אנגיוגנזה להמחיש באמצעות מיקרוסקופ Multiphoton Vivo ב מהונדסים גנטית לגרדום 3D-PLGA/nHAp Calvarial תיקון פגם קריטי של העצם

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

כאן, אנו מציגים את פרוטוקול להמחיש כלי דם היווצרות ויוו ואת בזמן אמת ב- 3D פיגומים על ידי מיקרוסקופ multiphoton. אנגיוגנזה פיגומים מהונדסים נחקרה מודל פגם מאתר calvarial עצם קריטי. עוד כלי דם חדשים התגלו בקבוצה טיפול יותר שולטת.

Cite this Article

Copy Citation | Download Citations

Li, J., Jahr, H., Zheng, W., Ren, P. G. Visualizing Angiogenesis by Multiphoton Microscopy In Vivo in Genetically Modified 3D-PLGA/nHAp Scaffold for Calvarial Critical Bone Defect Repair. J. Vis. Exp. (127), e55381, doi:10.3791/55381 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

השחזור של העצם בגודל אנושות פגמים נשאר בעיה קלינית חמורה בגלל אנגיוגנזה המסכן בתוך רקמות מהונדסים פיגומים במהלך תיקון, אשר מעורר חוסר אספקת דם מספיקה וגורם נמק של רקמות חדשות. Vascularization מהירה היא תנאי חיוני הישרדות רקמות חדשות ושילוב עם רקמות הפונדקאי הקיים. הדור דה נובו של להערכת ב פיגומים הוא אחד הצעדים החשובים ביותר ביצירת התחדשות העצם יעיל יותר, ומאפשר תיקון רקמת לגדול לתוך לפיגום. כדי להתמודד עם בעיה זו, שינוי גנטי של לפיגום biomaterial משמש כדי להאיץ אנגיוגנזה ואת פרכת. עם זאת, להמחיש ומעקב ויוו היווצרות כלי דם בזמן אמת, פיגומים תלת מימדי (3D) או רקמת העצם החדש הוא עדיין מהווה מכשול עבור הנדסת רקמות העצם. מיקרוסקופ multiphoton (MPM) הוא הרומן מודאליות הדמיה זה יכול לרכוש נפחי נתונים מבנים ביולוגיים בצורה מינימלית פולשנית ברזולוציה גבוהה. מטרת מחקר זה הייתה להמחיש אנגיוגנזה עם מיקרוסקופ multiphoton ויוו ב לפיגום 3D-PLGA/nHAp מהונדסים לתיקון פגם calvarial עצם קריטי. PLGA/nHAp פיגומים היו functionalized לאספקת pdgf-b גורם גדילה גנים נושא וקטורים lentiviral (LV -pdgfb) כדי להקל על אנגיוגנזה וכדי לשפר את התחדשות העצם. ב מושתל לגרדום calvarial קריטי עצם פגם דגם העכבר, האזורים כלי דם (BVAs) ב- PHp פיגומים היו גבוהות משמעותית יותר ב- PH פיגומים. בנוסף, הביטוי של pdgf-b ו גנים הקשורים אנגיוגנזה, vWF , VEGFR2, גדל בהתאמה. ניתוח MicroCT ציינו כי היווצרות העצם החדש בקבוצה PHp השתפרו באופן דרמטי לעומת קבוצות אחרות. ידיעתנו זו הפעם הראשונה מיקרוסקופ multiphoton היה בשימוש רקמת העצם-הנדסה לחקור אנגיוגנזה 3D לגרדום ביו-מתכלים ויוו , בזמן אמת.

Introduction

העצם היא רקמה vascularized מאוד שממשיך לשפץ במהלך החיים של הפרט1. התחדשות העצם מהירה ויעילה של עצם גדול פגמים הנובעים טראומה, יתאחה, כריתות גידולים או מומים ואסטתיים היא תהליך פיזיולוגי מורכב. גישות טיפוליות המסורתי המשמש לתיקון פגם העצם כוללים בשתל, להשתלת ההשתלה, אך השימוש בהם כרוך במספר בעיות, מגבלות, כגון זמינות מוגבלת, תורם משמעותי באתר תחלואה, סיכון גבוה לזיהום, ו לארח הדחייה החיסונית2,3. עם זאת, שתלי עצם מלאכותית להציע חלופה יעילה כדי להקל על מגבלות אלה. הם יכול להתבצע מחומרים מתכלים, קל יהיה להמציא עם גודל הנקבוביות מתאימים, יכולים להיות מהונדסים4,5.

כיום, יש כבר מועסקים פיגומים הנדסת רקמות שונות בפיתוח של רקמות מהונדסים עצם6,7. כדי לגרום העצם תיקון והתחדשות ביעילות רבה יותר, biomaterials מהונדסים בשילוב עם גורמי גדילה יש בקע, השיגו תוצאות טובות8,9. למרבה הצער, מחצית חיים קצר, קל שלעולם לא פעילות ו supraphysiological במינון של גורמי גדילה על יעילות טיפולית להגביל יישום קליני שלהם10. כדי להתגבר על בעיות אלה, הוכח את המשלוח של גורם גדילה גנים במקום גורמי גדילה כמו גישה יעילה לקיים אתריים לטיפול של פגמים osseous ומחלות11,12. וקטורים ויראלי הם מבטיחים מסירה כלים עבור התחדשות רקמות עקב שלהם גבוהה לבטא יעילות13.

בין גורמי הגדילה גורם גידול נגזר טסית דם (PDGF-BB) נבחר במחקר זה כי זה לא רק של mitogen, chemoattractant עבור תאים mesenchymal ו- osteogenic, אך גם מעורר אנגיוגנזה14,15 . מחקרים קודמים קליניות הראו כי PDGF-BB יכולים בבטחה וביעילות לקדם את עצם תיקון פגמים osseous חניכיים16,17. מחקרים שנעשו לאחרונה חשף כי PDGF-BB מעוררת אנגיוגנזה המניע תא אנדותל ההגירה והתפשטות ויוו18,19. יתר על כן, PDGF-BB יכול גם לדקלם גזע mesenchymal (MSCs) מסוגל להבדיל לתוך תאי אנדותל20, ואת זה מדגיש עוד יותר את התפקיד הפוטנציאלי של MSCs כורוידאלית. לכן, וגורם להיווצרות דה נובו להערכת ב פיגומים עם PDGF-BB הוא צעד חשוב עבור התיקון של רקמות התפתחה פיגומים בהנדסת רקמות העצם.

עצם פגם הריפוי הוא תהליך morphogenetic רקמות דינמי הדורש פרכת מתואמת של אנגיוגנזה עמדות תיקון21. Neoangiogenesis לתוך פיגומים רקמות מהונדסים מושתל הוא דרישה מוקדמת חיוני לאספקת תאים עם חומרים מזינים וחמצן וצמיחה של הישרדות ועל הסרת פסולת מטבולית. בשימוש נפוץ שיטות הדמיה, כולל צילום רנטגן מיקרו-שחושב טומוגרפיה (microCT), דימות תהודה מגנטית (MRI), סריקה מיקרוסקופ אלקטרונים (SEM), טומוגרפיה אופטית קוהרנטית (אוקטובר) ו לייזר קונפוקלי סורק מיקרוסקופ, מוחלים במקום בבדיקה היסטולוגית להשיג אנגיוגנזה מידע22,23. עם זאת, שיטות אלה בפני מכשולים שונים להמחיש, מדידה neovasculature ב 3D פיגומים בהנדסת רקמות העצם. מיקרוסקופ multiphoton (MPM) היא טכניקת הדמיה יחסית הרומן כי יש יתרון מובהק בו זמנית להמחיש תאים, מטריצה חוץ-תאית, וסביב רשתות כלי דם ויוו. הוא בעל יכולת הדמיה תלת מימדי הטבועה של רקמות עמוק חדירה וגורם נזקי נמוכה. לפיכך, בעשור האחרון, MPM צברה הרבה תשומת לב ב מחקרים ביו24, לרבות מדעי המוח, אימונולוגיה ודינמיקה תאי גזע. עם זאת, הוא בקושי משמש במחקר אורטופדי.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

הטיפול בבעלי חיים היה תואם המדריך על טיפוח ועל שימוש של מעבדה חיות של בפרובינצית גואנג-דונג. כל ההליכים בוצעו תחת בפיקוח והאישור של ועדת האתיקה עבור בעלי חיים למחקר, שנג'ן מוסדות של טכנולוגיה מתקדמת, האקדמיה הסינית למדעים.

1. ייצור lentiviral (LV)

  1. שיבוט cDNA pdgf-b לתוך וקטור ביטוי lentiviral (pLenti6/5-eGFP או LV-eGFP) ב מרובה-שיבוט מותאמת אישית באתר במורד הזרם של האמרגן cytomegalovirus באמצעות Spe אני, סאל אני הגבלת אתרים לבנות פלסמיד pLenti6/5-PDGFB-eGFP (LV - pdgfb) 25-
  2. לייצר חלקיקים lentiviral (LV - pdgfb) מתאי HEK - 293 FT מאת transfecting משותפת עם וירוסים פלסמידים אריזה (pLP1, pLP2 ו pVSV-G) באמצעות השיטה סטנדרטי סידן פוספט עם כלורוקין (הריכוז הסופי: 25 מיקרומטר) 25.
  3. לאחר 48 שעות של תרביות תאים, לקצור ולסנן 500 מ"ל של המכיל וירוס supernatant עם מסנן (0.45 מיקרומטר). לאחר מכן, לרכז את חלקיקי נגיפי על ידי ultracentrifugation ב g 89,000 x עבור 2 ה Resuspend ב µL 200 של באגירה פוספט תמיסת מלח (PBS), aliquot, ולאחסן ב-80 מעלות צלזיוס
  4. כדי לקבוע את כייל של lentivirus, דגירה תאים HEK293T עם פתרון lentiviral מדולל באופן סדרתי עבור 24 שעות ולחשב את כייל נוגדנים lentiviral, כפי שתואר לעיל 25.

2. ייצור של הדפסת תלת-ממד פיגומים PLGA/nHAp, LV הנייח

  1. לפזר 20 גרם של PLGA (פוליפוני D, L-lactide-co-glycolide) בחומר 20 מ ל 1, 4-dioxane כדי ליצור פתרון הומוגני. להוסיף 2 גר' nanosized אבקת האפ (ננו-hydroxyapatide) (nHAp) הפתרון; PLGA: nHAp יחס צריך להיות 10:1 (w/w).
  2. מוסיפים את הפתרון מעורבים נמרצות (זע מהירות: 1,500 סל ד) בטמפרטורת החדר במשך 16 שעות שימוש של פגים ליצירת עיסה אחידה. לפברק אותן לתוך נקבוביות פיגומים PLGA/nHAp באמצעות מדפסת בטמפרטורה נמוכה תלת-ממד עם זרבובית ממוחשבת אשר הופקד על הדבק שכבה אחרי שכבה, מלמטה למעלה, על פי מודל שתגבש 26; גודל הנקבוביות פיגומים בטווח של 200 עד 400 מיקרומטר.
  3. ואקום שזה יבש והקפיא פיגומים במשך 48 שעות להסיר ממיס באופן מלא ככל האפשר. להשרות פיגומים 75% אתנול לפתרון 1h לציון עיקור, lyophilize כדי לקבל פיגומים ניטרלי, אספטי.
    הערה: הפרמטרים העיקריים עבור ליופיליזציה ואקום כוללים עיבוי טמפרטורה (° C), תואר ואקום (Pa). תחת דרגת ואקום 45 הרשות הפלסטינית, פיגומים PLGA/nHAp היו ואקום הקפוא ב-78 מעלות צלזיוס במשך 48 שעות להסיר ביסודיות הממס.
  4. להוסיף 10 µL של LV חלקיקים (4.5 x 10 5) על כל PLGA/nHAp לגרדום (4 מ מ x 4 מ"מ x 2 מ"מ), דגירה פיגומים עבור 2 h ב- 37 מעלות צלזיוס חממה humidified כדי לאפשר ספיחה.
  5. לאחר הנייח, לשטוף פיגומים פעמיים עם PBS להסיר חלקיקים LV לא מאוגד. Snap-הקפאת פיגומים מצופים חלקיקים LV בחנקן נוזלי, lyophilize שוב ו לאחסן ב- 80 ° C לשימוש עתידי.

3. במבחנה קינטיקה של LV שחרור החלקיק פיגומים, LV התמרה חושית פעילות Assay

  1. Incubate 3D פיגומים (4 מ מ x 4 מ"מ x 2 מ"מ) נשיאה LV-ירוק חלבון פלואורסצנטי (LV-eGFP, 4.5 x 10 5 LV חלקיקים) ב 1 מ"ל של DMEM מלאה ב- 2.0 מ ל קריוגני בקבוקונים ב 37 מעלות צלזיוס ברעידות במשך 5 ימים.
  2. לקחת דגימה 1 מ"ל כל 12 שעות מ- 12 שעות כדי 120 h שלאחר הדגירה ולהחליף את המדיום. בכל נקודה בזמן, להוסיף 1 מ"ל בינוני טריים במקום 1 מ"ל של דגירה בינונית.
  3. להשתמש בתקשורת שנאספו כדי מגלי HEK293T תאים על-ידי שיתוף המקננת על 48 ה למדוד מספר החלקיקים LV ביואקטיביות על-ידי קביעת המספר של GFP-חיוביות HEK293T תאים על-ידי cytometry זרימה 27.
    1. לפני transducing את התאים HEK293T, להסיר את המדיום תרבות ולשטוף את התאים HEK293T פעמיים עם PBS. להוסיף התקשורת שנאספו המכיל lentivirus שוחררו פיגומים אל הבאר (1 מ"ל/טוב), תרבות עם תאי HEK293T עבור h 48-37 מעלות צלזיוס חממה humidified.

4. במבחנה הערכה של הנגזרות מח עצם ההעברה MSC (BMSC)

  1. לפני ההעברה וזמינותו, להכין BMSCs לבטא עגבניות חלבון פלואורסצנטי (BMSCs-T) ו PDGF-BB חלבון (BMSCs-P) 28.
  2. לבצע את הבדיקה ההעברה BMSC עם תא בוידן באמצעות צלחת 24-היטב ומסננים פוליקרבונט עם גודל הנקבוביות של 8 מיקרומטר.
    1. מקום 0.5 מ של BMSCs (5 x 10 4) transfected עם LV לבטא עגבניות חלבון פלואורסצנטי (BMSCs-T) בתאי העליון. במקום 0.5 מ של BMSCs (2 x 10 5) transfected עם LV לבטא PDGF-BB חלבון (BMSCs-P) התאים נמוך.
  3. כוללים שש קבוצות ניסוי ולהוסיף 500 µL התא התחתון של כל טוב.
    א בלנק שליטה, ללא סרום בינונית בלבד
    ב' FBS שליטה, בינוני בתוספת 10% FBS
    ג PDGF-BB שליטה, 4 ננוגרם למ"ל PDGF-BB במדיום נטול סרום
    ד PDGF-BB לתפוס את הקבוצה, PDGF-BB (4 ng/mL), נוגדן anti-PDGF-BB (4 ng/mL) polyclonal ב בינונית ללא סרום
    אי BMSC הקבוצה, 2 x 10 BMSCs 5 בינוני ללא סרום
    פ BMSCs-P קבוצה, 2 x 10 5 BMSCs-P במדיום חינם סרום.
  4. תקופת דגירה של 48 h ב- 5% CO 2 ו- 37 מעלות צלזיוס חממה humidified. לאחר מכן, להסיר תאים שהועברו על הצד התחתון קאמרית ולאסוף אותם על כימות של מספר BMSCs-T על ידי cytometry זרימה.
    1. להסיר תאים שהועברו על התא התחתון באמצעות מגרד תא ולא resuspend את התאים שהועברו עם 2 מ"ל ל- PBS. לכמת את מספר BMSCs-T שהועברו על ידי cytometry זרימה 29.

5. הקמת מאתר Calvarial קריטי עצם פגם דוגמנית וגם לגרדום השתלת

הערה: עכברים BALB זכר/c (בן 7 שבועות) נרכשו מ גואנג-דונג מעבדה חיה מרכז רפואי (גואנג-דונג, סין).

עכברים זכרים
  1. הרשמה בסך 42 עבור הפגם calvarial עצם הניסוי. לחלק באופן אקראי את העכברים לשלוש קבוצות, עם 14 בכל קבוצה לקבל את הטיפולים הבאים: קבוצה A, אין שתלים; קבוצה ב', ה-PH פיגומים מושתל (PLGA/nHAp); קבוצה c, פיגומים PHp מושתל (PLGA/nHAp/LV-pdgfb).
  2. עזים ומתנגד החיות עם הממשל בקרום הבטן של סודיום פנטוברביטל (50 מ"ג/ק"ג). הסר פרווה עם הדבק depilatory, לנקות את העור ראש עם תמיסת כוהל 75% לפני ביצוע החתך הראשוני. לתקן את ראשו של כל עכבר עם מכשיר סטיאוטטי לשמור. את זה עדיין בניתוח.
  3. בחתך הראשונית עם איזמל, ואז להגדיל אותה שנינותמספריים h כדי ליצור חתך בעור ליניארית 1 ס"מ. לגרד קרום העצם מן העצם הגולגולת כדי לחשוף את פני עצם הגולגולת באמצעות מקלון צמר גפן סטרילי.
  4. להשתמש צמח קוצני trephine כדי ליצור פגם קריטי בגודל 4 מ מ קוטר בצד שמאל של calvaria 30. השתלת לגרדום לתוך האתר פגם עצם.
    הערה: גודל קריטי פגמים (CSDs) במקור הוגדרו " בגודל הקטן ביותר intraosseous פצע עצם מסוים, מינים של בעלי חיים זה לא ירפא באופן ספונטני במהלך החיים של החיה של. " בניסוי זה, הפגם בקוטר 4 מ מ פגם עצם גודל קריטי, על פי בעבר ללמוד 31 , 32-
  5. להשתמש מלקחיים אופטלמולוגיות כדי להעביר קרום העצם חזרה בעדינות כדי לכסות את האתר כירורגית. תפר את העור חרות עם שלושה תפרים לכל ס מ.
  6. לבצע טיפול post-operational. לנהל את הבופרנורפין מאלחש (0.1 מ"ג/ק"ג) כדי להקל על כאב. לשמור על טמפרטורת הגוף עם כרית חימום עד החיה מתעורר. לאחר מכן, להאכיל את בעלי החיים עם מים ואוכל, להקליט את פעילותם בכל יום עד תום הבדיקה. הערה: שיכוך כאבים יכול להינתן לפני ההליך בהתאם הנחיות שלך הוועדה המקומית טיפול בבעלי חיים.

6. אין ויוו הדמיה של אנגיוגנזה בתוך עצם פגם עם MPM

הערה: FITC מצומדת 250 kD לתוספי (10 mg/mL) בתוך תמיסת מלח היה מוזרק לווריד עכברים להשיג SNR גבוהה (יחס אות לרעש) תמונות של כלי דם חדשים על פי המחקר הקודם 33. הינכם מתבקשים לשים לב כי מדובר בהליך הישרדות.

  1. להרכיב מערכת multiphoton מיקרוסקופ (MPM) עבור שני הפוטונים נרגש קרינה פלואורסצנטית (TPEF) והדמיה השני דור הרמונית אות (SHG).
  2. להרדים את החיות עם זריקה בקרום הבטן של סודיום פנטוברביטל (50 מ"ג/ק"ג), לשתק את החיות על צלחת חימום לשמירה על טמפרטורת גופם ב 37 מעלות צלזיוס לאורך כל הניסויים. גז 3.0% איזופלוריין 100% חמצן כדי לשמור על הרדמה משביע רצון, שיכוך כאבים במהלך תהליך ההדמיה. Intraperitoneally להזריק תמיסת מלח (200 µL חיה) כדי למנוע התייבשות לפני הדמיה-
  3. המנגינה לייזר הפמטו-שנייה Ti-ספיר עד 860 ננומטר. ליצור אזור 512 x 512 מיקרומטר דגימה על-ידי סריקת זוג מראות galvo ולהשתמש NA1.0 טבילה במי המטרה עדשות focusthe עירור קרן בתוך המדגם, כדי לאסוף את האות TPEF/SHG backscattered.
    הערה: ההדמיה בוצעה במערכת הבית-לבנות multiphoton מיקרוסקופית הדמיה (MPM). במהלך דימות, לייזר הפמטו-שנייה Ti-ספיר שהיה מכוון לתחנה 860 nm כמו הגל עירור אופטימלית. קרן הלייזר היה רסטר שנסרקו על פני מטוס מדגם באמצעות זוג מראות גלוונומטר. אחרי שעברו דרך מראה ודיקרואיק זוהר של 685 nm, הקרן היה ממוקד הדגימה על ידי מטרה X NA1.0 20. האותות המושרה TPEF ו- SHG נאספו על ידי אותה מטרה. האותות נפרדו הלייזר עירור על ידי המראה ודיקרואיק זוהר שהוזכרו לעיל וטיהרו באמצעות מסנן מעברים קצרים 680-nm. אותות TPEF ו- SHG היו שנאספו על ידי צרור סיבי, שנערכו spectrograph. הגלאי-spectrograph היה מערך ליניארי של האופטיקה צינורות (PMTs). שילוב spectrograph עם מערך ליניארי PMTs הציע את היכולת להקליט את האות ב 16 להקות ספקטרלי ברציפות, מ- 400 nm 600 nm, במרווחי זמן 12.5-nm. לכן, אותות TPEF ו- SHG היו זוהה באותו זמן, מופרדים בתחומים ספקטרלי. יתר על כן, עבור הדמיה תלת-ממדית, מנוע מפוח נעשה שימוש כדי לשלוט העומק הדמיה. האזור של כל תמונה הוגדר 512 x 512 מיקרומטר, המרווח עומק הוגדר 2 מיקרומטר (קבוצת הביקורת, 5 מיקרומטר). ראוי לציין, 5 אתרי על כל פגם היו עם תמונה כדי לאסוף נתונים משמעותיים מבחינה סטטיסטית, הדמיה האתרים שנבחרו חולקו באופן שווה, באופן אקראי לאורך הפגם.
  4. סרוק 5 אתרים על כל פגם כדי לאסוף נתונים משמעותיים מבחינה סטטיסטית כדי למדוד את היווצרות כלי.
    1. שימוש סריקת אתרים באופן שווה, באופן אקראי מפוזרים לאורך הפגם. עבור קבוצת בקרה, יש בתחום של הצג כיסוי (FOV) באזור העצם המקורי והן את הקצה של הפגם, אבל עבור הקבוצות PH ו- PHp, יש את FOV על הגרדום מושתל.
    2. עושים חתך בעור ליניארית 1 ס"מ באמצעות אזמל, תפר פתוח לעור הקיבעון כדי לחשוף את האתר השתלת. השתמש במזרק כדי למקם את טיפת מים בין העדשה וטבלו השתלות כדי ליצור כוס מים-
  5. רכוש התמונה ערימות כל 12 נגמר ה 2 הדמיה תקופה. להציג ניתוח נפחי נתונים באמצעות תוכנית MATLAB מותאמת אישית ולכמת את האזורים כלי דם עם ImageJ תוכנה 34 , 35.

7. ניתוח ביטוי גנטי של pdgf-b ו גנים הקשורים אנגיוגנזה מאת RT-qPCR

הערה: ה-PCR בוצעה השלבים הרגילים: 95 ° C ל 30 s, 40 מחזורי 95 ° C 5 s ו- C ° 60 התכה 30 ס' פוסט-PCR עקומות אישרה יחודיות של הגברה יחיד-יעד, ואת השינוי קיפול של הגן עניין ביחס β-אקטין הייתה נחושה. התגובה עבור כל דגימה נבדקה שלוש פעמים.

  1. הקציר מושתל פיגומים ורקמות של העכברים ניסיוני-2, 4 ו- 8 שבועות לאחר מבצע 36; לשלוט קבוצה דגימות (n = 4), נלקח באותן נקודות זמן, צריך להיות מתוך רקמת העצם הסמוכה.
    הערה: בכל נקודה בזמן (2, 4 ו- 8 שבועות), מורדמים העכברים עם שאיפת 2 CO. לנתח את calvaria, לאחר מכן, להסיר ולקצור פיגומים מושתל מן calvaria.
  2. השתמש ריאגנט מסחרית כדי לחלץ את הרנ א סך כל דגימה לפי היצרן ' פרוטוקול s. להשתמש בערכה שעתוק לאחור כדי להפוך-לתמלל את הרנ א לתוך cDNA בעקבות היצרן ' פרוטוקול s.
  3. לבצע PCR כמותי בזמן אמת באמצעות מערכת זיהוי SYBR Green; תחל המפורטים בטבלה 1-
Primer(5'–3')
ג'ין קדימה להפוך
pdgfb CATCCGCTCCTTTGATGATCTT GTGCTCGGGTCATGTTCAAGT
vWF CTCTTTGGGGACGACTTCATC TCCCGAGAATGGAGAAGGAAC
GAAATGACACTGGAGCCTACA AG VEGFR2 TCCATGCTGGTCACTAACAGAA G
β-אקטין GTATCCATGAAATAAGTGGTTAC AGG GCAGTACATAATTTACACAGAAG CAAT

טבלה 1: ערכות Pimer.

8-ניתוח MicroCT של התחדשות העצם

  1. Euthanize עכברים עם שאיפת 2 CO-פוסט-פעולה 8 שבועות. בסביבת מאוורר היטב, הנח את העכבר כל לתוך כלוב עכבר נקי ובעדינות משאבת CO 2 גז לתוך הכלוב כדי להרדים את העכברים לפני המתת החסד.
  2. לנתח את הגולגולת עבור microCT הדמיה של אזור עצם הפגם. המשתמש הבאות סריקה פרמטרים בניסויים: 9 רזולוציה מיקרומטר, Al 0.5 מ מ, 50 מתח kV ומסנן הנוכחי 142 µA.
  3. סיקור
  4. struct כל הנתונים הדמיה באמצעות תוכנה מסחרית המסופקים על ידי החברה. לכייל את הסריקות באמצעות הפונקציה כיול של תוכנת CTAn.
    הערה: למקם את יחידת נ. האונספילד (HU) תחת העכברים כל סריקה.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

פיגומים גלילי נקבובי PLGA/nHAp 0.6 מ"מ גובה, 4 מ מ קוטר זוייפו. עם מדפסת תלת-ממד. מורפולוגיות של פיגומים נותחו באמצעות סריקה מיקרוסקופ אלקטרוני ו microCT. איור 1A מציג את הצילום של לגרדום מושתל. סריקה MicroCT התגלה כי יותר מ-85% של הנקבוביות היה בגודל הנע בין 200 400 מיקרומטר (איור 1B). הדמיה SEM הוכיח כי פני השטח של לגרדום היה microtopography קשה, עם micropores (קטרים כ 5-10 מיקרומטר) אשר מחוברים בתוך פיגומים (איור 1 D-F). כ-40% מהסכום הכולל של חלקיקים LV-eGFP מצופה (4.5 x 105) שוחררו פיגומים PLGA/nHAp התחיל עם אפקט פרץ הראשונית בתוך 24 שעות. Bioactivity של וירוסים LV שפורסמו להגיע אל הפסגה-24 שעות, ואז ברציפות פחתה, מתקרב ל- 0 ב- h 120 (איור 2). נתונים אלה מצביעים על כך bioactivity של חלקיקים LV ביותר מתאושש לגרדום יכול להימשך עד 96 שעות. יכולת העברה של MSCs-T נצפתה עם השיטה FACS לחקור אם LV נושאת cDNA pdgf-b יכול לבטא, להוביל כימוטקסיס BMSC, כפי שמוצג איור 3- הפקד חיובי (C) והן הקבוצה PDGF-BB-הבעת ' (F) הציגה רמה גבוה משמעותית של הגירה BMSC מ- 4 קבוצות אחרות. בנוסף, ההעברה של BMSCs בפה קבוצה היה גבוה באופן משמעותי מזה בקבוצה סי היו אין הבדלים משמעותיים BMSC ההעברה בין 4 הקבוצות האחרות.

אנגיוגנזה בתוך עצם הפגם נאמד בין ה-2 ל-8 בשבוע שלאחר ההשתלה מאת MPM סריקה. איור 4A מראה של איור סכמטי של עכבר תחת MPM סריקה. ברור אנגיוגנזה זוהה בקבוצות PH ו- PHp, אבל כלי הדם היו בקושי מקהים קבוצת הבקרה, שבו רק שכבה של ממברנות סיביים ברחבי האזור הפגם נוצר (איור 4B). GIF הגרפים מראים את טומוגרפיה של כלי דם של כל קבוצה (נתונים משלימים). האזור של כלי דם חדשים בהדרגה במשך הזמן בקבוצות PH ו- PHp, עם דפוסים דומים גדל והולך. בשבוע השמיני, בכלי הדם הופיע דומה מורפולוגיה לאלו שנצפו בשלב מוקדם; השינוי היחיד היה כי מספר גדל והולך של כלי קטן יותר היה גדל לתוך פיגומים (איור 4B). BVA של קבוצת PHp היה גבוה באופן משמעותי כי שתי הקבוצות אחרים בכלל נקודות זמן (איור 4C). יתר על כן, היו אתרים רבים קולגן התצהיר, כפי שמציין SHG אותות (הצבע הירוק ב תרשימים וגרפים GIF) בקבוצות PH ו- PHp, אבל לא בקבוצת הביקורת (איור 4B).

על מנת להבהיר את הקשר של אנגיוגנזה וביטוי PDGF-BB, השווינו את ג'ין התעתיק רמות הביטוי של pdgf-b, vWF, VEGFR2 עם השיטה RT-qPCR-2, 4 ו- 8 שבועות לאחר ההשתלה ( איור 5). כצפוי, pdgf-b הביטוי היה משמעותי מוגברת בקבוצה PHp בנקודות כל הזמן, עם עלייה 5 - 13 פעמים לעומת שליטה וקבוצות PH (איור 5A). היה הבדל משמעותי בין שליטה לבין קבוצה PH, ונשארו רמת הביטוי של PDGF-BB כמעט קבוע בשבוע 2 בשבוע 8, כפי שמוצג באיור 5A. רמות הביטוי של mRNA של vWF , VEGFR2 בכל שלוש קבוצות בהדרגה, היו הגבוהים ביותר בקבוצה PHp כל שלוש נקודות (איור 5B ו ג 5) זמן. עבור קבוצת ה-PH, היה ללא מובהקות סטטיסטית לעומת קבוצת הביקורת, למרות ברור אנגיוגנזה (איור 4B).

לאשר עוד את pdgf-b-פיגומים המכיל לקדם עצם התחדשות ויוו באמצעות אנושות בגודל פגמים calvarial בעכברים BALB/c זכר, microCT סריקה סיפק מידע כדי להעריך את התחדשות העצם בגיל 8 שבועות שלאחר ההשתלה. כפי שמוצג באיור 6, פגמים בקבוצה PHp מולאו מסה של ingrowth רקמת עצם חדשה בפיגומים, ואילו היה עצם חדשה הרבה פחות שליטה ובקבוצות PH.

Figure 1
איור 1: אפיון מבניים של לפיגום 3D PLGA/nHAp. (א) תצלום של לפיגום מודפס 3D. (B) A microCT תמונה של נקבוביות הכוללת לגרדום. (ג) microtopography של פני השטח לגרדום שנצפה על ידי SEM 60 X, 2,000 X (D), 5,000 X (E), ולא X 10,000 הגדלה (F). אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 2
איור 2: הכנת Lentivirus והערכת Bioactivity של החלקיקים LV-GFP. (א) ייצוג סכמטי של הבונה וקטור lentiviral. לאחר 48 שעות של תרביות תאים, התאים HEK - 293FT נצפו תחת אור (B), קרינה פלואורסצנטית. תנאי המגרש (C). (ד) במבחנה הערכה של bioactivity של החלקיקים LV-GFP מצטברת שוחררו פיגומים PLGA/nHAp. כל הנתונים המוצגים כדמויות זאת אומרת ± SEM (n = 4). אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 3
איור 3. אתריים PDGF-BB כתגובה חזק גורם Chemotactic של הגירה BMSC. BMSCs-T (5 x 104) היו נזרע על גבי תאי transwell, עם מדיה תנאי שונים ממוקמים בחלק התחתון של התאים. (א) בקרה הריק, ללא סרום בינוני בלבד; (B) FBS לשלוט, בינוני בתוספת 10% FBS; (ג) PDGF-BB שליטה, 4 ננוגרם למ"ל PDGF-BB ללא סרום בינוני; (ד) PDGF-BB לתפוס את הקבוצה, PDGF-BB (4 ng/mL), נוגדן anti-PDGF-BB (4 ng/mL) polyclonal ללא סרום בינוני; BMSCs (E) קבוצה, 2 x 105 BMSCs ללא סרום בינוני; וקבוצת BMSCs (F)-P, 2 x 105 BMSCs-P במדיום נטול סרום. כל הנתונים מוצגים זאת אומרת ± SEM (n = 4). #: השוואה בין קבוצה C לקבוצות האחרות, אלא קבוצה F, # p < 0.0001. *: השוואה בין כל קבוצות אחרות, קבוצה F * p < 0.05, * * * p < 0.0001. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 4
איור 4: דימות ברזולוציה גבוהה Multiphoton מיקרוסקופ (SHG/TPEF), כימות של אנגיוגנזה באזור עצם פגם Calvaria העכבר.trong > (א) A איור סכמטי של עכבר תחת MPM סריקה. עיגול כתום מייצג את האתר פגם בקוריאנית האדום מייצג את כלי הדם, הירוק מייצג קולגן. Unoperated (B) ובעלי המופעלים נסרקו עם MPM-8 שבועות לאחר ההשתלה. SHG, TPEF, SHG/TPEF ממוזג, מוצגות תמונות תלת-ממד. הקו המנוקד מייצג את הגבול לאורך עצם הפגם בקבוצת הביקורת בהתבסס על אותות SHG. (ג) כלי דם באזור כימות בתוך אזור פגם של שליטה, PH ו- PHp משבוע 2 עד שבוע 8 שלאחר ההשתלה. כל הנתונים מוצגים זאת אומרת ± SEM (n = 5). : ניתוח סטטיסטי בין קבוצות PH ו- PHp, p < 0.0001. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 5
איור 5: RT-qPCR ניתוח pdgf-b (A), גנים הקשורים אנגיוגנזה vWF (B), VEGRF2 (ג) ביטוי לשלוש קבוצות. דגימות מבעלי חיים 4 נותחו עבור כל נקודת זמן. #: השוואה בין הקבוצות PHp ו- PH, # p < 0.05, # p < 0.01 ו- #p < 0.0001. *: השוואה בין הקבוצות PHp ושליטה, * p < 0.05, * * p < 0.01, ו * * * p < 0.0001. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 6
איור 6: הערכה של In Vivo עצם היווצרות בסריקת MicroCT. קבוצת הביקורת ללא פיגומים מושתל. PH קבוצה בתוך מושתלים PLGA/nHAp לגרדום בלבד. קבוצת PHp בתוך מושתל לגרדום PLGA/nHAp שונה על-ידי החלקיקים LV- pdgfb . אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

העצם היא רקמה vascularized מאוד עם קיבולת ייחודי ללא הרף להחלים ולהתאושש לשפץ לאורך כל חייו של הפרט1. הרמה של vascularization חשוב פרכת ותיקון פגם. Vascularization נמוכה מגבילה את יישום קליני רחב של רקמות מהונדסים עצם. בניית עצם רקמות מהונדסים מאוד vascularized לפי תורת ביומימטיקה הפך להיות כלי לתיקון פגמים עצם קטע גדול. סוגים שונים של פיגומים הוחלו בהצלחה לתיקון ליקויי osseous קטן יחסית. עם זאת, עצם קריטי פגמים, היישום של פיגומים לתקן עדיין מכשולים פרצופים, בעיקר בזכות דם מספקת לספק לתיקון פגם. לכן, שיפור אספקת הדם במהלך התהליך של תיקון פגמים עצם גדול הוא אחד הנושאים העיקריים בהנדסת רקמות.

אנשים משתמשים ביו פיגומים מצופים חומר כדי לעזור להקים את השדות הנדרשים morphogenetic זה יכול לעורר, לגייס, ולקדם את כימוטקסיס בידול, התפשטות של התאים לצורך גיבוש neovasculature ועצמות 37. Neovasculature, פיגומים רקמות מהונדסים חיוני עבור התאים לקלוט חמצן וחומרים מזינים, עבור סילוק חומרי פסולת, ובסופו של דבר על מימוש הפונקציה של פיגומים. מטרות המחקר היו לחקור אנגיוגנזה עם ויוו multiphoton מיקרוסקופ ב לפיגום PLGA/nHAp מהונדסים, מודפס 3D לתיקון פגם calvarial עצם קריטי וכדי להעריך את ההשפעות של שימוש התחדשות העצם microCT.

למרות ההישגים הדרמטיים הנדסת רקמות העצם, ויזואליזציה ויוו כימות של כורוידאלית ב פיגומים במהלך עצם התחדשות הוא עדיין אתגר. מערכות הדמיה המיקרוסקופיים ביותר אינם יכולים לספק מידע הנפחי אנגיוגנזה. שיטות הדמיה מסורתיים, כגון microCT, MRI וניתוחים היסטולוגית, הרסני, מסובך, מייגעת, יש החלטות המרחבי נמוך, ייבוא תמונות ארוך פי38. אולם, MPM הדמיה הוא מודאליות הדמיה הרומן כי יכול ללכוד כלי דם אותות ויוו בצורה פולשנית ברזולוציה גבוהה. הוא מסוגל לזהות ספינות חדשות דק יותר מ- 10 מיקרומטר (איור 4B). מלבד תמונות כלי דם, גם הבחנו מסה של התצהיר קולגן חדש (הצבע הירוק באיור 4B) וגרפים GIF בחומר משלים, כמצוין על-ידי אותות SHG, אשר מצביעים על היווצרות רקמת העצם מזווית אחרת. באופן תיאורטי, תמונות כלי דם יכולה להיות מושגת ללא שימוש של סוכנים בניגוד. אולם, במחקר הנוכחי, אנו משמש סוכן חדות כדי לקבל תמונות יותר, הסרת העור המקומי כדי להבטיח עומק הסריקה נאותה. זה יהיה מיותר כאשר חזק יותר. מערכות הדמיה זמינים בעתיד עבור הדמיה באמת לא פולשנית.

האפ הוא חומר ביו עבור התחדשות רקמות העצם נפוצה בשל osteoconduction טוב שלה תכונות osteoinduction. האפ יש יכולת טובה של איגוד ה-DNA וקטורים ו שמירה וייצוב וקטורים, לרבות נגיפי וקטורים39. בהשוואה microsized האפ, nanosized האפ חלקיקים בעלי ספציפיות גבוהה פני שטחים, ולכן להראות טוב יותר התנהגות הסלולר ואת תכונות מכניות40. מסיבות אלו, nHAp חלקיקים הם אחד המרכיבים של פיגומים. תמונות SEM פני השטח ואת חתך הרוחב של לגרדום PLGA/nHAp המוצגת באיור 1 מציין כי פיגומים מפוברק להציג מבנה נקבובית מחוברים היטב וגדלים נקבובית מבוזרות בצורה אחידה. הנייח של וירוס על גבי biomaterial נשאים יכולים להשפיע על פעילות הווירוס. לכן, בדקנו את bioactivity של חלקיקים LV שוחררו פיגומים על ידי חקירת פעילותם תרביות תאים. הפרופילים שחרור של LV חלקיקים פיגומים, bioactivities שלהם היו הערכה במבחנה, הוכחת מסירה מבוקרת של חלקיקים LV ביואקטיביות במשך חמישה ימים (איור 2). יתר על כן, התמקד המחקר שלנו במבחנה הפוטנציאל של PDGF-BB כדי לגרות את ההעברה של MSCs העיקרי. תוצאות אלו מראים כי החלקיקים LV הביע PDGF ביו-BB והעברה BMSC ביעילות מגורה.

כדי לאשר את הקיבולת עבור אנגיוגנזה ועצם התחדשות ויוו, פיגומים PHp שהיו מושתלים לתוך מאתר עצם קריטי calvarial פגמים. היווצרות כלי אושר עם סמנים האנגיוגנזה, RT-qPCR ניתוח כלי דם צפיפויות נצפתה עם הדמיה SHG/TPEF. שניהם של שתי קבוצות של ניסויים הפגינו אנגיוגנזה ויצירת כלי דם שופרו באופן משמעותי עם הטיפול של פיגומים מהונדסים. תוצאות אלו מצביעות על כך PDGF-BB ישירות מגרה אנגיוגנזה אלא גם מעוררת גנים אחרים הקשורים אנגיוגנזה. בינתיים, מדידות microCT להדגים את pdgf-b-המכיל פיגומים באופן משמעותי קידם את היווצרות העצם בהשוואה פיגומים שלא שונתה, אשר עולה בקנה אחד גם עם neovasculature ב לגרדום. תוצאות אלו מצביעות על פיגומים מהונדסים, ביו לשפר באופן משמעותי את התחדשות אנגיוגנזה ורקמות.

התוצאות המובאות כאן מדגימים כי השינוי הגנטי בתיווך lentivirus של פיגומים מקלה על תיקון גדול לפגם osseous במודל פגם מאתר calvarial עצם קריטי, ככל הנראה דרך אנגיוגנזה המשופרים. בנוסף, אין ויוו MPM הדמיה מספקת כלי ייחודי כדי להבין אנגיוגנזה ואת פרכת בתוך עצם פיגומים מאפשרת הבהרה נוספת של לפיגום מסוימים הוא מועיל כורוידאלית. מיקרוסקופ multiphoton intravital הדמיה מספקת מודאליות להבנת הפיזיולוגיה של הפתופיזיולוגיה של אנגיוגנזה רקמות, פיגומים. עם זאת, ישנן מספר מגבלות בעת שימוש בטכניקה זו. ראשית, הכנת כירורגית דורשת מומחיות מיוחדת. דלקת הנגרמת על ידי פעולת מיומנים יקטן באופן משמעותי את MPM הדמיה באיכות. שנית, בשל MPM הדמיה הגבלת מהירות, בעל ראש אישית מעוצבת העכבר יש צורך להפחית את החפצים הנגרמת על ידי קצב לב ונשימה. שלישית, עבור הדמיה לטווח ארוך, חיות חייב להיות intraperitoneally או דרך הווריד מוזרק עם תמיסת מלח כדי למנוע התייבשות.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

המחברים מצהירים כי יש להם אינטרסים כלכליים אין מתחרים.

Acknowledgements

מחקר זה נתמך על ידי התוכנית טווס שנג'ן, סין (לא 110811003586331), שנג'ן התוכנית מחקר בסיסי (מס ' JCYJ20150401150223631, מס JCYJ20150401145529020, מס JCYJ20160331190714896), גואנג-דונג הציבורית מחקר ובניית יכולת התוכנית המיוחדת (מספר 2015A020212030), הקרן הלאומית למדע הטבעי של סין (מספר 81501893), התוכנית מחקר בסיסי מייג'ור הלאומי של סין (2013CB945503), ו האירוע מתקיים תוכנית חדשנות לחוקרים צעירים מצוינים (Y5G010).

Materials

Name Company Catalog Number Comments
Poly(D,L-lactide-co-glycolide) (PLGA) Sigma P1941 L/G ratio 75:25, MW 66000-107000
Hydroxyapatite nanoparticles Sigma 702153 Average diameter < 200 nm
Chloroquine diphosphate salt Sigma C6628
FITC-conjugated 250-kD dextran Sigma FD250S
1,4-dioxane lingfeng,Shanghai 0.45 micron
Stericup filters Merck Millipore Corporation SLHV033RB
PDGF-BB Cdna Sino Biological, Inc MZ50801-G
Anti-PDGF-BB mouse polyclonal antibody  BioVision, Inc 5489-30T
PDGF-BB recombinant protein 4489-50
Calcium-phosphate transfection solution Promega Corporation E1200
L-DMEM Hyclone SH30021.01
DPBS Hyclone SH30028.01
Penicillin-Streptomycin, Liquid Thermo Fisher Scientific 15140122
FBS Thermo Fisher Scientific 10099-141
Transwell  Corning 3422
Male BALB/c mice Guangdong Medical Laboratory Animal Center 
sodium pentobarbital  Merck 1063180500
multiphoton microscopy A homemade in Shenzhen Institutes of Advanced Technology to detect two-photon excited fluorescence (TPEF) and second harmonic generation signal (SHG).
isoflurane Keyuan, Shandong 401750169
TRIzol reagent Invitrogen 15596018
PrimeScript RT Master Mix (Perfect Real Time) Takara RR420B
SYBR Premix Ex Taq (Tli RNaseH Plus) Takara RR036B
Hematoxylin and eosin Beyotime C0105
Paraffin Leica  RM2235
Ultracentrifuge OPtima L-100XP Beckman Coulter L-100XP
Low-temperature printer  Tsinghua university A homemade in Tsinghua university
LightCycler 480 instrument  Roche 5815916001
microCT Bruker 1176
commercial software Bruker
Buprenorphine

DOWNLOAD MATERIALS LIST

References

  1. Hu, X., et al. GPNMB enhances bone regeneration by promoting angiogenesis and osteogenesis: potential role for tissue engineering bone. J Cell Biochem. 114, (12), 2729-2737 (2013).
  2. Schroeder, J. E., Mosheiff, R. Tissue engineering approaches for bone repair: concepts and evidence. Injury. 42, (6), 609-613 (2011).
  3. Chiarello, E., et al. allograft and bone substitutes in reconstructive orthopedic surgery. Aging Clin Exp Res. 25, S101-S103 (2013).
  4. Elangovan, S., et al. The enhancement of bone regeneration by gene activated matrix encoding for platelet derived growth factor. Biomaterials. 35, (2), 737-747 (2014).
  5. Bouyer, M., et al. Surface delivery of tunable doses of BMP-2 from an adaptable polymeric scaffold induces volumetric bone regeneration. Biomaterials. 104, 168-181 (2016).
  6. Rezwan, K., et al. Biodegradable and bioactive porous polymer/inorganic composite scaffolds for bone tissue engineering. Biomaterials. 27, (18), 3413-3431 (2006).
  7. Burg, K. J., Porter, S., Kellam, J. F. Biomaterial developments for bone tissue engineering. Biomaterials. 21, (23), 2347-2359 (2000).
  8. Xiao, Y., et al. Modifications of collagen-based biomaterials with immobilized growth factors or peptides. Methods. 84, 44-52 (2015).
  9. Chen, G., Lv, Y. Immobilization and Application of Electrospun Nanofiber Scaffold-based Growth Factor in Bone Tissue Engineering. Curr Pharm Des. 21, (15), 1967-1978 (2015).
  10. Kofron, M. D., Li, X., Laurencin, C. T. Protein- and gene-based tissue engineering in bone repair. Curr Opin Biotechnol. 15, (5), 399-405 (2004).
  11. Chen, F. M., et al. New insights into and novel applications of release technology for periodontal reconstructive therapies. J Control Release. 149, (2), 92-110 (2011).
  12. Winn, S. R., et al. Gene therapy approaches for modulating bone regeneration. Adv Drug Deliv Rev. 42, (1-2), 121-138 (2000).
  13. Chang, P. C., et al. Adenovirus Encoding Human Platelet-Derived Growth Factor-B Delivered to Alveolar Bone Defects Exhibits Safety and Biodistribution Profiles Favorable for Clinical Use. Hum Gene Ther. 20, (5), 486-496 (2009).
  14. Phipps, M. C., Xu, Y. Y., Bellis, S. L. Delivery of Platelet-Derived Growth Factor as a Chemotactic Factor for Mesenchymal Stem Cells by Bone-Mimetic Electrospun Scaffolds. Plos One. 7, (7), (2012).
  15. Gehmert, S., et al. Angiogenesis: The role of PDGF-BB on Adiopse-tissue derived Stem Cells (ASCs). Clin Hemorheol and Microcirc. 48, (1-3), 5-13 (2011).
  16. Chang, P. C., et al. PDGF-B gene therapy accelerates bone engineering and oral implant osseointegration. Gene Ther. 17, (1), 95-104 (2010).
  17. Javed, F., et al. Significance of the platelet-derived growth factor in periodontal tissue regeneration. Arch Oral Biol. 56, (12), 1476-1484 (2011).
  18. Murali, R., et al. Biomimetic hybrid porous scaffolds immobilized with platelet derived growth factor-BB promote cellularization and vascularization in tissue engineering. J Biomed Mater Res A. 104, (2), 388-396 (2016).
  19. Andrae, J., Gallini, R., Betsholtz, C. Role of platelet-derived growth factors in physiology and medicine. Genes Dev. 22, (10), 1276-1312 (2008).
  20. Wosnitza, M., et al. Plasticity of human adipose stem cells to perform adipogenic and endothelial differentiation. Differentiation. 75, (1), 12-23 (2007).
  21. Hankenson, K. D., et al. Angiogenesis in bone regeneration. Injury. 42, (6), 556-561 (2011).
  22. Schmidt, C., et al. Rapid three-dimensional quantification of VEGF-induced scaffold neovascularisation by microcomputed tomography. Biomaterials. 30, (30), 5959-5968 (2009).
  23. Perng, C. K., et al. In Vivo Angiogenesis Effect of Porous Collagen Scaffold with Hyaluronic Acid Oligosaccharides. J Surg Res. 168, (1), 9-15 (2011).
  24. Sun, Y., et al. Imaging tissue engineering scaffolds using multiphoton microscopy. Microsc Res Tech. 71, (2), 140-145 (2008).
  25. Fan, X., et al. Noninvasive monitoring of placenta-specific transgene expression by bioluminescence imaging. PLoS One. 6, (1), e16348 (2011).
  26. Yeo, M. G., Kim, G. H. Preparation and Characterization of 3D Composite Scaffolds Based on Rapid-Prototyped PCL/β-TCP Struts and Electrospun PCL Coated with Collagen and HA for Bone Regeneration. Chem Mater. 24, (5), 903-913 (2012).
  27. Mao, Y., et al. Lentiviral Vectors Mediate Long-Term and High Efficiency Transgene Expression in HEK 293T cells. Int J Med Sci. 12, (5), 407-415 (2015).
  28. Li, J., et al. Investigation of angiogenesis in bioactive 3-dimensional poly (D,L-lactide-co-glycolide)/nano-hydroxyapatite scaffolds by in vivo multiphoton microscopy in murine calvarial critical bone defect. Acta Biomater. 42, 389-399 (2016).
  29. Abbasi, H., et al. Lentiviral vector-mediated transduction of goat undifferentiated spermatogonia. Anim Reprod Sci. 163, 10-17 (2015).
  30. Pigossi, S. C., et al. Bacterial cellulose-hydroxyapatite composites with osteogenic growth peptide (OGP) or pentapeptide OGP on bone regeneration in critical-size calvarial defect model. J Biomed Mater Res A. (2015).
  31. Bos, G. D., et al. The effect of histocompatibility matching on canine frozen bone allografts. J Bone Joint Surg Am. 65, (1), 89-96 (1983).
  32. Hollinger, J. O., Kleinschmidt, J. C. The critical size defect as an experimental model to test bone repair materials. J Craniofac Surg. 1, (1), 60-68 (1990).
  33. Hollanders, K., et al. Bevacizumab Revisited: Its Use in Different Mouse Models of Ocular Pathologies. Curr Eye Res. 40, (6), 611-621 (2015).
  34. Gao, L. QSIM: quantitative structured illumination microscopy image processing in ImageJ. Biomed Eng Online. 14, 4 (2015).
  35. Kobat, D., et al. Deep tissue multiphoton microscopy using longer wavelength excitation. Opt Express. 17, (16), 13354-13364 (2009).
  36. Lohmann, P., et al. Bone regeneration induced by a 3D architectured hydrogel in a rat critical-size calvarial defect. Biomaterials. 113, 158-169 (2016).
  37. Lv, J., et al. Enhanced angiogenesis and osteogenesis in critical bone defects by the controlled release of BMP-2 and VEGF: implantation of electron beam melting-fabricated porous Ti6Al4V scaffolds incorporating growth factor-doped fibrin glue. Biomed Mater. 10, (3), (2015).
  38. Guldberg, R. E., et al. 3D imaging of tissue integration with porous biomaterials. Biomaterials. 29, (28), 3757-3761 (2008).
  39. Boehler, R. M., et al. A PLG/HAp composite scaffold for lentivirus delivery. Biomaterials. 34, (21), 5431-5438 (2013).
  40. Heo, S. J., et al. Fabrication and characterization of novel nano- and micro-HA/PCL composite scaffolds using a modified rapid prototyping process. J Biomed Mater Res A. 89, (1), 108-116 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics