FastPrep-24 5G System Bio-Rad 116005500
100 mm x 15 mm Petri Dish Falcon 5687
Plate 6 well ps TC CS100, Cellstar, 6w, tc, F-bottom (Flat), w/lid, sterile Cellstar 5085
100 μm cell strainer Falcon 5698
Sorvall Legend Micro 21R Centrifuge Thermo Fisher Scientific
Sorvall ST40R Centrifuge Thermo Fisher Scientific
Forma Scientific orbital shaker Thermo Fisher Scientific

DOWNLOAD MATERIALS LIST

References

  1. Maloy, K. J., Powrie, F. Intestinal homeostasis and its breakdown in inflammatory bowel disease. Nature. 474, 298-306 (2011).
  2. Hooper, L. V., Macpherson, A. J. Immune adaptations that maintain homeostasis with the intestinal microbiota. Nat Rev Immunol. 10, 159-169 (2010).
  3. Vaishnava, S., Behrendt, C. L., Ismail, A. S., Eckmann, L., Hooper, L. V. Paneth cells directly sense gut commensals and maintain homeostasis at the intestinal host-microbial interface. Proc Natl Acad Sci U S A. 105, 20858-20863 (2008).
  4. Kamada, N., Chen, G. Y., Inohara, N., Nunez, G. Control of pathogens and pathobionts by the gut microbiota. Nat Immunol. 14, 685-690 (2013).
  5. Wu, H. J., Wu, E. The role of gut microbiota in immune homeostasis and autoimmunity. Gut Microbes. 3, 4-14 (2012).
  6. Zimmerman, N. P., Vongsa, R. A., Wendt, M. K., Dwinell, M. B. Chemokines and chemokine receptors in mucosal homeostasis at the intestinal epithelial barrier in inflammatory bowel disease. Inflamm Bowel Dis. 14, 1000-1011 (2008).
  7. Elliott, D. E., Siddique, S. S., Weinstock, J. V. Innate immunity in disease. Clin Gastroenterol Hepatol. 12, 749-755 (2014).
  8. Chopra, D. P., Dombkowski, A. A., Stemmer, P. M., Parker, G. C. Intestinal epithelial cells in vitro. Stem Cells Dev. 19, 131-142 (2010).
  9. Autrup, H. Explant culture of human colon. Methods Cell Biol. 21, 385-401 (1980).
  10. Qin, J., et al. A human gut microbial gene catalogue established by metagenomic sequencing. Nature. 464, 59-65 (2010).
  11. Wildenberg, M. E., vanden Brink, G. R. A major advance in ex vivo intestinal organ culture. Gut. 61, 961-962 (2012).
  12. Leushacke, M., Barker, N. Ex vivo culture of the intestinal epithelium: strategies and applications. Gut. 63, 1345-1354 (2014).
  13. Sato, T., et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459, 262-265 (2009).
  14. Tsilingiri, K., et al. Probiotic and postbiotic activity in health and disease: comparison on a novel polarised ex-vivo organ culture model. Gut. 61, 1007-1015 (2012).
  15. Haque, A., et al. Early interactions of Salmonella enterica serovar typhimurium with human small intestinal epithelial explants. Gut. 53, 1424-1430 (2004).
  16. Hicks, S., Candy, D. C., Phillips, A. D. Adhesion of enteroaggregative Escherichia coli to pediatric intestinal mucosa in vitro. Infect Immun. 64, 4751-4760 (1996).
  17. Knutton, S., Lloyd, D. R., Candy, D. C., McNeish, A. S. In vitro adhesion of enterotoxigenic Escherichia coli to human intestinal epithelial cells from mucosal biopsies. Infect Immun. 44, 514-518 (1984).
  18. Senior, P. V., Pritchett, C. J., Sunter, J. P., Appleton, D. R., Watson, A. J. Crypt regeneration in adult human colonic mucosa during prolonged organ culture. J Anat. 134, 459-469 (1982).
  19. Smollett, K., Shaw, R. K., Garmendia, J., Knutton, S., Frankel, G. Function and distribution of EspG2, a type III secretion system effector of enteropathogenic Escherichia coli. Microbes Infect. 8, 2220-2227 (2006).
  20. Bareiss, P. M., et al. Organotypical tissue cultures from adult murine colon as an in vitro model of intestinal mucosa. Histochem Cell Biol. 129, 795-804 (2008).
  21. Tsilingiri, K., Sonzogni, A., Caprioli, F., Rescigno, M. A novel method for the culture and polarized stimulation of human intestinal mucosa explants. J Vis Exp. e4368 (2013).
  22. Hu, S., et al. The DNA Sensor AIM2 Maintains Intestinal Homeostasis via Regulation of Epithelial Antimicrobial Host Defense. Cell Rep. 13, 1922-1936 (2015).
  23. Moorghen, M., Chapman, M., Appleton, D. R. An organ-culture method for human colorectal mucosa using serum-free medium. J Pathol. 180, 102-105 (1996).
  24. Dame, M. K., et al. Human colon tissue in organ culture: preservation of normal and neoplastic characteristics. In Vitro Cell Dev Biol Anim. 46, 114-122 (2010).
  25. Grant, A. J., Woodward, J., Maskell, D. J. Development of an ex vivo organ culture model using human gastro-intestinal tissue and Campylobacter jejuni. FEMS Microbiol Lett. 263, 240-243 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Video Stats