le

Published 2/13/2017
0 Comments
  CITE THIS  SHARE 
Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





By clicking "Submit", you agree to our policies.

 

Summary

Cite this Article

Copy Citation

Udden, S. M., Waliullah, S., Harris, M., Zaki, H. The Ex Vivo Colon Organ Culture and Its Use in Antimicrobial Host Defense Studies. J. Vis. Exp. (120), e55347, doi:10.3791/55347 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

L'intestin présente une architecture de structures glandulaires répétitives constituées de différents types de cellules épithéliales, de la lamina propria contenant des cellules immunitaires, et le stroma. Toutes ces cellules hétérogènes contribuent à l'homéostasie intestinale et participent à la défense de l'hôte antimicrobien. Par conséquent, l' identification d' un modèle de substitution pour l' étude de la réponse immunitaire et l' activité antimicrobienne de l'intestin dans un milieu in vitro est extrêmement difficile. Des études in vitro utilisant des lignées intestinales immortalisées de cellules épithéliales ou crypte même primaire organoide culture ne représentent pas la physiologie exacte de l' intestin normal et son microenvironnement. Ici, nous discutons d' une méthode de tissu du côlon culture de la souris dans une boîte de culture et comment cette ex vivo système de culture d'organe peut être mis en œuvre dans les études relatives aux réponses de défense de l' hôte antimicrobiens. Dans des expériences représentatives, nous avons montré que dans la culture côlons d'organes expriment des peptides antimicrobiens dans response exogène de l'IL-1β et IL-18. En outre, les molécules effectrices antimicrobiens produits par les tissus du côlon dans la culture d'organes tuent efficacement Escherichia coli in vitro. Cette approche, par conséquent, peut être utilisé pour disséquer le rôle des modèles moléculaires et de danger-pathogène-associés et leurs récepteurs cellulaires dans la régulation des réponses immunitaires innées intestinales et les réponses de défense de l'hôte antimicrobiens.

Introduction

L'intestin représente un système dynamique qui agit comme une barrière pour les micro - organismes commensaux, lutte contre les agents pathogènes envahisseurs, et régule la composition microbienne 1. Les cellules épithéliales intestinales, comprenant des entérocytes, les cellules caliciformes, des cellules de Paneth et des cellules entéro-endocrines sont les principales populations cellulaires qui fournissent des réponses de défense de l'hôte contre la microflore intestinale. Les cellules caliciformes produisent mucines qui créent une zone démilitarisée sur la partie supérieure de la couche épithéliale 2. Les cellules et les entérocytes Paneth produisent des peptides antimicrobiens, des cytokines, et des espèces d'oxygène et d' azote réactifs qui constituent les réactions de défense de l' hôte antimicrobiennes et contribuent à la mise en forme de la composition microbienne intestinale 3, 4. En plus des cellules épithéliales, les cellules immunitaires, y compris les macrophages, les cellules dendritiques, les neutrophiles, les cellules tueuses naturelles, les lymphocytes et inna les cellules lymphoïdes te dans la lamina propria et la sous - muqueuse jouent un rôle essentiel dans les réactions de défense de l' hôte antimicrobiens intestinales par des cytokines, chimiokines produisant ainsi que d' autres médiateurs 5 - 7. Afin de comprendre comment le système immunitaire de la muqueuse régule microbiote et assure une protection contre l'infection microbienne, il est important de tenir compte de l'interaction complexe des populations de cellules hétérogènes de l'intestin. Cependant, un modèle in vitro qui comprend toutes les fonctions de l'intestin ne sont pas disponibles. Par conséquent, les études moléculaires sur l'interaction hôte-pathogène dans l'intestin sont très difficiles.

Au cours des dernières années, plusieurs systèmes modèles qui simulent les aspects de la muqueuse intestinale ont été développées pour étudier les processus physiopathologiques impliqués dans les maladies inflammatoires de l' intestin (MICI) et d' autres troubles gastro - intestinaux 8 -= "xref"> 14. lignées immortalisées de cellules épithéliales de l'intestin sont souvent utilisés pour étudier les réponses spécifiques des cellules épithéliales. Toutefois, en raison de l' expression différentielle de gènes et la fonction des cellules immortalisées, les données obtenues à partir de l' utilisation de ces cellules ne correspondent pas toujours à celles observées dans les études in vivo. Crypte Intestinal organoide culture a récemment émergé comme un outil potentiel pour évaluer la réponse de l'épithélium intestinal à des stimuli différents 13. Dans ce système, les cellules souches cryptes sont autorisés à croître et à développer une structure organoide 3D. Bien que le système de culture organoïde est très utile pour l'étude de nombreux aspects de l'épithélium intestinal, il ne reproduit pas l'interaction complexe entre les cellules immunitaires, les cellules épithéliales et les produits microbiens. La culture ex vivo du tissu intestinal offre une meilleure représentation des in vivo des réponses de défense de l' hôte dans. Dans ce procédé, une partie de l'intestin est cultivée dans une culture cellulaire plaque esprith médias appropriés permettant aux différents types de populations de cellules dans l'intestin pour être métaboliquement actif pendant au moins 48 h. Ainsi, une culture ex vivo de l'organe peut être utilisé pour mesurer l'expression des gènes antimicrobiens et les réactions de défense de l' hôte de l'intestin à un stimulus particulier.

Les enquêteurs ont eu recours à l'ex vivo système de culture d'organe pour étudier les réactions de défense de l' hôte contre l' infection microbienne dans l'intestin 15-21. Nous avons récemment adopté le système de culture d'organe pour étudier le rôle de l'inflammasome dans les réponses de défense de l' hôte antimicrobiens chez les colons de souris 22. Inflammasome est une plate-forme moléculaire pour l'activation de la caspase-1, qui est nécessaire pour la production d'une maturation de l'IL-1β et IL-18. Nous avons montré que l' IL-1β et IL-18 induisent des peptides antimicrobiens qui tuent efficacement pathobiontes commensales telles que E. coli E. coli charge dans côlons de souris 22 inflammasome-défectueux. Ce système peut donc être utilisé pour étudier le rôle des récepteurs de reconnaissance des formes (PRR), et d'autres molécules immunitaires innées dans les réactions de défense de l'hôte antimicrobiens intestinaux ainsi que pathogenèse de troubles intestinaux tels que la maladie inflammatoire de l'intestin (MII) et du cancer colorectal (CRC). Il y a plus de 200 gènes de susceptibilité IBD, et des mutations dans plusieurs de ces gènes sont associés à la composition microbienne altérée dans l'intestin. Il est d'une grande importance clinique pour déterminer le mécanisme précis par lequel les gènes IBD-sensibilité régulent microbiote intestinale. L'objectif global de cette méthode est d'introduire un protocole de base de culture ex vivo d'organes du côlon et de démontrer comment cette méthode de culture peut être utilisée pour étudier les réponses antimicrobiennes de l'intestin de défense de l' hôte.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Toutes les expériences décrites ici ont été effectuées en utilisant 6-8 semaines de type sauvage mâle (C57BL6 / J) souris maintenues dans une zone de libre installation des agents pathogènes spécifiques (SPF) au Centre des ressources animales (ARC), UT Southwestern Medical Center. Toutes les études ont été approuvées par le Comité des soins et l'utilisation des animaux institutionnels (IACUC) et ont été menées conformément aux lignes directrices du IACUC et les National Institutes of Health Guide pour le soin et l'utilisation des animaux de laboratoire.

1. Collecte et préparation du côlon

  1. Euthanize souris avec asphyxie au CO2 suivie d' une dislocation cervicale.
  2. Vaporiser souris avec 70% d'éthanol et épingler les membres d'un conseil épinglant en gardant la face dorsale de la souris sur la carte.
  3. Avec des ciseaux et des pinces pré-stérilisés dissection, faire une incision médiane dans le péritoine de l'abdomen. Ouvrez l'abdomen en pliant le péritoine avec une pince.
  4. Retirer l'intestin de la cavité abdominale wie dissection pinces et ciseaux. Séparer le côlon à partir de l'intestin grêle, en coupant au fond du caecum et l'autre extrémité au niveau du rectum.
  5. Placez le côlon dans une boîte de Pétri stérile contenant du PBS glacé. Vider le contenu de la lumière du côlon avec du PBS glacé à l'aide d'une seringue 20 ml de maintien d'une aiguille G 20 ou une aiguille de gavage oral, jusqu'à ce que les selles dans la lumière du côlon est complètement enlevé.
  6. Couper le côlon avec des ciseaux longitudinalement. Laver le côlon en secouant vigoureusement dans du PBS glacé dans une boîte de Pétri stérile.
  7. Coupez le tissu du côlon en morceaux d'environ 1 cm de long à l'aide d'un scalpel ou des ciseaux stériles.
  8. Enregistrer le poids des pièces du côlon.
    NOTE: Toutes les étapes de la section 1 peuvent être effectuées soit à l'intérieur ou à l'extérieur d'une enceinte de sécurité biologique. Une fois que les deux points sont prêts pour la culture, toutes les étapes doivent être effectuées à l'intérieur d'une enceinte de sécurité biologique pour maintenir la stérilité.

2. Colon Orgune culture

  1. Placer un tamis cellulaire (100 um) sur une plaque de culture cellulaire à 6 puits. Transférer toutes les pièces du côlon collectées à partir d'une souris dans le tamis cellulaire.
  2. Ajouter 5 ml de milieu DMEM / F12 contenant 5% de FBS, de pénicilline-streptomycine (1x) et de la gentamycine (20 pg / ml). Couvrir complètement les morceaux du côlon avec les médias.
  3. Incuber pendant 2 heures à 37 ° C dans un incubateur avec 5% de CO2 et 95% d' air.
  4. Soulevez le filtre cellulaire et aspirer les médias.
  5. Placez le tamis cellulaire de retour sur le puits et ajouter 5 ml du milieu frais sans antibiotiques. Soulevez le filtre cellulaire et aspirer les médias.
  6. Répétez l'étape précédente de lavage (étape 2.5) deux fois (3x totale) pour éliminer tous les antibiotiques résiduels.
  7. Transférer les morceaux du côlon d'un seul tamis cellulaire en un seul puits d'une plaque à 12 puits de culture cellulaire stérile.
  8. Ajouter moyen / F12 DMEM contenant 5% de FBS (sans antibiotiques). Réglez le volume du milieu avec le weight des pièces du côlon, par exemple, 1 ml de milieu pour 100 mg de tissu. Incuber pendant 12 heures à 37 ° C dans un incubateur à injecter 5% de CO2 et 95% d' air.
  9. Recueillir le surnageant de culture dans un tube stérile de 1,5 ml.
  10. Centrifuger à 12 000 xg à 4 ° C pendant 5 min. Séparer le surnageant dans un nouveau tube de 1,5 ml pour une utilisation dans le dosage tuant des bactéries et / ou d'autres tests immunitaires. Le surnageant peut être conservé à -80 ° C jusqu'au moment du dosage.
  11. Ramassez les morceaux du côlon dans un tube pour l'isolement de l'ARN.

3. E. coli Tuer Assay

  1. Inoculer E. coli dans 5 ml de milieu Luria-Bertani (LB) dans un tube de 15 ml et on incube à 37 ° C sous agitation à 200 tours par minute pendant une nuit. Gardez le bouchon du tube de culture un peu lâche.
  2. Centrifuger le tube de culture bactérienne à 1200 xg pendant 10 min à 4 ° C. Retirer le surnageant et remettre en suspension le culot bactérien dans du PBS 5 ml glacée.
  3. Le transfert de 1 mL de la bactsuspension erial dans une cuvette et mesure DO à 600 nm. Utilisez PBS comme un blanc.
  4. Calculer l'unité de formation de colonies (cfu) en utilisant une courbe étalon prédéterminée. Ici, on suppose que 1 DO = 2 x 10 9 ufc / ml (environ).
  5. Diluer la suspension bactérienne pour rendre la suspension 1 x 10 5 ufc / mL.
  6. Transférez l'organe du côlon surnageant de culture (500 pl / puits) ont été recueillies dans la section 2.10 dans des puits en double d'une plaque de culture cellulaire de 24 puits.
  7. Ajouter 10 ul E. coli culture (1000 ufc) dans un puits contenant 500 pi organe du côlon surnageant de culture. Laisser l'autre puits sans inoculation de E. coli pour confirmer que l'organe du côlon surnageant de culture ne contient aucune contamination.
  8. Incuber le même nombre de bactéries (1000 ufc) dans le milieu de culture (DMEM / F12 plus 5% de FBS) sans antibiotiques en tant que témoin.
  9. Incuber à 37 ° C pendant 1 h.
  10. Placer 50 ul de chaque échantillon goutte-wisoi sur des plaques de gélose MacConkey. Incuber les plaques de gélose MacConkey à 37 ° C pendant une nuit.
  11. Compter le nombre de colonies et de calculer le ufc / ml.

4. L'effet des facteurs extrinsèques et intrinsèques sur colique antimicrobiens hôtes Réponses de la défense

NOTE: L'essai de destruction antimicrobien tel que décrit ici peut être adoptée pour examiner l'effet des modèles de pathogènes associés moléculaires (PAMP) et des cytokines sur l'activité bactéricide de la culture d'organe surnageant. Un exemple d'une telle expérience en utilisant l'IL-1β et IL-18 est décrit ci-dessous.

  1. Recueillir côlons de souris comme décrit dans la section 1.
  2. Placez le côlon sur une serviette en papier stérile. Couper le côlon longitudinalement en trois parties avec des ciseaux (figure 2).
  3. Laver chaque partie du côlon dans le froid de la glace PBS comme décrit dans la section 1.
  4. Couper chaque partie du côlon en petits morceaux et peser de façon aseptique. Transférer les morceaux de chaque partiedu côlon en trois crépines de cellules séparées (100 um) placées sur trois puits d'une plaque de culture cellulaire à 6 puits (figure 2).
  5. Ajouter 2 ml de milieu DMEM / F12 contenant 5% de FBS, de pénicilline-streptomycine (1x) et de la gentamycine (20 pg / ml).
  6. Incuber pendant 2 heures à 37 ° C dans un incubateur à injecter 5% de CO2 et 95% d' air.
  7. Laver les morceaux du côlon comme décrit dans 2,4-2,6. Transférer les morceaux du côlon d'un seul tamis cellulaire en un seul puits d'une plaque à 12 puits de culture cellulaire stérile. Les trois puits contenant au moins trois parties du côlon d'une souris unique devraient être désignés comme non traités, l' IL-1β et IL-18 (Figure 2).
  8. Ajouter moyen / F12 DMEM contenant 5% de FBS (sans antibiotiques). Ajuster le volume du milieu avec le poids des pièces du côlon, par exemple, 1 ml de milieu pour 100 mg de tissu.
  9. Stimuler la culture d'organes du colon avec de l'IL-1β (20 ng / ml) ou IL-18 (20 ng / mL) pendant 12 h. Le côlon non traité culture d'organe sert de témoin.
  10. Après 12 h d' incubation à 37 ° C dans un incubateur à injecter 5% de CO 2 et 95% d' air, recueillir le surnageant de culture dans un tube stérile de 1,5 ml.
  11. Transférer 500 ul de surnageant de culture dans des puits en double d'une plaque de 24 puits.
  12. Inoculer E. coli (1000 ufc) dans l' organe du côlon surnageant de culture comme décrit dans la section 3. Pour chaque condition, ensemencer E. coli dans un seul puits. L'autre puits contenant même organe surnageant de culture sans E. coli servira de contrôle de la contamination bactérienne.
  13. Incuber la même quantité de bactéries dans les milieux de culture sans antibiotiques comme témoin.
  14. Incuber à 37 ° C pendant 1 h.
  15. Placer 50 ul de chaque goutte à goutte sur des plaques de gélose MacConkey échantillon. Incuber les plaques de gélose MacConkey pour la nuit à 37 ° C.
  16. Compter le nombre de colonies et de calculer le ufc / ml (Figure 4).
e_title "> 5. Mesure de l'expression des gènes antimicrobiens

  1. Après une nuit d'incubation (12 h) de la culture d'organes colique comme décrit dans les sections 2 et 4, laver les pièces du côlon avec 2 ml PBS glacé (2x).
  2. Ramassez les morceaux du côlon dans un tube à vis de bouchon libre 2 mL RNase / DNase. Placer les tubes sur la glace.
  3. Ajouter 1 ml de réactif Trizol commerciale et de lyser des billes de matrice dans le tube.
  4. Lyser le tissu à l'aide d'un homogénéiseur tissulaire automatisé.
  5. Collecter le lysat de tissu dans un nouveau tube de microcentrifugeuse.
  6. Isoler ARN en utilisant le protocole standard.
  7. Mesurer la concentration en ARN.
  8. Diluer l'ARN de manière appropriée avec de l'eau déminéralisée et utiliser 500 ng d'ARN pour synthétiser l'ADNc.
  9. Utiliser l'ADNc de l'analyse en temps réel RT-PCR des gènes cibles antimicrobiens, des cytokines, des chimiokines, et d'autres gènes d'intérêt.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Une image représentative de colons dans la culture d'organe est représenté sur la figure 1. Les morceaux du côlon dans la culture restent métaboliquement et physiologiquement actif. Ils répondent efficacement aux stimuli ajoutés aux milieux de culture exogènes. Un flux de travail schématique de la préparation du tissu du côlon pour culture ex vivo et d'une stimulation par des stimuli exogènes, par exemple l' IL-1β et IL-18, est représenté sur la figure 2. Les données représentatives de la figure 3 montrent que deux - points dans la culture d'organes expriment des peptides antimicrobiens tels que les β-défensines 2 (BD2), Reg3γ, S100A8, S100A9 et iNOS en réponse à l' IL-1β et de l' IL-18.

Les médiateurs libérés par les implants du côlon présentent un effet létal antimicrobienne tel que démontré par la croissance significativement réduit d ' E. coli mis en incubation avec le surnageant de culture d'organes ( 4B). Une telle activité de destruction de E. coli est en outre potentialisée par la stimulation de l' IL-1β et IL-18 (Figures 4A et 4B). Colon surnageants de culture d'organe mis en incubation sans E. coli ne présentent pas de croissance bactérienne suivant la culture sur de la gélose MacConkey (figures 4C et 4D). Ces résultats suggèrent en outre que l'inflammasome joue un rôle important dans la défense de l'hôte antimicrobien intestinal.

Dans l' ensemble, les données présentées ici suggèrent que la culture d'organes colique ex vivo est une technique très utile pour étudier les réponses immunitaires intestinales antimicrobiennes in vitro.

GAPDH_F TGGCAAAGTGGAGATTGTTGCC
GAPDH_R AAGATGGTGATGGGCTTCCCg
β-défensines 2 (BD2) _F TGACCACTGCCACACCAATG
β-défensines 2 (BD2) _R CCTGGCAGAAGGAGGACAAA
Reg3γ_F CAAGGTGAAGTTGCCAAGAA
Reg3γ_R CCTCTGTTGGGTTCATAGCC
S100a8_F TGTCCTCAGTTTGTGCAGAATATAAA
S100a8_R TCACCATCGCAAGGAACTCC
S100a9_F GGTGGAAGCACAGTTGGCA
S100a9_R GTGTCCAGGTCCTCCATGATG
iNOS_F TGTGACACACAGCGCTACAACA
iNOS_R GAAACTATGGAGCACAGCCACAT

Tableau 1: Liste des amorces de souris pour la PCR en temps réel.


Figure 1: image représentant des morceaux du côlon de la souris dans la culture. (A) L' incubation des morceaux du côlon sur un tamis cellulaire (100 um) placée sur une plaque à 6 puits. morceaux de Colon sont immergés dans 2 milieux de culture mL complété avec des antibiotiques. (B) Après 2 heures d' incubation, des morceaux du côlon sont transférés dans le puits d'une nouvelle plaque de 12 puits de culture cellulaire contenant un milieu exempt d' antibiotiques. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 2
Figure 2: Représentation schématique des étapes de la préparation des tissus du côlon et de la stimulation ex vivo avec l' IL-1β et IL-18. Le côlon d'une souris est longi tudinally disséqués en trois parties. Chaque partie a été coupée en petits morceaux et pesé. Les morceaux du côlon à partir de chaque section du côlon sont transférées sur des crépines de cellules placées sur les puits d'une plaque à 6 puits contenant 2 ml de milieu DMEM / F12 plus 5% de FBS et des antibiotiques. Suite à une incubation de 2 h, les pièces du côlon d'un seul tamis cellulaire sont transférés dans un seul puits d'une plaque de culture cellulaire à 12 puits. DMEM / F12 plus 5% de FBS (pas d'antibiotiques) est ajouté dans chaque puits et le volume du milieu est ajustée en fonction du poids du tissu (1 ml de milieu pour 100 mg de tissu). les tissus du côlon sont stimulées par l'IL-1β (20 ng / ml) et de l'IL-18 (20 ng / ml) pendant 12 h. Les surnageants de culture sont centrifugés et utilisées pour tuer E. Coli dosage et / ou d' autres tests immunitaires. Les tissus du côlon sont rassemblés dans le réactif de trypsine commerciale pour l'isolement de l'ARN et les analyses ultérieures de l'expression des gènes antimicrobiens par PCR en temps réel..jpg "target =" _ blank "> S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

figure 3
Figure 3: les tissus du côlon de souris expriment des cytokines et des peptides antimicrobiens , en réponse à l' IL-1β ou IL-18 au cours de culture ex vivo. des cultures d'organes du côlon ont été stimulées par l'IL-1β (20 ng / ml) ou IL-18 (20 ng / ml) pendant 12 h. L'expression de la BD2 Reg3γ, S100A8, S100A9, et iNOS a été mesurée en temps réel RT-PCR (tableau 1). Les données représentent des moyennes ± SD; * P <0,05, ** p <0,01. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 4
Figure 4: Surnageant de souris culte d'orgue du côlonure présente une activité bactéricide. Des morceaux du côlon ont été cultivées ex vivo en présence ou en absence d'IL-1β (20 ng / ml) ou IL-18 (20 ng / mL) pendant 12 h. 500 ul des surnageants de culture ont été incubés avec E. coli (1.000 CFU) pendant 1 heure à 37 ° C. Colon organe surnageant de culture sans E. coli a également été incubé comme témoin. Suite à une heure d'incubation, 50 ul de chaque échantillon a été placé goutte à goutte sur des plaques de gélose MacConkey et on fait incuber à 37 ° C pendant une nuit. (A) Image de colonies de E. coli sur gélose MacConkey montrant une activité antimicrobienne de la culture d'organes du côlon. (B) de E. coli montrant le nombre de tuer l' efficacité de l' IL-1β- et l' IL-18 traitée surnageant de culture d'organes du côlon. (C) Image de MacConkey plaque de gélose montrant aucune croissance bactérienne dans la culture d'organes du côlon incubé sans E. coli. (D) n colonies E. coli ont été identifiés dans le côlon organe cULTURE mis à incuber sans bactérie E. coli, ce qui indique l'absence de toute contamination bactérienne dans l'échantillon. Les données représentent des moyennes ± SD; ** P <0,01, *** p <0,001. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Les cellules épithéliales intestinales sont très sensibles en termes de leurs besoins de croissance et donc difficile à la culture. Les cellules épithéliales isolées par traitement à l' EDTA ne survivent pas dans un milieu de culture cellulaire classiques tels que le DMEM 8. Par conséquent, les études d'interaction hôte-pathogène en utilisant crypt isolées ou les cellules épithéliales primaires sont très difficiles. Récemment, Sato et al. décrit un système de culture organoide crypte qui est très prometteuse et utile pour les études liées à la physiopathologie intestinale 13. Alors que organites représentent de nombreuses caractéristiques de la crypte intestinale, il y a des préoccupations quant à savoir si les réponses immunitaires des cellules organoïdes, qui sont cultivées dans un environnement stérile, récapitulent les réponses des cellules épithéliales intestinales in vivo. Les techniques précises qui sont nécessaires pour l'isolement et la culture des cellules souches épithéliales et les besoins des réactifs coûteux pour la culture des organites empêchent malaboratoires ny de prendre avantage de ce système. Bien que l'utilisation de culture ex vivo d'organes ne sont pas une alternative à la culture organoide, ce système offre une méthode simple et peu coûteuse pour étudier les réponses antimicrobiennes de l' épithélium intestinal.

L'avantage majeur de cette technique est que l'architecture tissulaire de l'intestin est maintenue pendant la mise en culture dans les plats. Nous avons observé que les tissus du côlon sont physiologiquement actif pendant au moins 24 h après leur culture. Au cours de la culture du côlon, les cellules épithéliales du côlon réagissent à des stimuli exogènes, telle que mesurée par l'expression de cytokines et de peptides antimicrobiens. La viabilité des cellules épithéliales du tissu intact peut être encore améliorée par l'addition de facteurs et des inhibiteurs de la mort cellulaire croissance appropriées dans le milieu de culture. Des rapports antérieurs suggèrent que l'organe normal des tissus du côlon humain pourrait être maintenu ex vivo pendant plusieurs jours 8 sup>, 23, 24.

Le protocole pour la culture ex vivo d' un organe colique de souris peut avoir de nombreuses applications dans des études relatives à des réponses immunitaires antimicrobiennes de l'épithélium intestinal. Les agents pathogènes et leurs PAMP sont reconnus par PRRs tels que les récepteurs Toll-like (TLR) et les récepteurs NOD-like (NLR) présents dans les cellules épithéliales et immunitaires. l'expression et la fonction de nombreux TLR et NLR défectueux sont associés à la susceptibilité aux MICI, la tumorigenèse colorectal, et les infections bactériennes. Depuis des lignées de cellules épithéliales immortalisées ne représentent pas toutes les caractéristiques de la niche intestinale, vivo culture l'ex organe du côlon est un outil expérimental très utile. Grâce à ce système, nous pouvons examiner l'effet de divers PAMP ou stimuli sur l'induction de molécules effectrices antimicrobiens dans les cellules épithéliales intestinales. Dans l'expérience représentative, nous avons montré que les cytokines aimentIL-1β et IL-18 déclenchement de l'expression des peptides antimicrobiens (figure 3). Nous montrons ici aussi que les peptides antimicrobiens produits par les tissus du côlon peuvent effectivement tuer E. coli (Figure 4). Ces techniques peuvent être appliquées pour tester l'influence de lipopolysaccharide (LPS), le peptidoglycane (PGN), muramyldipeptide (MDP), et d'autres PAMP dans les réponses antimicrobiennes de défense de l'hôte dans l'intestin.

Le protocole de culture d'organes du côlon , comme décrit précédemment 12, 16, 20, 25 nous avons légèrement modifié. On a cultivé le côlon en deux phases. Dans un premier temps, on incube le tissu du côlon chez les antibiotiques contenant du milieu pendant 2 h. Nous avons ensuite retiré les antibiotiques avec des lavages répétés des pièces du côlon, suivie d'une incubation avec des milieux sans antibiotiques. Ainsi, le surnageant de culture obtenu à partir de culture de nuit de laexpositions du côlon que l'effet des peptides antimicrobiens sécrétées quand incubé avec E. coli. Cette approche peut être utilisée pour voir l'effet bactéricide du côlon ou de l'intestin dérivé des peptides antimicrobiens sur les bactéries d'intérêt. Un milieu agar sélectif approprié doit être utilisé pour la culture des bactéries.

Comme la plupart des techniques, il existe des limitations de l'ex vivo système de culture d'organe. Premièrement, contrairement à la culture cellulaire ou de la culture organoide, les organes ne se développent pas et prolifèrent et ne peuvent donc être étendues. Deuxièmement, les cellules épithéliales intestinales sont très sensibles et ils meurent relativement rapidement sans facteurs de croissance supplémentaires et des inhibiteurs de l'apoptose, qui sont utilisés pour la culture organoïde crypte. En troisième lieu, la réponse immunitaire observée à partir de la culture d'organe est une réponse collective des différents types de populations cellulaires. Par conséquent, le rôle de l'individu type cellulaire dans l'expression de gènes effecteurs antimicrobiens et ne peut pas être évaluée. additionnellement, contrairement à des lignées cellulaires et culture organoïde, l'expression des peptides antimicrobiens et d'autres molécules effectrices dans les côlons peut varier d'une souris à du même arrière-plan génétique.

En résumé, nous décrivons ici un protocole simple pour la culture d'organes colique ex vivo qui est très utile pour étudier les réponses immunitaires antimicrobiennes intestinales. Cette approche peut être utilisée pour tester le rôle de divers gènes immunitaires innées dans l'expression des peptides antimicrobiens par culture côlons de souris mutantes génétique d'intérêt. En outre, ce protocole peut être adapté pour une utilisation dans des études cliniques pour examiner les réponses antimicrobiennes intestinale des patients atteints de MII en procédant à la culture d'organes des échantillons de biopsie du côlon.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgements

Ce travail a été soutenu par un financement de la maladie de Crohn et la colite Foundation of America, (CCFA; 3711) la prévention du cancer et de l'Institut de recherche du Texas (CPRIT; RP160169) et UT Southwestern Medical Center donnés à MHZ

Materials

Name Company Catalog Number Comments
Advanced DMEM/ F12 Life Technologies 12634-010
Dulbecco's phosphate buffered saline, modified, w/o Calcium chloride & Magnesium chloride Sigma 5634
FBS, heat inactivated Sigma F4135
Penicillin-Streptomycin Life Technologies 15070063
Gentamicin solution Sigma G1272
Mouse IL-1b recombinan Reprokine RKP10749
Mouse IL-18 recombinant Reprokine RKP70380
TRIzol Reagent Thermo Fisher Scientific 15596018
Difco Luria-Bertani Broth  BD Bioscience 244620
BD Difco Dehydrated Culture Media: MacConkey Agar Fisher Scientific DF0075-17-1
NanoDrop 1000 Spectrophotometer Thermo Scientific Uded to measure RNA concentration
UV/Vis Spectrophotometer BECKMAN DU 530 Used to determine E. coli count
iScript RT Supermix, 100 rxns Bio-Rad 1708841
iTaq Univer SYBR Green Supermix  Bio-Rad 1725125 
Lysing Matrix S (1/8"), 2 ml Tube MP Biomedicals 116925500 Used to homgenize colon organ for RNA isolation
FastPrep-24 5G System Bio-Rad 116005500
100 mm x 15 mm Petri Dish Falcon 5687
Plate 6 well ps TC CS100, Cellstar, 6w, tc, F-bottom (Flat), w/lid, sterile Cellstar 5085
100 μm cell strainer Falcon 5698
Sorvall Legend Micro 21R Centrifuge Thermo Fisher Scientific
Sorvall ST40R Centrifuge Thermo Fisher Scientific
Forma Scientific orbital shaker Thermo Fisher Scientific

DOWNLOAD MATERIALS LIST

References

  1. Maloy, K. J., Powrie, F. Intestinal homeostasis and its breakdown in inflammatory bowel disease. Nature. 474, 298-306 (2011).
  2. Hooper, L. V., Macpherson, A. J. Immune adaptations that maintain homeostasis with the intestinal microbiota. Nat Rev Immunol. 10, 159-169 (2010).
  3. Vaishnava, S., Behrendt, C. L., Ismail, A. S., Eckmann, L., Hooper, L. V. Paneth cells directly sense gut commensals and maintain homeostasis at the intestinal host-microbial interface. Proc Natl Acad Sci U S A. 105, 20858-20863 (2008).
  4. Kamada, N., Chen, G. Y., Inohara, N., Nunez, G. Control of pathogens and pathobionts by the gut microbiota. Nat Immunol. 14, 685-690 (2013).
  5. Wu, H. J., Wu, E. The role of gut microbiota in immune homeostasis and autoimmunity. Gut Microbes. 3, 4-14 (2012).
  6. Zimmerman, N. P., Vongsa, R. A., Wendt, M. K., Dwinell, M. B. Chemokines and chemokine receptors in mucosal homeostasis at the intestinal epithelial barrier in inflammatory bowel disease. Inflamm Bowel Dis. 14, 1000-1011 (2008).
  7. Elliott, D. E., Siddique, S. S., Weinstock, J. V. Innate immunity in disease. Clin Gastroenterol Hepatol. 12, 749-755 (2014).
  8. Chopra, D. P., Dombkowski, A. A., Stemmer, P. M., Parker, G. C. Intestinal epithelial cells in vitro. Stem Cells Dev. 19, 131-142 (2010).
  9. Autrup, H. Explant culture of human colon. Methods Cell Biol. 21, 385-401 (1980).
  10. Qin, J., et al. A human gut microbial gene catalogue established by metagenomic sequencing. Nature. 464, 59-65 (2010).
  11. Wildenberg, M. E., vanden Brink, G. R. A major advance in ex vivo intestinal organ culture. Gut. 61, 961-962 (2012).
  12. Leushacke, M., Barker, N. Ex vivo culture of the intestinal epithelium: strategies and applications. Gut. 63, 1345-1354 (2014).
  13. Sato, T., et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459, 262-265 (2009).
  14. Tsilingiri, K., et al. Probiotic and postbiotic activity in health and disease: comparison on a novel polarised ex-vivo organ culture model. Gut. 61, 1007-1015 (2012).
  15. Haque, A., et al. Early interactions of Salmonella enterica serovar typhimurium with human small intestinal epithelial explants. Gut. 53, 1424-1430 (2004).
  16. Hicks, S., Candy, D. C., Phillips, A. D. Adhesion of enteroaggregative Escherichia coli to pediatric intestinal mucosa in vitro. Infect Immun. 64, 4751-4760 (1996).
  17. Knutton, S., Lloyd, D. R., Candy, D. C., McNeish, A. S. In vitro adhesion of enterotoxigenic Escherichia coli to human intestinal epithelial cells from mucosal biopsies. Infect Immun. 44, 514-518 (1984).
  18. Senior, P. V., Pritchett, C. J., Sunter, J. P., Appleton, D. R., Watson, A. J. Crypt regeneration in adult human colonic mucosa during prolonged organ culture. J Anat. 134, 459-469 (1982).
  19. Smollett, K., Shaw, R. K., Garmendia, J., Knutton, S., Frankel, G. Function and distribution of EspG2, a type III secretion system effector of enteropathogenic Escherichia coli. Microbes Infect. 8, 2220-2227 (2006).
  20. Bareiss, P. M., et al. Organotypical tissue cultures from adult murine colon as an in vitro model of intestinal mucosa. Histochem Cell Biol. 129, 795-804 (2008).
  21. Tsilingiri, K., Sonzogni, A., Caprioli, F., Rescigno, M. A novel method for the culture and polarized stimulation of human intestinal mucosa explants. J Vis Exp. e4368 (2013).
  22. Hu, S., et al. The DNA Sensor AIM2 Maintains Intestinal Homeostasis via Regulation of Epithelial Antimicrobial Host Defense. Cell Rep. 13, 1922-1936 (2015).
  23. Moorghen, M., Chapman, M., Appleton, D. R. An organ-culture method for human colorectal mucosa using serum-free medium. J Pathol. 180, 102-105 (1996).
  24. Dame, M. K., et al. Human colon tissue in organ culture: preservation of normal and neoplastic characteristics. In Vitro Cell Dev Biol Anim. 46, 114-122 (2010).
  25. Grant, A. J., Woodward, J., Maskell, D. J. Development of an ex vivo organ culture model using human gastro-intestinal tissue and Campylobacter jejuni. FEMS Microbiol Lett. 263, 240-243 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Video Stats