o

Published 2/13/2017
0 Comments
  CITE THIS  SHARE 
Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





By clicking "Submit", you agree to our policies.

 

Summary

Cite this Article

Copy Citation

Udden, S. M., Waliullah, S., Harris, M., Zaki, H. The Ex Vivo Colon Organ Culture and Its Use in Antimicrobial Host Defense Studies. J. Vis. Exp. (120), e55347, doi:10.3791/55347 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

O intestino tem uma arquitectura de estruturas cripta repetitivas que consistem em diferentes tipos de células epiteliais, lâmina própria contendo células do sistema imunológico, e estroma. Todas estas células heterogéneas contribuem para a homeostase intestinal e participar na defesa do hospedeiro antimicrobiana. Portanto, a identificação de um modelo substituto para estudar a resposta imune e atividade antimicrobiana do intestino em um ambiente in vitro é extremamente desafiador. Os estudos in vitro utilizando linhas de células epiteliais do intestino imortalizadas ou cripta mesmo primária organ�de cultura não representam a fisiologia exata do intestino normal e seu microambiente. Aqui, nós discutimos um método de cultura de tecido do cólon do rato numa placa de cultura e como este sistema de cultura ex vivo de órgãos pode ser implementado em estudos relacionados com as respostas de defesa do hospedeiro antimicrobianos. Em experiências representativas, que mostrou que dois pontos em cultura de órgão expressar peptídeos antimicrobianos em response de IL-1β e IL-18. Além disso, as moléculas efectoras antimicrobianos produzidos pelos tecidos do cólon em cultura de órgãos a matar eficientemente Escherichia coli in vitro. Esta abordagem, portanto, pode ser utilizada para dissecar o papel de padrões moleculares pathogen- e associada ao perigo e os seus receptores celulares na regulação de respostas imunes inatas intestinais e as respostas de defesa do hospedeiro antimicrobianos.

Introduction

O intestino representa um sistema dinâmico, que actua como uma barreira para os microrganismos comensais, luta contra os agentes patogénicos invasores, e regula a composição microbiana 1. As células epiteliais do intestino, que consiste em enterócitos, células caliciformes, células de Paneth e células enteroendócrinas, são as principais populações de células que fornecem respostas de defesa do hospedeiro contra a microbiota intestinal. As células caliciformes produzir mucinas que criam uma zona desmilitarizada na parte superior da camada epitelial 2. As células de Paneth e enterócitos produzem peptídeos antimicrobianos, citocinas e espécies de oxigênio e nitrogênio reativos que constituem respostas de defesa do hospedeiro antimicrobianos e contribuir para a definição da composição microbiana intestinal 3, 4. Em adição às células epiteliais, as células do sistema imunológico, incluindo macrófagos, células dendríticas, neutrófilos, células assassinas naturais, os linfócitos e inna células linfóides te na lâmina própria e submucosa desempenhar um papel crítico na resposta de defesa do hospedeiro antimicrobianos intestinais pela produção de citocinas, quimiocinas e outros mediadores 5 - 7. A fim de compreender como o sistema imune da mucosa regula microbiota e fornece protecção contra a infecção microbiana, é importante considerar a interação complexa entre as populações de células heterogéneas do intestino. No entanto, um modelo in vitro que engloba todas as características do intestino não está disponível. Portanto, os estudos moleculares sobre a interação patógeno-hospedeiro no intestino são altamente desafiador.

Ao longo dos últimos anos, vários sistemas modelo que mimetizam aspectos da mucosa intestinal tem sido desenvolvido para investigar os processos patofisiológicos envolvidos em doenças inflamatórias do intestino (IBD) e outras desordens gastrointestinais 8 -= "xref"> 14. linhas de células epiteliais intestinais imortalizadas são muitas vezes usadas para estudar as respostas específicas de células epiteliais. No entanto, por causa da expressão diferencial de genes e função de células imortalizadas, os dados obtidos a partir de células usando esses muitas vezes não coincidir com os observados em estudos in vivo. Cripta intestinal organ�de cultura surgiu recentemente como um potencial instrumento para avaliar a resposta do epitélio intestinal a diferentes estímulos 13. Neste sistema, as células estaminais criptas são deixadas a crescer e a desenvolver uma estrutura organ�de 3D. Enquanto o sistema de cultura organ�de é muito útil para estudar muitos aspectos do epitélio intestinal, ele não imitam o complexo interacção de células do sistema imunológico, células epiteliais e produtos microbianos. A cultura ex vivo do tecido intestinal oferece uma melhor representação in vivo de respostas de defesa do hospedeiro. Neste método, uma parte do intestino é cultivada numa placa de cultura de células with meios adequados que permitem que os diferentes tipos de populações de células no intestino para ser metabolicamente activa durante pelo menos 48 h. Assim, uma cultura ex vivo do órgão pode ser utilizado para medir a expressão de genes antimicrobianos e as respostas de defesa do hospedeiro do intestino a um estímulo específico.

Os investigadores têm vindo a utilizar o sistema de cultura ex vivo de órgãos para estudar as respostas de defesa do hospedeiro contra a infecção microbiana no intestino 15-21. Nós recentemente adoptado o sistema de cultura de órgãos para estudar o papel da inflammasome nas respostas de defesa do hospedeiro antimicrobianos em dois pontos do rato 22. O inflamassoma é uma plataforma molecular para a activação de caspase-1, o que é necessário para a produção de IL-1β amadurecido e IL-18. Mostrámos que a IL-1β e IL-18 induzem péptidos antimicrobianos que matam eficazmente pathobionts comensais, tais como E. coli E. coli em dois pontos do rato inflammasome defeituoso 22. Este sistema, por conseguinte, pode ser utilizado para estudar o papel de receptores de reconhecimento de padrões (PRRs) e outras moléculas imunitárias inatas em respostas de defesa do hospedeiro antimicrobianos intestinais, bem como patogénese de desordens intestinais, tais como doença inflamatória do intestino (IBD) e cancro colorrectal (CRC). Existem mais de 200 genes de susceptibilidade, IBD e mutações em muitos destes genes estão associados com a composição microbiana alterada no intestino. É de grande importância clínica para determinar o mecanismo preciso através do qual os genes de susceptibilidade IBD-regular a flora intestinal. O objectivo geral do presente método é a introdução de um protocolo básico de cultura de órgãos ex vivo do cólon e demonstrar como este método de cultura pode ser usado para estudar as respostas de defesa do hospedeiro antimicrobianos do intestino.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Todos os experimentos aqui descritos foram realizados utilizando camundongos 6-8 semanas de idade do sexo masculino de tipo selvagem (C57BL6 / J) mantido em um free (SPF) instalação de patógenos específicos no Centro de Recursos Animal (ARC), UT Southwestern Medical Center. Todos os estudos foram aprovados pelo Comitê Institucional de Animal Care and Use (IACUC) e foram conduzidos de acordo com as diretrizes IACUC e do National Institutes of Health Guide para o Cuidado e Uso de Animais de Laboratório.

1. Recolha e Preparação do Colon

  1. Eutanásia ratos com asfixia com CO 2, seguida por deslocação cervical.
  2. Spray de ratos com 70% de etanol e fixá-membros a uma placa prendendo mantendo lado o rato dorsal para baixo no tabuleiro.
  3. Usando tesouras e pinças pré-esterilizados dissecando, fazer uma incisão na linha média no peritônio do abdômen. Abra o abdómen dobrando o peritônio com uma pinça.
  4. Remover o intestino a partir da cavidade abdominal with dissecando pinça e tesouras. Separa-se o cólon a partir do intestino delgado através do corte na parte inferior do ceco e a outra extremidade no recto.
  5. Colocar o cólon numa placa de Petri estéril contendo PBS gelado. Lavar o conteúdo do lúmen do cólon com PBS arrefecido em gelo, utilizando uma seringa de 20 ml que prende uma agulha G 20 ou uma agulha de gavagem oral até que as fezes no interior do lúmen do cólon é completamente removido.
  6. Corte do cólon com uma tesoura longitudinalmente. Lavar o cólon, mediante agitação vigorosa em PBS arrefecido com gelo numa placa de Petri estéril.
  7. Corte o tecido do cólon em pedaços de aproximadamente 1 cm de comprimento, utilizando um bisturi ou tesoura estéril.
  8. Registar o peso das peças do cólon.
    NOTA: Todas as etapas na Seção 1 pode ser realizada dentro ou fora de uma cabine de segurança biológica. Uma vez que dois pontos estão prontos para a cultura, todas as etapas devem ser executadas dentro de uma cabine de segurança biológica para manter a esterilidade.

2. Colon Orguma Cultura

  1. Coloque um filtro celular (100 um) sobre uma placa de cultura celular de 6 poços. Transferir todas as peças do cólon recolhidos a partir de um rato para o filtro de células.
  2. Adicionar 5 ml de meio DMEM / F12 contendo FBS a 5%, penicilina-estreptomicina (1x), e gentamicina (20 ug / ml). Completamente cobrir os pedaços do cólon com a mídia.
  3. Incubar durante 2 horas a 37 ° C numa incubadora com 5% de CO 2 e 95% de ar.
  4. Levante o filtro de células e aspirar a mídia.
  5. Coloque o filtro de células de volta no bem e adicionar 5 ml meio fresco sem quaisquer antibióticos. Levante o filtro de células e aspirar a mídia.
  6. Repetir o passo de lavagem acima (Passo 2.5) duas vezes mais (total de 3x) para remover todos os antibióticos residuais.
  7. Transferir as peças do cólon a partir de um único filtro de células em um único poço de uma placa de cultura celular de 12 poços estéreis.
  8. Adicionar meio DMEM / F12 contendo FBS a 5% (sem antibióticos). Ajuste o volume do meio com o weigHT das peças do cólon, por exemplo, 1 ml de meio por 100 mg de tecido. Incubar durante 12 h a 37 ° C numa incubadora de injecção de 5% de CO 2 e 95% de ar.
  9. Recolhe-se o sobrenadante de cultura num tubo esterilizado de 1,5 mL.
  10. Centrifuga-se a 12000 xg, a 4 ° C durante 5 min. Separa-se o sobrenadante para um novo tubo de 1,5 mL para uso nas bactérias matando ensaio e / ou outros ensaios imunológicos. O sobrenadante pode ser armazenado a -80 ° C até o ensaio.
  11. Recolher as peças de cólon em um tubo para o isolamento de RNA

3. E. coli Ensaio Killing

  1. Inocular E. coli em 5 mL de meio de Luria-Bertani (LB) num tubo de 15 ml e incuba-se a 37 ° C com agitação a 200 rpm durante a noite. Mantenha a tampa do tubo de cultura levemente solto.
  2. Centrifuga-se o tubo de cultura bacteriana a 1.200 xg durante 10 min a 4 ° C. Remover o sobrenadante e ressuspender o sedimento de bactérias em 5 ml de PBS arrefecido com gelo.
  3. Transferir 1 ml do Bactsuspensão erial em uma OD cuvete e medida a 600 nm. Use PBS como branco.
  4. Calcula-se a unidade de formação de colónias (ufc) utilizando uma curva padrão predeterminada. Aqui, assumir que uma OD = 2 x 10 9 cfu / mL (aproximadamente).
  5. Dilui-se a suspensão bacteriana para fazer a suspensão de 1 x 10 5 CFU / mL.
  6. Transferir o sobrenadante de cultura do cólon órgão (500 ul / poço) recolhida na secção 2.10 em poços duplicados de uma placa de cultura celular de 24 poços.
  7. Adiciona-se 10 uL de cultura de E. coli (1000 cfu) para um poço contendo 500 uL do cólon sobrenadante da cultura de órgãos. Deixar o outro bem sem qualquer inoculação de E. coli para confirmar que o sobrenadante de cultura do cólon órgão não contém qualquer contaminação.
  8. Incubar o mesmo número de bactérias (1000 cfu) no meio de cultura (DMEM / F12 + 5% de FBS) sem quaisquer antibióticos como um controlo.
  9. Incubar a 37 ° C durante 1 h.
  10. Transferir 50 uL de cada amostra gota-wise em placas de ágar MacConkey. Incubar as placas de ágar de MacConkey a 37 ° C durante a noite.
  11. Contar o número de colónias e calcular a CFU / ml.

4. O efeito de fatores extrínsecos e intrínsecos no cólon Antimicrobianos respostas de defesa do hospedeiro

NOTA: O ensaio de morte antimicrobiano, tal como descrito aqui pode ser adoptada para examinar o efeito de padrões de agentes patogénicos associados moleculares (PAMPs) e citocinas sobre a actividade bactericida de sobrenadante de cultura de órgãos. Um exemplo de tal experiência usando IL-1β e IL-18 é descrita abaixo.

  1. Recolha dois pontos de camundongos como descrito na Seção 1.
  2. Coloque os dois pontos em uma toalha de papel estéril. Corte do cólon longitudinalmente em três partes com uma tesoura (Figura 2).
  3. Lave cada parte do cólon em PBS gelado como descrito na Seção 1.
  4. Corte cada parte do cólon em pedaços pequenos e pesam de forma asséptica. Transferir as peças de cada partedo cólon em três filtros celulares separadas (100 um) colocadas em três poços de uma placa de cultura de células de 6 poços (Figura 2).
  5. Adicionar 2 ml de meio DMEM / F12 contendo FBS a 5%, penicilina-estreptomicina (1x), e gentamicina (20 ug / ml).
  6. Incubar durante 2 horas a 37 ° C numa incubadora de injecção de 5% de CO 2 e 95% de ar.
  7. Lavam-se as peças do cólon tal como descrito no 2,4-2,6. Transferir as peças de cólon de um único filtro de células em um único poço de uma placa de cultura celular de 12 poços estéreis. Os três poços contendo três partes do cólon a partir de um único rato deve ser designado como não tratada, a IL-1β, e IL-18 (Figura 2).
  8. Adicionar meio DMEM / F12 contendo FBS a 5% (sem antibióticos). Ajustar o volume do meio com o peso das peças do cólon, por exemplo, 1 mL de meio por 100 mg de tecido.
  9. Estimular a cultura de órgãos cólon com IL-1β (20 ng / ml) ou IL-18 (20 ng / mL) durante 12 h. Os dois pontos não tratados cultura de órgãos serve como controlo.
  10. Após 12 h de incubação a 37 ° C numa incubadora de injecção de 5% de CO 2 e 95% de ar, recolher o sobrenadante da cultura em um tubo de 1,5 ml estéril.
  11. Transferir 500 uL de sobrenadante de cultura em poços duplicados de uma placa de 24 poços.
  12. Inocular E. coli (1.000 ufc) no cólon órgão sobrenadante de cultura, conforme descrito na Seção 3. Para cada condição, inocular E. coli em um único poço. A outra cavidade contendo sobrenadante de cultura de órgãos mesmo sem E. coli vai servir como um controlo para a contaminação bacteriana.
  13. Incubar a mesma quantidade de bactérias em meios de cultura sem nenhum antibiótico como um controlo.
  14. Incubar a 37 ° C durante 1 h.
  15. Coloque 50 mL de cada amostra gota a gota, em placas de ágar MacConkey. Incubar as placas de agar MacConkey para a noite a 37 ° C.
  16. Contar o número de colónias e calcular o CFU / mL (Figura 4).
e_title "> 5. Medição da expressão de genes antimicrobianos

  1. Após incubação durante a noite (12 h) de cultura de órgão do cólon tal como descrito nas secções 2 e 4, lavar as peças do cólon com 2 ml de PBS arrefecido com gelo (2x).
  2. Recolher as peças do cólon em um tubo livre com tampa de rosca 2 mL RNase / DNase. Colocar os tubos em gelo.
  3. Adicionar 1 ml de reagente Trizol comercial e lisar os grânulos da matriz para dentro do tubo.
  4. Lise do tecido utilizando um homogeneizador de tecido automatizada.
  5. Recolhe-se o lisado de tecido para um novo tubo de microcentrifugação.
  6. Isolar RNA usando o protocolo padrão.
  7. Medir a concentração de ARN.
  8. Diluir apropriadamente ARN com água desionizada e utilizar 500 ng de ARN para sintetizar ADNc.
  9. Usar o cDNA para a análise em tempo real de RT-PCR dos genes alvo antimicrobianas, citocinas, quimiocinas, e outros genes de interesse.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Uma imagem representativa de dois pontos em cultura de órgãos é mostrado na Figura 1. As peças do cólon na cultura permanecem metabolicamente e fisiologicamente ativa. Eles responder de forma eficiente aos estímulos exógenas adicionadas ao meio de cultura. Um fluxo da preparação do tecido do cólon para a cultura ex vivo e estimulação com estímulos exógenos, por exemplo, IL-1β e IL-18 de trabalho esquemática, é mostrado na Figura 2. Os dados representativos na Figura 3 mostram que os dois pontos em cultura de órgãos expressar péptidos antimicrobianos tais como β-defensina 2 (BD2), Reg3γ, S100A8, S100A9, e iNOS em resposta a IL-1β e IL-18.

Os mediadores libertados pelos implantes cólon exibem um efeito de morte antimicrobiana como demonstrado pelo crescimento significativamente reduzido de E. coli incubadas com o sobrenadante de cultura de órgãos ( 4B). Tal actividade de morte de E. coli é ainda mais potenciada pela estimulação de IL-1β e IL-18 (Figuras 4A e 4B). Colon sobrenadantes de cultura de órgãos incubados sem E. coli não mostram o crescimento de bactérias na sequência cultura em ágar MacConkey (Figuras 4C e 4D). Estes resultados sugerem ainda que o inflamassoma desempenha um papel importante na defesa do hospedeiro antimicrobiana intestinal.

No geral, os dados aqui apresentados sugerem que a cultura ex vivo de órgãos do cólon é uma técnica muito útil para estudar as respostas imunitárias intestinais antimicrobianos in vitro.

GAPDH_F TGGCAAAGTGGAGATTGTTGCC
GAPDH_R AAGATGGTGATGGGCTTCCCG
β-defensina 2 _F (BD2) TGACCACTGCCACACCAATG
β-defensina 2 _R (BD2) CCTGGCAGAAGGAGGACAAA
Reg3γ_F CAAGGTGAAGTTGCCAAGAA
Reg3γ_R CCTCTGTTGGGTTCATAGCC
S100a8_F TGTCCTCAGTTTGTGCAGAATATAAA
S100a8_R TCACCATCGCAAGGAACTCC
S100a9_F GGTGGAAGCACAGTTGGCA
S100a9_R GTGTCCAGGTCCTCCATGATG
iNOS_F TGTGACACACAGCGCTACAACA
iNOS_R GAAACTATGGAGCACAGCCACAT

Tabela 1: Lista de iniciadores de rato para PCR em tempo real.


Figura 1: imagem representativa das peças do mouse cólon na cultura. (A) Incubação de peças do cólon em um filtro celular (100 um) colocadas em uma placa de 6 poços. peças de cólon são submersos em 2 meios de cultura mL suplementado com antibióticos. (B) Após 2 h de incubação, as peças do cólon são transferidos para o poço de uma placa de cultura celular de 12 poços contendo meio novo antibióticos livres. Por favor clique aqui para ver uma versão maior desta figura.

Figura 2
Figura 2: Apresentação esquemática dos passos para a preparação de tecidos do cólon e a estimulação ex vivo com IL-1β e IL-18. Os dois pontos de um rato é longi tudinally dissecado em três partes. Cada parte foi cortada em pedaços pequenos e pesados. As peças do cólon a partir de cada secção do cólon são transferidas para filtros de células colocadas em poços de uma placa de 6 poços contendo 2 ml de meio DMEM / F12 mais 5% de FBS e antibióticos. Seguindo uma incubação de 2 h, pedaços de cólon de um único filtro de células são transferidos para um único poço de uma placa de cultura celular de 12 poços. DMEM / F12 mais 5% de FBS (sem antibióticos) é adicionado a cada poço e o volume do meio é ajustado de acordo com o peso do tecido (1 mL de meio por 100 mg de tecido). Colon tecidos são estimuladas com IL-1β (20 ng / ml) e IL-18 (20 ng / ml) durante 12 h. Os sobrenadantes de cultura são centrifugadas e usado para matar a E. coli de ensaio e / ou outros ensaios imunológicos. Os tecidos do cólon são coletados em reagente tripsina comercial para isolamento de RNA e análises subsequentes de expressão do gene antimicrobiano por PCR em tempo real..jpg "target =" _ blank "> Clique aqui para ver uma versão maior desta figura.

Figura 3
Figura 3: Mouse tecidos do cólon expressam citoquinas e péptidos antimicrobianos em resposta a IL-1β ou IL-18 durante a cultura ex vivo. culturas de órgãos de cólon foram estimuladas com IL-1β (20 ng / ml) ou IL-18 (20 ng / ml) durante 12 h. A expressão de BD2, Reg3γ, S100A8, S100A9, e iNOS foi medido pelo tempo real de RT-PCR (Tabela 1). Os dados representam médias ± DP; * P <0,05, ** p <0,01. Por favor clique aqui para ver uma versão maior desta figura.

Figura 4
Figura 4: sobrenadante de rato cult cólon órgãoure exibe actividade bactericida. Peças cólon foram cultivadas ex vivo na presença ou ausência de IL-1β (20 ng / ml) ou IL-18 (20 ng / mL) durante 12 h. 500 ul dos sobrenadantes de cultura foram incubados com E. coli (1000 cfu) durante 1 h a 37 ° C. Cólon órgão de sobrenadante da cultura de E. coli sem também foi incubada como um controlo. Após 1 h de incubação, 50 uL de cada amostra foi colocada, gota a gota em placas de agar MacConkey e incubado a 37 ° C durante a noite. (A) Imagem de E. coli colónias em agar MacConkey que mostram a atividade antimicrobiana da cultura cólon órgão. (B) número de E. coli que mostra a eficiência da matando-tratados com IL-18, IL-1β- e sobrenadante de cultura de órgão do cólon. (C) Imagem de MacConkey placa de ágar não mostrando nenhum crescimento bacteriano na cultura de cólon órgão incubada sem E. coli. (D) n colónias de E. coli foram identificados no cólon órgão Cultura incubadas sem E. coli, indicando a ausência de quaisquer bactérias contaminantes na amostra. Os dados representam médias ± DP; ** P <0,01, *** p <0,001. Por favor clique aqui para ver uma versão maior desta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

As células do epitélio intestinal são muito sensíveis em termos das suas necessidades de crescimento e, por conseguinte, difícil de cultura. As células epiteliais isoladas por tratamento com EDTA não sobrevivem no meio de cultura celular convencionais, tais como DMEM 8. Portanto, estudos de interação patógeno-hospedeiro usando cripta isolados ou células epiteliais primárias são muito desafiador. Recentemente, Sato et ai. descrito um sistema de cultura organ�de cripta, que é muito promissor e útil para estudos relacionados à fisiopatologia intestinal 13. Enquanto Organóides representam muitas características da cripta intestinal, existem preocupações quanto ao facto de as respostas imunitárias das células organ�de, que estão a ser cultivadas num ambiente estéril, recapitulam as respostas das células epiteliais do intestino in vivo. As técnicas precisas necessárias para isolamento e cultivo de células-tronco epiteliais e exigência de reagentes caros para a cultura de Organóides evitar malaboratórios de NY de tirar vantagem deste sistema. Enquanto o uso de cultura de órgãos ex vivo não é uma alternativa à cultura organ�de, este sistema oferece um método simples e barato para estudar as respostas anti-microbianos de epitélio intestinal.

A principal vantagem desta técnica é que a arquitectura do tecido do intestino é mantida enquanto a cultura nos pratos. Observou-se que os tecidos do cólon são fisiologicamente ativo por pelo menos 24 horas após a sua cultura. Durante a cultura do cólon, as células epiteliais do cólon responder a estímulos exógenos tal como medido pela expressão de citoquinas e péptidos antimicrobianos. A viabilidade das células epiteliais do tecido intacto pode ser ainda melhorada através da adição de factores de crescimento apropriadas e inibidores da morte celular no meio de cultura. Relatórios anteriores indicam que o órgão tecido colónico humano normal pode ser mantido ex vivo, durante vários dias 8 sup>, 23, 24.

O protocolo para a cultura ex vivo de rato órgão do cólon pode ter muitas aplicações em estudos relacionados à resposta imune antimicrobianos do epitélio intestinal. Os agentes patogénicos e os seus MMAPs são reconhecidos por PRRs tais como receptores semelhantes a Toll (TLRs) e receptores NOD-like (NLRs) presentes em células epiteliais e do sistema imunológico. expressão e função de muitos TLRs e NLRs com defeito estão associados com a susceptibilidade a IBD, tumorigênese colorretal e infecções bacterianas. Uma vez que as linhas celulares epiteliais imortalizadas não representam todas as características do nicho intestinal, a cultura ex vivo de órgãos do cólon é uma ferramenta muito útil experimental. Usando este sistema, pode-se examinar o efeito de diferentes estímulos MMAPs ou na indução de moléculas efectoras antimicrobianos nas células epiteliais intestinais. Na experiência representativa, mostrámos que as citocinas gostoIL-1β e IL-18 do gatilho a expressão de péptidos antimicrobianos (Figura 3). Também mostramos aqui que os péptidos antimicrobianos produzidos pelo tecido do cólon pode eficazmente matar E. coli (Figura 4). Estas técnicas podem ser aplicadas para testar a influência de lipopolissacarídeo (LPS), peptidoglicanos (PGN), muramyldipeptide (MDP), e outros MMAPs em respostas de defesa do hospedeiro antimicrobiano no intestino.

Temos ligeiramente modificada do protocolo de cultura de órgão do cólon tal como descrito anteriormente 12, 16, 20, 25. Nós cultivadas do cólon em duas fases. No primeiro, incubado a tecido do cólon em antibióticos contendo meio durante 2 h. Em seguida, removeu os antibióticos com repetidas lavagens das peças do cólon, seguido de incubação com antibióticos de mídia livre. Assim, o sobrenadante de cultura obtido a partir da cultura durante a noite deexposições cólon apenas o efeito de péptidos antimicrobianos segregadas quando incubado com E. coli. Esta abordagem pode ser utilizada para ver o efeito bactericida do cólon ou intestino derivados peptídeos antimicrobianos em todas as bactérias de interesse. Um meio de agar selectivo apropriado devem ser usadas para a cultura das bactérias.

Como a maioria das técnicas, existem limitações do sistema de cultura ex vivo de órgãos. Em primeiro lugar, ao contrário de cultura de células ou cultura organ�de, os órgãos não crescem e proliferam e, portanto, não pode ser expandido. Em segundo lugar, as células epiteliais intestinais são muito sensíveis e morrem de forma relativamente rápida, sem factores de crescimento adicionais e inibidores de apoptose, as quais são utilizadas para a cultura organ�de cripta. Terceiro, a resposta imune observada a partir da cultura de órgãos é uma resposta colectiva de diferentes tipos de populações de células. Por conseguinte, o papel do tipo de célula individual na expressão de genes antimicrobianos e efectoras não pode ser avaliada. additionally, ao contrário de linhas de células e cultura organ�de, a expressão de péptidos antimicrobianos e outras moléculas efectoras nos dois pontos pode variar de rato para rato do mesmo fundo genético.

Em resumo, descreve-se aqui um protocolo simples para cultura de órgãos ex vivo do cólon, que é muito útil para estudar as respostas imunitárias intestinais antimicrobianos. Esta abordagem pode ser utilizada para testar o papel dos diversos genes imunes inatas na expressão de péptidos antimicrobianos a partir de dois pontos por cultura de ratinhos mutantes genética de interesse. Além disso, este protocolo pode ser adaptado para uso em estudos clínicos para examinar as respostas antimicrobianos intestinal de pacientes de DII através da realização de cultura de órgãos de amostras de biópsia do cólon.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgements

Este trabalho foi apoiado pelo financiamento da Fundação de Crohn e Colite da América, (CCFA; 3711) Prevenção de Câncer e Instituto de Pesquisa de Texas (CPRIT; RP160169) e UT Southwestern Medical Center dado a MHZ

Materials

Name Company Catalog Number Comments
Advanced DMEM/ F12 Life Technologies 12634-010
Dulbecco's phosphate buffered saline, modified, w/o Calcium chloride & Magnesium chloride Sigma 5634
FBS, heat inactivated Sigma F4135
Penicillin-Streptomycin Life Technologies 15070063
Gentamicin solution Sigma G1272
Mouse IL-1b recombinan Reprokine RKP10749
Mouse IL-18 recombinant Reprokine RKP70380
TRIzol Reagent Thermo Fisher Scientific 15596018
Difco Luria-Bertani Broth  BD Bioscience 244620
BD Difco Dehydrated Culture Media: MacConkey Agar Fisher Scientific DF0075-17-1
NanoDrop 1000 Spectrophotometer Thermo Scientific Uded to measure RNA concentration
UV/Vis Spectrophotometer BECKMAN DU 530 Used to determine E. coli count
iScript RT Supermix, 100 rxns Bio-Rad 1708841
iTaq Univer SYBR Green Supermix  Bio-Rad 1725125 
Lysing Matrix S (1/8"), 2 ml Tube MP Biomedicals 116925500 Used to homgenize colon organ for RNA isolation
FastPrep-24 5G System Bio-Rad 116005500
100 mm x 15 mm Petri Dish Falcon 5687
Plate 6 well ps TC CS100, Cellstar, 6w, tc, F-bottom (Flat), w/lid, sterile Cellstar 5085
100 μm cell strainer Falcon 5698
Sorvall Legend Micro 21R Centrifuge Thermo Fisher Scientific
Sorvall ST40R Centrifuge Thermo Fisher Scientific
Forma Scientific orbital shaker Thermo Fisher Scientific

DOWNLOAD MATERIALS LIST

References

  1. Maloy, K. J., Powrie, F. Intestinal homeostasis and its breakdown in inflammatory bowel disease. Nature. 474, 298-306 (2011).
  2. Hooper, L. V., Macpherson, A. J. Immune adaptations that maintain homeostasis with the intestinal microbiota. Nat Rev Immunol. 10, 159-169 (2010).
  3. Vaishnava, S., Behrendt, C. L., Ismail, A. S., Eckmann, L., Hooper, L. V. Paneth cells directly sense gut commensals and maintain homeostasis at the intestinal host-microbial interface. Proc Natl Acad Sci U S A. 105, 20858-20863 (2008).
  4. Kamada, N., Chen, G. Y., Inohara, N., Nunez, G. Control of pathogens and pathobionts by the gut microbiota. Nat Immunol. 14, 685-690 (2013).
  5. Wu, H. J., Wu, E. The role of gut microbiota in immune homeostasis and autoimmunity. Gut Microbes. 3, 4-14 (2012).
  6. Zimmerman, N. P., Vongsa, R. A., Wendt, M. K., Dwinell, M. B. Chemokines and chemokine receptors in mucosal homeostasis at the intestinal epithelial barrier in inflammatory bowel disease. Inflamm Bowel Dis. 14, 1000-1011 (2008).
  7. Elliott, D. E., Siddique, S. S., Weinstock, J. V. Innate immunity in disease. Clin Gastroenterol Hepatol. 12, 749-755 (2014).
  8. Chopra, D. P., Dombkowski, A. A., Stemmer, P. M., Parker, G. C. Intestinal epithelial cells in vitro. Stem Cells Dev. 19, 131-142 (2010).
  9. Autrup, H. Explant culture of human colon. Methods Cell Biol. 21, 385-401 (1980).
  10. Qin, J., et al. A human gut microbial gene catalogue established by metagenomic sequencing. Nature. 464, 59-65 (2010).
  11. Wildenberg, M. E., vanden Brink, G. R. A major advance in ex vivo intestinal organ culture. Gut. 61, 961-962 (2012).
  12. Leushacke, M., Barker, N. Ex vivo culture of the intestinal epithelium: strategies and applications. Gut. 63, 1345-1354 (2014).
  13. Sato, T., et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459, 262-265 (2009).
  14. Tsilingiri, K., et al. Probiotic and postbiotic activity in health and disease: comparison on a novel polarised ex-vivo organ culture model. Gut. 61, 1007-1015 (2012).
  15. Haque, A., et al. Early interactions of Salmonella enterica serovar typhimurium with human small intestinal epithelial explants. Gut. 53, 1424-1430 (2004).
  16. Hicks, S., Candy, D. C., Phillips, A. D. Adhesion of enteroaggregative Escherichia coli to pediatric intestinal mucosa in vitro. Infect Immun. 64, 4751-4760 (1996).
  17. Knutton, S., Lloyd, D. R., Candy, D. C., McNeish, A. S. In vitro adhesion of enterotoxigenic Escherichia coli to human intestinal epithelial cells from mucosal biopsies. Infect Immun. 44, 514-518 (1984).
  18. Senior, P. V., Pritchett, C. J., Sunter, J. P., Appleton, D. R., Watson, A. J. Crypt regeneration in adult human colonic mucosa during prolonged organ culture. J Anat. 134, 459-469 (1982).
  19. Smollett, K., Shaw, R. K., Garmendia, J., Knutton, S., Frankel, G. Function and distribution of EspG2, a type III secretion system effector of enteropathogenic Escherichia coli. Microbes Infect. 8, 2220-2227 (2006).
  20. Bareiss, P. M., et al. Organotypical tissue cultures from adult murine colon as an in vitro model of intestinal mucosa. Histochem Cell Biol. 129, 795-804 (2008).
  21. Tsilingiri, K., Sonzogni, A., Caprioli, F., Rescigno, M. A novel method for the culture and polarized stimulation of human intestinal mucosa explants. J Vis Exp. e4368 (2013).
  22. Hu, S., et al. The DNA Sensor AIM2 Maintains Intestinal Homeostasis via Regulation of Epithelial Antimicrobial Host Defense. Cell Rep. 13, 1922-1936 (2015).
  23. Moorghen, M., Chapman, M., Appleton, D. R. An organ-culture method for human colorectal mucosa using serum-free medium. J Pathol. 180, 102-105 (1996).
  24. Dame, M. K., et al. Human colon tissue in organ culture: preservation of normal and neoplastic characteristics. In Vitro Cell Dev Biol Anim. 46, 114-122 (2010).
  25. Grant, A. J., Woodward, J., Maskell, D. J. Development of an ex vivo organ culture model using human gastro-intestinal tissue and Campylobacter jejuni. FEMS Microbiol Lett. 263, 240-243 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Video Stats