Angiogenesis visualizing द्वारा Multiphoton माइक्रोस्कोपी में आनुवंशिक रूप से संशोधित 3 डी-PLGA/Calvarial क्रिटिकल हड्डी दोष मरंमत के लिए nHAp पाड़

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

यहाँ, हम vivo में रक्त वाहिका गठन कल्पना और 3 डी पाड़ों में वास्तविक समय में multiphoton माइक्रोस्कोपी द्वारा एक प्रोटोकॉल पेश करते हैं । आनुवंशिक रूप से संशोधित पाड़ों में Angiogenesis एक murine calvarial क्रिटिकल बोन दोष मॉडल में अध्ययन किया गया था । अधिक नई रक्त वाहिकाओं नियंत्रण में से उपचार के समूह में पाया गया ।

Cite this Article

Copy Citation | Download Citations

Li, J., Jahr, H., Zheng, W., Ren, P. G. Visualizing Angiogenesis by Multiphoton Microscopy In Vivo in Genetically Modified 3D-PLGA/nHAp Scaffold for Calvarial Critical Bone Defect Repair. J. Vis. Exp. (127), e55381, doi:10.3791/55381 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

गंभीर रूप से आकार के अस्थि दोषों के पुनर्निर्माण एक गंभीर नैदानिक समस्या है क्योंकि ऊतक के भीतर गरीब angiogenesis की मरंमत के दौरान इंजीनियर पाड़, जो पर्याप्त रक्त की आपूर्ति की कमी को जंम देता है और नए ऊतकों के परिगलन का कारण बनता है । रैपिड vascularization नए ऊतक अस्तित्व और मौजूदा मेजबान ऊतक के साथ एकीकरण के लिए एक महत्वपूर्ण शर्त है । पाड़ों में vasculature के de नोवो पीढ़ी हड्डी पुनर्जनन अधिक कुशल बनाने में सबसे महत्वपूर्ण चरणों में से एक है, की मरंमत ऊतक एक पाड़ में विकसित करने की अनुमति । इस समस्या से निपटने के लिए, एक भौतिक पाड़ के आनुवंशिक संशोधन angiogenesis और आस्टियोजेनेसिस में तेजी लाने के लिए प्रयोग किया जाता है । हालांकि, visualizing और वास्तविक समय में और तीन आयामी (3 डी) पाड़ या नए अस्थि ऊतक में vivo रक्त वाहिका गठन में ट्रैकिंग अभी भी हड्डी ऊतक इंजीनियरिंग के लिए एक बाधा है । Multiphoton माइक्रोस्कोपी (MPM) एक उपंयास जैव इमेजिंग रूपरेखा है कि एक उच्च संकल्प और ंयूनतम इनवेसिव तरीके से जैविक संरचनाओं से volumetric डेटा प्राप्त कर सकते हैं । इस अध्ययन का उद्देश्य calvarial क्रिटिकल बोन दोष की मरंमत के लिए एक आनुवंशिक रूप से संशोधित 3 डी-PLGA/nHAp पाड़ में vivo में multiphoton माइक्रोस्कोपी के साथ angiogenesis कल्पना थी । PLGA/nHAp पाड़ों एक विकास कारक के निरंतर वितरण के लिए कार्यात्मक थे pdgf-बी जीन ले lentiviral वैक्टर (LV-pdgfb) क्रम में angiogenesis की सुविधा के लिए और हड्डी पुनर्जनन बढ़ाने के लिए । एक पाड़ प्रत्यारोपित calvarial क्रिटिकल बोन दोष माउस मॉडल में, रक्त वाहिका क्षेत्रों (BVAs) PHp पाड़ों में काफी पीएच पाड़ों की तुलना में अधिक थे । इसके अतिरिक्त, pdgf-बी और angiogenesis से संबंधित जीन, vWF और VEGFR2की अभिव्यक्ति, तदनुसार वृद्धि हुई । MicroCT विश्लेषण संकेत दिया है कि नए PHp समूह में हड्डी गठन नाटकीय रूप से अंय समूहों की तुलना में सुधार हुआ । हमारे ज्ञान के लिए, यह पहली बार है multiphoton माइक्रोस्कोपी में प्रयोग किया जाता था अस्थि ऊतक-इंजीनियरिंग में angiogenesis की जांच करने के लिए एक 3d बायो-सड़ पाड़ vivo में और वास्तविक समय में.

Introduction

हड्डी एक उच्च संवहनी ऊतक है कि एक व्यक्ति के जीवनकाल के दौरान फिर से बनाना जारी है1। आघात, संघ, ट्यूमर लकीरें, या craniofacial विकृतियों से उत्पंन बड़ी हड्डी दोष के तेजी से और प्रभावी अस्थि पुनर्जनन एक जटिल शारीरिक प्रक्रिया है । अस्थि दोष की मरंमत के लिए इस्तेमाल किया पारंपरिक चिकित्सीय दृष्टिकोण शामिल है भ्रष्टाचार और allograft आरोपण, लेकिन उनके उपयोग में कई समस्याओं और सीमित उपलब्धता, महत्वपूर्ण दाता साइट रुग्णता, संक्रमण के एक उच्च जोखिम के रूप में सीमाएं, शामिल है, और मेजबान प्रतिरक्षा अस्वीकृति2,3। हालांकि, कृत्रिम अस्थि भ्रष्टाचार इन सीमाओं को कम करने के लिए एक कुशल विकल्प प्रदान करते हैं । वे biodegradable सामग्री से बनाया जा सकता है, आसान कर रहे है एक उपयुक्त ताकना आकार के साथ गढ़े हो, और आनुवंशिक रूप से4,5संशोधित किया जा सकता है ।

वर्तमान में, विभिंन ऊतक इंजीनियरिंग पाड़ों ऊतक के विकास में नियोजित किया गया है इंजीनियर हड्डी6,7। हड्डी की मरंमत और पुनर्जनन अधिक प्रभावी ढंग से प्रेरित करने के लिए, इंजीनियर विकास कारकों के साथ संयुक्त सामग्री उभरा है और अच्छे परिणाम प्राप्त8,9। दुर्भाग्य से, कम आधा जीवन, आसान करने के लिए खो गतिविधि, और चिकित्सीय प्रभावकारिता के लिए विकास कारकों की supraphysiological खुराक उनके नैदानिक आवेदन10सीमा. इन समस्याओं को दूर करने के लिए, विकास कारकों के बजाय वृद्धि कारक जीन के वितरण के लिए एक प्रभावी दृष्टिकोण के रूप में प्रदर्शन किया गया है osseous दोषों और रोगों11,12के उपचार के लिए प्रतिपूर्ति के लिए प्रतिक्रिया को बनाए रखने । वायरल वैक्टर ऊतक पुनर्जनन उनके उच्च एक्सप्रेस दक्षता13के कारण के लिए वितरण उपकरण का वादा कर रहे हैं ।

वृद्धि कारकों के अलावा, प्लेटलेट-व्युत्पन्न वृद्धि कारक (PDGF-BB) इस अध्ययन में चुना गया था क्योंकि यह न केवल mesenchymal और osteogenic कोशिकाओं के लिए एक mitogen और chemoattractant है, लेकिन यह भी angiogenesis के लिए एक उत्तेजक14,15 . पिछले पूर्व नैदानिक और नैदानिक अध्ययनों से पता चला है कि PDGF-BB सुरक्षित रूप से और प्रभावी ढंग से periodontal osseous दोषों16,17में हड्डी की मरंमत को बढ़ावा देने सकता है । हाल के अध्ययनों से पता चला है कि PDGF-BB vivo18,19 मेंendothelial सेल माइग्रेशन और जखीरे को प्रेरित करके angiogenesis को उत्तेजित करता है । इसके अलावा, PDGF-BB भी mesenchymal स्टेम कोशिकाओं को रेंडर कर सकते हैं (MSCs) endothelial कोशिकाओं में अंतर करने में सक्षम20, और यह आगे MSCs में neovascularization की संभावित भूमिका पर प्रकाश डाला गया. इसलिए, PDGF-BB के साथ पाड़ों में vasculature के de नोवो गठन उत्प्रेरण हड्डी ऊतक इंजीनियरिंग में पाड़ में बड़े ऊतक की मरंमत के लिए एक महत्वपूर्ण कदम है ।

अस्थि दोष हीलिंग एक गतिशील ऊतक morphogenetic प्रक्रिया है कि समंवित आस्टियोजेनेसिस और angiogenesis की मरंमत के पदों पर21की आवश्यकता है । प्रत्यारोपित ऊतक में Neoangiogenesis-इंजीनियर पाड़ एक आवश्यक पूर्व पोषक तत्वों और विकास और अस्तित्व के लिए ऑक्सीजन और चयापचय अपशिष्ट को हटाने के लिए के साथ कोशिकाओं की आपूर्ति के लिए अपेक्षित है । आमतौर पर इस्तेमाल किया इमेजिंग तरीकों, सहित एक्स-रे माइक्रो गणना टोमोग्राफी (microCT), चुंबकीय अनुनाद इमेजिंग (एमआरआई), स्कैनिंग इलेक्ट्रॉन माइक्रोस्कोपी (SEM), ऑप्टिकल जुटना टोमोग्राफी (OCT), और फोकल लेजर स्कैनिंग माइक्रोस्कोपी, के बजाय लागू कर रहे हैं ऊतकीय परीक्षा angiogenesis सूचना प्राप्त गर्न२२,२३। हालांकि, इन तरीकों visualizing और अस्थि ऊतक इंजीनियरिंग में 3 डी पाड़ में neovasculature को मापने में विभिंन बाधाओं का सामना । Multiphoton माइक्रोस्कोपी (MPM) एक तुलनात्मक उपंयास जैव इमेजिंग तकनीक है कि एक साथ के विशिष्ट लाभ है कोशिकाओं visualizing, extracellular मैट्रिक्स, और vivo में संवहनी नेटवर्क के आसपास । यह गहरी ऊतक प्रवेश के लिए एक अंतर्निहित तीन आयामी इमेजिंग क्षमता के पास और कम धूप का कारण बनता है । इसलिए, पिछले दशक में, MPM जैव चिकित्सा अध्ययन में अधिक ध्यान दिया है24, तंत्रिका विज्ञान, इम्यूनोलॉजी में सहित, और स्टेम सेल गतिशीलता । हालांकि, यह बमुश्किल आर्थोपेडिक अनुसंधान में प्रयोग किया जाता है ।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

< p class = "jove_content" > पशु देखभाल गुआंग्डोंग प्रांत के प्रयोगशाला पशुओं की देखभाल और उपयोग के लिए मार्गदर्शिका के साथ अनुपालन में था । सभी प्रक्रियाओं पशु अनुसंधान, शेन्ज़ेन उंनत प्रौद्योगिकी, चीनी अकादमी विज्ञान के संस्थानों के लिए आचार समिति के पर्यवेक्षण और अनुमोदन के तहत प्रदर्शन किया गया ।

< p class = "jove_title" > 1. Lentiviral (LV) उत्पादन

  1. क्लोन pdgf-b सीडीएनए में एक Lentiviral अभिव्यक्ति सदिश (pLenti6/5-eGFP या LV-eGFP) एक कस्टम एकाधिक-क्लोनिंग साइट cytomegalovirus एसपीई मैं और साल का उपयोग प्रमोटर के बहाव में मैं प्रतिबंध साइटों के निर्माण के लिए pLenti6/5-PDGFB-eGFP प्लाज्मिड (LV- PDGFB ) < सुप वर्ग = "xref" > 25 .
  2. वायरस पैकेजिंग के साथ सह HEK द्वारा 293FT-transfecting कोशिकाओं से lentiviral कणों (LV- pdgfb plasmids) का उत्पादन (pLP1, pLP2, और pVSV-जी) क्लोरोक्वीन के साथ मानक कैल्शियम फॉस्फेट विधि का उपयोग (अंतिम एकाग्रता: 25 & #181; M) < सुप वर्ग = "xref" > 25 .
  3. के बाद अभिकर्मक, फसल और फिल्टर ५०० मिलीलीटर वायरस युक्त supernatant के एक फिल्टर (०.४५ & #181; एम) के साथ. इसके बाद, ultracentrifugation द्वारा वायरल कणों पर ध्यान केंद्रित करने के लिए ८९,००० एक्स जी में 2 एच. के लिए २०० & #181 में reसस्पैंड, फॉस्फेट बफर खारा (पंजाब) के एल, aliquot, और स्टोर पर-८० & #176; C.
  4. के titer का निर्धारण करने के लिए lentivirus, HEK293T कोशिकाओं को प्रश्नपत्र पतला lentiviral समाधान के लिए 24 ज के लिए और गणना lentiviral titer, पहले वर्णित के रूप में < सुप वर्ग = "xref" > 25 .
< p class = "jove_title" > 2. 3 डी के निर्माण-मुद्रित PLGA/nHAp पाड़ और LV स्थिरीकरण

  1. के 20 जी भंग PLGA (पाली डी, एल-lactide-सह-glycolide) सामग्री के 20 मिलीलीटर में 1, 4-dioxane एक सजातीय समाधान के लिए फार्म । समाधान के लिए nanosized पड़ना (नैनो-hydroxyapatide) पाउडर (nHAp) के 2 जी जोड़ें; PLGA: nHAp अनुपात 10:1 (डब्ल्यू/
  2. ) होना चाहिए ।
  3. मिश्रित समाधान जोरदार हलचल (सरगर्मी गति: १,५०० rpm) 16 एच के लिए कमरे के तापमान पर एक समान पेस्ट बनाने के लिए एक चुंबकीय सरगर्मी का उपयोग कर । इसे छिद्रित PLGA/nHAp पाड़ों में एक कंप्यूटरीकृत नोक के साथ एक 3 डी कम तापमान प्रिंटर का उपयोग कर बनाना है कि पेस्ट परत-दर-परत, नीचे जमा एक डिजाइन मॉडल के अनुसार < सुप वर्ग = "xref" > 26 ; पाड़ों के आकार को ताकना २०० से लेकर ४०० & #181; m.
  4. वैक्यूम फ्रीज-४८ एच के लिए पाड़ों शुष्क के रूप में पूरी तरह से संभव के रूप में विलायक हटाने के लिए । ७५% इथेनॉल समाधान में नसबंदी और lyophilize के लिए 1 घंटे के लिए तटस्थ, रोकनेवाला पाड़ों पाने के पाड़ों सोख ।
    नोट: वैक्यूम फ्रीज-सुखाने के लिए प्रमुख मापदंडों संघनित्र तापमान (& #176; सी) और वैक्यूम डिग्री (फिलीस्तीनी अथॉरिटी) शामिल हैं । ४५ फिलीस्तीनी अथॉरिटी के एक निर्वात डिग्री के तहत, PLGA/nHAp पाड़ वैक्यूम फ्रीज में सूख रहे थे-७८ & #176; C ४८ h के लिए अच्छी तरह से विलायक हटाने के लिए ।
  5. Add 10 & #181; एल. वी. कणों (४.५ x 10 5 ) के प्रत्येक PLGA/nHAp पाड़ (4 मिमी x 4 मिमी x 2 मिमी) और 2 ज के लिए पाड़ों में ३७ & #176; C एक humidified मशीन में सोखना अनुमति देने के लिए.
  6. के बाद, पंजाबियों के साथ दो बार पाड़ों कुल्ला करने के लिए असीम LV कणों को दूर । स्नैप-फ़्रीज़ करें LV कण-लेपित पाड़ों में तरल नाइट्रोजन, lyophilize फिर से, और स्टोर पर-८० & #176; C भविष्य के उपयोग के लिए.
< p class = "jove_title" > 3. इन विट्रो कैनेटीक्स से lv कण रिहाई के पाड़ और lv Transduction गतिविधि परख

  1. गर्मी 3 डी पाड़ (4 मिमी x 4 मिमी x 2 मिमी) एल. वी.-ग्रीन फ्लोरोसेंट प्रोटीन ले (lv-eGFP, ४.५ x 10 5 LV कण) में 1 मिलीलीटर पूर्ण DMEM में २.० मिलीलीटर क्रायोजेनिक शीशियों में ३७ & #176; सी के साथ 5 दिनों के लिए मिलाते हुए.
  2. ले एक 1 मिलीलीटर नमूना हर 12 ज से 12 ज १२० ज के बाद मशीन और जगह मध्यम । हर बार बिंदु पर, नए माध्यम के बजाय 1 मिलीलीटर की मशीन मध्यम के 1 मिलीलीटर जोड़ें ।
  3. एकत्र मीडिया का उपयोग करने के लिए सह के द्वारा HEK293T कोशिकाओं transduce-४८ ज. मापने के लिए GFP-धनात्मक HEK293T कोशिकाओं की संख्या का निर्धारण करके, प्रवाह cytometry < सुप वर्ग = "xref" > २७ . HEK293T कोशिकाओं को transducing करने से पहले
    1. , कल्चरल मीडियम को निकालें और HEK293T कोशिकाओं को दो बार पंजाबियों के साथ कुल्ला करें । एकत्र मीडिया lentivirus से युक्त अच्छी तरह से पाड़ों से जारी जोड़ें (1 मिलीलीटर/HEK293T कोशिकाओं के साथ और संस्कृति ३७ & #176 पर ४८ ज के लिए एक humidified मशीन में सी ।
< p class = "jove_title" > 4. इन विट्रो अस्थि मज्जा का आकलन-एमएससी प्राप्त (BMSC) प्रवासन

  1. माइग्रेशन परख से पहले, तैयार BMSCs टमाटर फ्लोरोसेंट प्रोटीन (BMSCs-T) और PDGF-BB प्रोटीन (BMSCs-p) < सुप वर्ग = "xref" > 28 .
  2. एक Boyden चैंबर के साथ BMSC प्रवास परख प्रदर्शन एक 24 अच्छी तरह से प्लेट और 8 के एक ताकना आकार के साथ थाली और पॉली कार्बोनेट फिल्टर का उपयोग कर & #181; m.
    1. जगह ०.५ मिलीलीटर की BMSCs (5 x 10 4 ) transfected के साथ एल. वी. प्रोटीन (BMSCs-टी) ऊपरी कक्षों में । BMSCs (2 x 10 5 ) के transfected LV एक्सप्रेस के साथ PDGF-BB प्रोटीन (BMSCs-P) के निचले कक्षों में ०.५ मिलीलीटर रखें ।
  3. इस प्रयोग में छह समूह शामिल हैं और प्रत्येक कुआं के निचले डिब्बे में ५०० & #181; L को जोड़ें.
    A. रिक्त नियंत्रण, सीरम-मुक्त मध्यम केवल
    B. FBS नियंत्रण, मध्यम पूरक के साथ 10% FBS
    C. PDGF-बीबी कंट्रोल, 4 एनजी/एमएल PDGF-बीबी सीरम मुक्त माध्यम में
    डी. PDGF-बीबी जब्त ग्रुप, PDGF-बीबी (4 एनजी/एमएल) और एंटी PDGF-बीबी (4 एनजी/एमएल) polyclonal एंटीबॉडी में सीरम मुक्त मध्यम
    ई. BMSC समूह, 2 x 10 5 BMSCs सीरम-मुक्त मध्यम
    F. BMSCs-p समूह, 2 x 10 5 BMSCs-सीरम मुक्त माध्यम में पी.
  4. के लिए ४८ ज पर 5% कं 2 और ३७ & #176; सी में एक humidified मशीन । बाद में, निचले कक्ष की ओर माइग्रेट किए गए कक्षों को निकालें और उन्हें BMSCs-T की संख्या के ठहराव के लिए प्रवाह cytometry द्वारा एकत्रित करें.
    1. एक सेल खुरचना का उपयोग कर निचले चैंबर पक्ष पर माइग्रेट कोशिकाओं को हटाने और पंजाब के 2 मिलीलीटर के साथ माइग्रेट कोशिकाओं को फिर से सस्पेंड. माइग्रेट BMSCs-T की संख्या को प्रवाह से बढ़ाता है cytometry < सुप वर्ग = "xref" > 29 .
< p class = "jove_title" > 5. एक Murine Calvarial क्रिटिकल बोन दोष मॉडल और पाड़ प्रत्यारोपण की स्थापना

< p class = "jove_content" > नोट: नर बालब/चूहे (7 सप्ताह पुराने) गुआंग्डोंग चिकित्सा प्रयोगशाला पशु केंद्र (गुआंग्डोंग, चीन) से खरीदे गए ।

  1. calvarial अस्थि दोष प्रयोग के लिए कुल ४२ पुरुष चूहों का नामांकन । बेतरतीब ढंग से चूहों तीन समूहों में विभाजित, चौदह के साथ प्रत्येक समूह में है कि निम्नलिखित उपचार प्राप्त: समूह ए, कोई प्रत्यारोपण; ग्रुप बी, पीएच पाड़ प्रत्यारोपित (PLGA/nHAp); और समूह सी, PHp पाड़ों प्रत्यारोपित (PLGA/nHAp/LV- pdgfb ).
  2. Anesthetize पशुओं को सोडियम pentobarbital के intraperitoneal प्रशासन (५० मिलीग्राम/ लोमनाशक पेस्ट के साथ फर निकालें और पहले चीरा बनाने से पहले ७५% अल्कोहल समाधान के साथ सिर की त्वचा को साफ करें । एक स्टीरियोटैक्टिक साधन के साथ प्रत्येक माउस के सिर ठीक यह अभी भी सर्जरी के दौरान रखने के लिए ।
  3. एक स्केलपेल के साथ एक प्रारंभिक चीरा बनाने के लिए और फिर यह बुद्धि विस्तारएच कैंची एक 1 सेमी रैखिक त्वचा चीरा बनाने के लिए । एक बाँझ कपास झाड़ू का उपयोग कर खोपड़ी की हड्डी की सतह को प्रकट करने के लिए cranium की हड्डी से periosteum परिमार्जन.
  4. calvaria < सुप वर्ग = "xref" > 30 के बाईं ओर एक 4 मिमी व्यास महत्वपूर्ण आकार दोष बनाने के लिए एक trephine गड़गड़ाहट का उपयोग करें । अस्थि दोष स्थल में पाड़ प्रत्यारोपण ।
    नोट: क्रिटिकल साइज डिफेक्ट (सीएसडीएस) को मूल रूप से & #34 के रूप में परिभाषित किया गया था; छोटे आकार intraosseous एक विशेष हड्डी और पशु की प्रजातियों में है कि सहज रूप से पशु के जीवनकाल के दौरान ठीक नहीं होगा की प्रजाति में घाव । & #34; इस प्रयोग में 4 मिमी व्यास दोष एक क्रिटिकल आकार के अस्थि दोष है, पहले के अध्ययन के अनुसार < सुप class = "xref" > 31 , < सुप class = "xref" > 32 .
  5. उपयोग नेत्र संदंश periosteum वापस ले जाने के लिए धीरे शल्य साइट को कवर करने के लिए । प्रति सेमी तीन टांके के साथ incised त्वचा सीवन ।
  6. के बाद संचालन देखभाल करते हैं । प्रशासन दर्द को दूर करने के लिए एनाल्जेसिक buprenorphine (०.१ मिलीग्राम/ एक हीटिंग पैड के साथ शरीर के तापमान को बनाए रखने जब तक पशु जागता है । इसके बाद, पशुओं को भोजन और पानी के साथ खिलाएं और परीक्षण के अंत तक हर दिन अपनी गतिविधि रिकॉर्ड करें । नोट: Analgesia अपने स्थानीय पशु देखभाल समिति के दिशा निर्देशों के आधार पर प्रक्रिया से पहले प्रशासित किया जा सकता है । & #160;
< p class = "jove_title" > 6. में Vivo MPM के साथ अस्थि दोष के भीतर Angiogenesis की इमेजिंग

< p class = "jove_content" > नोट: FITC-संयुग्मित २५० केडी dextran (10 मिलीग्राम/खारा में नसों के द्वारा चूहों में इंजेक्ट किया गया उच्च SNR प्राप्त करने के लिए (सिग्नल-शोर अनुपात) नई रक्त वाहिकाओं की छवियाँ एक पिछले अध् ययन < सुप class = "xref" > 33 के अनुसार । & #160;P पट्टा ध्यान दें कि यह एक अस्तित्व की प्रक्रिया है । & #160;

  1. दो-फोटॉन उत्तेजित प्रतिदीप्ति (TPEF) और द्वितीय सुरीले उत्पादन संकेत (स्वसहायता) इमेजिंग के लिए multiphoton माइक्रोस्कोपी (MPM) प्रणाली को इकट्ठा करें ।
  2. Anaesthetize पशुओं के एक intraperitoneal इंजेक्शन के साथ pentobarbital सोडियम (५० मिलीग्राम/) और एक हीटिंग प्लेट पर पशुओं को स्थिर करने के लिए अपने शरीर के तापमान को बनाए रखने के ३७ & #176 प्रयोगों भर; सी । इमेजिंग प्रक्रिया के दौरान संतोषजनक संज्ञाहरण और analgesia बनाए रखने के लिए १००% ऑक्सीजन में ३.०% isoflurane गैस का प्रयोग करें । Intraperitoneally इंजेक्षन खारा (२०० & #181; L/इमेजिंग से पहले निर्जलीकरण रोकने के लिए/
  3. ने femtosecond ती-नीलम लेजर को ८६० एनएम के लिए ट्यून करें । create a ५१२ x ५१२ & #181; m नमूना क्षेत्र galvo दर्पण की एक जोड़ी स्कैनिंग करके और न का उपयोग करें 1.0 जल-विसर्जन उद्देश्य लेंस नमूना में focusthe उत्तेजना बीम करने के लिए और backscattered TPEF/स्वसहायता संकेत इकट्ठा करने के लिए ।
    नोट: इमेजिंग एक घर का निर्माण multiphoton माइक्रोस्कोपी इमेजिंग प्रणाली (MPM) पर किया गया था । इमेजिंग के दौरान, एक femtosecond ती-नीलमणि लेजर इष्टतम उत्तेजना तरंग दैर्ध्य के रूप में ८६० एनएम के लिए देखते थे । लेजर बीम रैस्टर गैल्वेनोमीटर दर्पण की एक जोड़ी का उपयोग कर एक नमूना विमान भर में स्कैन किया गया था । ६८५ एनएम के एक dichroic दर्पण के माध्यम से गुजर के बाद, बीम एक 20X न 1.0 उद्देश्य से नमूना पर ध्यान केंद्रित किया गया था । इसी उद्देश्य से उत्प्रेरणा TPEF एवं स्वसहायता संकेत एकत्र किए गए. संकेतों उत्तेजना लेजर से dichroic ऊपर उल्लेख किया और एक ६८०-एनएम लघु फिल्टर पास से शुद्ध द्वारा विभाजित किया गया । TPEF और स्वसहायता समूहों संकेत एक फाइबर बंडल द्वारा एकत्र किए गए थे और एक spectrograph के लिए आयोजित किया । spectrograph पर डिटेक्टर photomultiplier ट्यूबों (PMTs) के एक रैखिक सरणी था । spectrograph और रैखिक सरणी PMTs के संयोजन की पेशकश की क्षमता 16 लगातार वर्णक्रमीय बैंड में संकेत रिकॉर्ड करने के लिए, ४०० एनएम से ६०० एनएम के लिए, १२.५ एनएम के अंतराल पर । इसलिए, TPEF और स्वसहायता समूहों का संकेत एक ही समय में पाए गए और वर्णक्रमीय डोमेन में अलग किया गया । इसके अलावा, 3 डी इमेजिंग के लिए, एक अक्षीय मोटर इमेजिंग गहराई को नियंत्रित करने के लिए इस्तेमाल किया गया था । प्रत्येक छवि का क्षेत्र ५१२ x ५१२ & #181; m पर सेट किया गया था, और गहराई का अंतराल 2 & #181; m (नियंत्रण समूह, 5 & #181; m) पर सेट किया गया था । विशेष रूप से, प्रत्येक दोष पर 5 साइटों सांख्यिकीय महत्वपूर्ण डेटा इकट्ठा करने के लिए imaged थे, और चयनित इमेजिंग साइटों को समान रूप से और बेतरतीब ढंग से दोष के साथ वितरित किया गया.
  4. स्कैन पोत गठन मापने के लिए सांख्यिकीय महत्वपूर्ण डेटा इकट्ठा करने के लिए प्रत्येक दोष पर 5 साइटों.
    1. साइट समान रूप से स्कैनिंग और अनियमित दोष के साथ वितरित का उपयोग करें । नियंत्रण समूह के लिए, देखने के क्षेत्र (FOV) दोनों मूल हड्डी क्षेत्र और दोष के किनारे को कवर किया है, लेकिन पीएच और PHp समूहों के लिए, प्रत्यारोपित पाड़ पर FOV है ।
    2. एक 1 सेमी रैखिक त्वचा एक स्केलपेल का उपयोग चीरा और निर्धारण करने के लिए खुली त्वचा टांका प्रत्यारोपण साइट प्रकट करने के लिए बनाते हैं । एक सिरिंज का उपयोग करने के लिए सूई लेंस और प्रत्यारोपण के बीच पानी की एक बूंद जगह के लिए एक गिलास पानी के रूप में ।
  5. एक 2 एच इमेजिंग अवधि में छवि ढेर हर 12 एस प्राप्त करते हैं । कस्टम MATLAB प्रोग्राम का उपयोग करके volumetric डेटा प्रदर्शित और विश्लेषित करें और ImageJ सॉफ़्टवेयर के साथ रक्त वाहिका क्षेत्रों को बढ़ाता है < सुप वर्ग = "xref" > ३४ , < सुप वर्ग = "xref" > ३५ .
< p class = "jove_title" > 7. pdgf-b और Angiogenesis से संबंधित जीन की जीन अभिव्यक्ति का विश्लेषण आरटी द्वारा-qPCR

< p class = "jove_content" > NOTE: पीसीआर सामान्य चरणों का पालन किया गया: ९५ & #176; ग के लिए 30 s, ४० चक्र के ९५ & #176; ग के लिए 5 एस, और ६० & #176; ग के लिए 30 एस. पद-पीसीआर पिघल रही है curves एकल लक्ष्य प्रवर्धन की विशिष्टता की पुष्टि की है, और ब्याज के जीन की तह परिवर्तन के सापेक्ष & #946;-actin निर्धारित किया गया था । प्रत्येक नमूने के लिए प्रतिक्रिया तीन बार परीक्षण किया गया था ।

  1. फसल प्रत्यारोपित पाड़ों और ऊतकों प्रयोगात्मक चूहों से 2, 4, और 8 सप्ताह के बाद ऑपरेशन < सुप वर्ग = "xref" > ३६ ; नियंत्रण समूह नमूने (n = 4), एक ही समय बिंदुओं पर लिया, आसन्न हड्डी ऊतक से होना चाहिए.
    नोट: प्रत्येक समय बिंदु (2, 4, और 8 सप्ताह) में, सह 2 साँस लेना के साथ चूहों euthanized. टुकड़े calvaria और, बाद में, हटाने और calvaria से प्रत्यारोपित मचान फसल ।
  2. निर्माता & #39; s प्रोटोकॉल के अनुसार प्रत्येक नमूने से कुल आरएनए निकालने के लिए एक वाणिज्यिक एजेंट का उपयोग करें. रिवर्स प्रतिलेखन किट का प्रयोग करें रिवर्स-आरएनए के निर्माता & #39; एस प्रोटोकॉल का पालन सीडीएनए में टाइप करना ।
  3. SYBR हरे रंग का पता लगाने प्रणाली का उपयोग मात्रात्मक वास्तविक समय पीसीआर प्रदर्शन; प्राइमरों तालिका 1 में सूचीबद्ध हैं ।
< तालिका बॉर्डर = "1" फो: साथ-साथ रखें । भीतर-पृष्ठ = "1" के लिए फो: रख-साथ-साथ अगला । भीतर-पृष्ठ = "हमेशा" > < td colspan = "8" > प्राइमरी (5 & #39; & #8211; 3 & #39;) < td colspan = "2" rowspan = "1" > जीन < td colspan = "2" rowspan = "1" > फॉरवर्ड < td colspan = "4" rowspan = "1" > उलट pdgfb < टीडी colspan = "3" > CATCCGCTCCTTTGATGATCTT < टीडी colspan = "4" > GTGCTCGGGTCATGTTCAAGT vWF < टीडी colspan = "3" > CTCTTTGGGGACGACTTCATC < टीडी colspan = "4" > TCCCGAGAATGGAGAAGGAAC VEGFR2 < td colspan = "3" > GAAATGACACTGGAGCCTACA AG < td colspan = "4" > TCCATGCTGGTCACTAACAGAA G & #946;-actin < td colspan = "3" > GTATCCATGAAATAAGTGGTTAC AGG < td colspan = "4" > GCAGTACATAATTTACACAGAAG CAAT < p class = "jove_content" फो: रख-जुलकर । भीतर-पृष्ठ = "1" > तालिका 1: Pimer सेट्स.

< p class = "jove_title" > 8. अस्थि पुनर्जनन के MicroCT विश्लेषण

  1. Euthanize चूहों के साथ सह 2 साँस लेना पर 8 सप्ताह के बाद ऑपरेशन. एक अच्छी तरह हवादार वातावरण में, धीरे से एक साफ माउस पिंजरे में एक चूहा जगह और पंप सह 2 गैस पिंजरे में anaesthetize करने के लिए इच्छामृत्यु से पहले चूहों ।
  2. अस्थि दोष क्षेत्र के microCT इमेजिंग के लिए खोपड़ी टुकड़े । उपयोगकर्ता निम्न स्कैनिंग पैरामीटर प्रयोगों में: 9 & #181; m रिज़ॉल्यूशन, Al ०.५ mm फ़िल्टर, ५० केवी वोल्टेज, और १४२ & #181; A current.
  3. टोहकंपनी द्वारा प्रदान किए गए व्यावसायिक सॉफ़्टवेयर का उपयोग करके सभी इमेजिंग डेटा struct । एक CTAn सॉफ्टवेयर के अंशांकन समारोह का उपयोग कर स्कैन जांचना ।
    नोट: प्रत्येक स् कैन में चूहों के नीचे एक Hounsfield यूनिट (HU) लगाएं ।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

बेलनाकार छिद्र PLGA/nHAp पाड़ ऊंचाई में ०.६ mm और व्यास में 4 मिमी एक 3 डी प्रिंटर के साथ गढ़े थे । पाड़ों की morphologies स्कैनिंग इलेक्ट्रॉन माइक्रोस्कोपी और microCT के जरिए विश्लेषण किया गया. चित्र 1a प्रत्यारोपित पाड़ की तस्वीर से पता चलता है । MicroCT स्कैनिंग से पता चला है कि अधिक से अधिक ८५% pores २०० से ४०० µm (आंकड़ा 1b) को लेकर आकार था । SEM इमेजिंग का प्रदर्शन किया है कि पाड़ की सतह एक मोटा microtopography था, micropores के साथ (लगभग 5-10 µm व्यास) कि पाड़ के अंदर परस्पर( चित्रा 1 डी-एफ) । लगभग ४०% लेपित LV-eGFP कणों की कुल राशि (४.५ x 105) से जारी PLGA/nHAp पाड़ 24 एच के भीतर एक प्रारंभिक फट प्रभाव के साथ शुरू कर दिया । स्पर्म LV वायरस की प्रतिक्रिया 24 घंटे में शिखर संमेलन में पहुंची और फिर लगातार कम, १२० ज पर 0 में आ (चित्र 2) । इन आंकड़ों से संकेत मिलता है कि ज्यादातर पाड़-मैटीरियल LV कणों की अधिकता को ९६ ज तक बनाए रखा जा सकता है । MSCs-टी की प्रवास क्षमता FACS विधि के साथ देखा गया था कि क्या LV ले pdgf-बी सीडीएनए एक्सप्रेस और BMSC chemotaxis के लिए सीसा सकता है, के रूप में चित्रा 3 में दिखाया गया है । सकारात्मक नियंत्रण () और PDGF-BB-एक्सप्रेस समूह (F) दोनों ने अंय 4 समूहों की तुलना में BMSC माइग्रेशन का काफी उच्च स्तर दर्शाया है । इसके अलावा ग्रुप एफ में BMSCs का माइग्रेशन ग्रुप सी में उस से काफी अधिक था । अंय 4 समूहों के बीच BMSC माइग्रेशन में कोई महत्वपूर्ण अंतर नहीं थे ।

अस्थि दोष के भीतर Angiogenesis 2 से 8 सप्ताह के बाद MPM स्कैनिंग द्वारा आरोपण का आकलन किया गया था । चित्रा 4a MPM स्कैनिंग के तहत एक चूहे की एक योजनाबद्ध चित्रण दिखाता है । स्पष्ट angiogenesis पीएच और PHp समूहों में पाया गया था, लेकिन रक्त वाहिकाओं के नियंत्रण समूह में बमुश्किल देख रहे थे, जहां दोष क्षेत्र में रेशेदार झिल्ली की केवल एक परत का गठन (चित्रा 4B) । GIF रेखांकन प्रत्येक समूह (अनुपूरक डेटा) के रक्त वाहिका tomographs दिखा । नए रक्त वाहिकाओं के क्षेत्र में धीरे से समूह पीएच और PHp में समय के साथ वृद्धि हुई, इसी तरह बढ़ती पैटर्न के साथ । 8 वें सप्ताह में, जहाजों प्रारंभिक चरण में मनाया उन के लिए आकृति विज्ञान में समान दिखाई दिया; केवल परिवर्तन था कि छोटे जहाजों की एक बढ़ती हुई संख्या पाड़ों (चित्रा 4B) में बढ़ रहा था । PHp समूह के BVA सभी समय अंक (चित्र 4c) में अंय दो समूहों की तुलना में काफी अधिक था । इसके अलावा, वहां कई कोलेजन स्वभाव साइटों थे, के रूप में स्वसहायता समूहों के संकेतों से संकेत (रेखांकन और GIF रेखांकन में हरे रंग) पीएच और PHp समूह में है, लेकिन नियंत्रण समूह में नहीं (चित्रा 4B) ।

आदेश में PDGF-BB अभिव्यक्ति और angiogenesis के संबंध को स्पष्ट करने के लिए, हम के जीन प्रतिलिपि अभिव्यक्ति स्तर की तुलना में PDGF-b, vWF, और VEGFR2 पर RT-qPCR विधि के साथ 2, 4, और 8 सप्ताह के बाद आरोपण ( चित्रा 5) । के रूप में अपेक्षित, pdgf-b अभिव्यक्ति काफी PHp समूह में सभी समय अंक में वृद्धि हुई थी, के साथ एक 5-13 गुना वृद्धि नियंत्रण और पीएच समूहों की तुलना में (आंकड़ा 5) । नियंत्रण और PH समूह के बीच कोई महत्वपूर्ण अंतर नहीं था, और PDGF-BB की अभिव्यक्ति का स्तर लगभग सप्ताह 2 से सप्ताह 8 तक निरंतर बना रहा, जैसा कि चित्र 5 एमें दिखाया गया है । सभी तीन समूहों में vWF और VEGFR2 की mRNA अभिव्यक्ति का स्तर धीरे-धीरे बढ़ गया और सभी तीन समय बिंदुओं (चित्रा 5B और 5C) में PHp समूह में सबसे अधिक थे । पीएच समूह के लिए, स्पष्ट angiogenesis (चित्रा 4B) के बावजूद नियंत्रण समूह की तुलना में कोई सांख्यिकीय महत्व नहीं था ।

आगे की पुष्टि करने के लिए कि pdgf-बी-पाड़ों vivo में हड्डी पुनर्जनन को बढ़ावा देने के पुरुष बालब में गंभीर आकार calvarial दोषों का उपयोग करते हुए/सी चूहों, microCT स्कैनिंग की आपूर्ति की जानकारी के लिए अस्थि पुनर्जनन का आकलन 8 सप्ताह में पद-आरोपण । के रूप में चित्रा 6में दिखाया गया है, PHp समूह में दोषों पाड़ों में नए अस्थि ऊतक विकास के एक बड़े पैमाने से भर रहे थे, जबकि नियंत्रण और पीएच समूहों में बहुत कम नई हड्डी थी ।

Figure 1
चित्रा 1: एक 3 डी PLGA/nHAp पाड़ के संरचनात्मक लक्षण वर्णन । (एक) एक 3 डी मुद्रित पाड़ की तस्वीर । () सुपाड़े की समग्र porosity की एक microCT छवि । () 60X, 2, 000X (), 5, 000X (), और 10, 000X आवर्धन () पर SEM द्वारा मनाया पाड़ सतह के microtopography । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 2
चित्र 2: एल. वी.-GFP कणों की Lentivirus और मूल्यांकन की तैयारी । () lentiviral वेक्टर के योजनाबद्ध प्रतिनिधित्व का निर्माण । अभिकर्मक के ४८ ज के बाद प्रकाश () और प्रतिदीप्ति फील्ड (C) शर्तों के तहत HEK-293FT कोशिकाओं को मनाया गया । (D) इन विट्रो में PLGA/nHAp पाड़ों से जारी GFP कणों की संयोजी गतिविधि का आकलन । सभी डेटा मतलब ± SEM (n = 4) के रूप में प्रस्तुत कर रहे हैं । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 3
चित्र 3. PDGF-BB BMSC माइग्रेशन के एक शक्तिशाली Chemotactic कारक प्रतिक्रिया के रूप में BMSCs-टी (5 x 104) transwell मंडलों के शीर्ष पर, विभिंन शर्त मीडिया कक्षों के तल में रखा के साथ वरीयता दी गई । ( A) रिक्त नियंत्रण, सीरम-मुक्त माध्यम केवल; (B) FBS नियंत्रण, 10% FBS के साथ मध्यम पूरक; (ग) PDGF-बीबी नियंत्रण, 4 एनजी/एमएल PDGF-बीबी सीरम मुक्त माध्यम में; () PDGF-बीबी जब्त समूह, PDGF-बीबी (4 एनजी/एमएल) और एंटी PDGF-बी (4 एनजी/एमएल) polyclonal एंटीबॉडी सीरम मुक्त माध्यम में; () BMSCs समूह, २ एक्स १०BMSCs सीरम रहित माध्यम में; और () BMSCs-पी समूह, 2 x 105 BMSCs-सीरम मुक्त माध्यम में पी. सभी डेटा मतलब ± SEM (n = 4) के रूप में दिखाया जाता है । #: समूह C और अन्य सभी समूहों के बीच तुलना, समूह F को छोड़कर, # # # p & #60; ०.०००१. *: समूह F और अन्य सभी समूहों के बीच तुलना, * p & #60; ०.०५, * * * p & #60; ०.०००१. कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 4
चित्रा 4: उच्च संकल्प Multiphoton माइक्रोस्कोपी (स्वसहायता समूहों/TPEF) इमेजिंग और ठहराव माउस Calvaria के अस्थि दोष क्षेत्र में Angiogenesis ।टरोंं > () MPM स्कैनिंग के अंतर्गत माउस का एक योजनाबद्ध चित्रण. ऑरेंज सर्कल दोष साइट का प्रतिनिधित्व करता है, लाल नलिकाओं रक्त वाहिकाओं का प्रतिनिधित्व करते हैं, और हरी कोलेजन का प्रतिनिधित्व करता है. () unMPMed और संचालित पशुओं के साथ 8 सप्ताह के बाद आरोपण में स्कैन किया गया । स्वसहायता समूहों, TPEF, स्वसहायता/TPEF विलय, और 3 डी चित्र दिखाए जाते हैं । डॉटेड रेखा स्वसहायता संकेतों के आधार पर नियंत्रण समूह में अस्थि दोष के साथ सीमा का प्रतिनिधित्व करती है । () नियंत्रण के दोष क्षेत्र के भीतर रक्त वाहिका क्षेत्र ठहराव, पीएच, और PHp सप्ताह से 2 सप्ताह 8 के बाद आरोपण । सभी डेटा मतलब ± SEM (n = 5) के रूप में दिखाया गया है । : समूहों के बीच सांख्यिकीय विश्लेषण पीएच और PHp, p & #60; ०.०००१. कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 5
चित्र 5: आरटी-qPCR विश्लेषण pdgf-बी () और Angiogenesis-संबंधी जीन vWF () और VEGRF2 () के तीन समूहों में अभिव्यक्ति. 4 पशुओं से नमूने हर समय बिंदु के लिए विश्लेषण किया गया । #: PHp और PH समूहों के बीच तुलना, # p & #60; ०.०५, # # p & #60; ०.०१, और # # #p & #60; ०.०००१. *: PHp और नियंत्रण समूहों के बीच तुलना, * p & #60; ०.०५, * * p & #60; ०.०१, और * * * p & #60; ०.०००१. कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 6
चित्रा 6: MicroCT स्कैनिंग के साथ Vivo हड्डी गठन में मूल्यांकन. प्रत्यारोपित पाड़ों के बिना नियंत्रण समूह । पीएच समूह के भीतर प्रत्यारोपित PLGA/nHAp पाड़ ही । PHp समूह के भीतर प्रत्यारोपित PLGA/nHAp पाड़ LV-pdgfb कणों द्वारा संशोधित । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

हड्डी एक अद्वितीय क्षमता के साथ एक उच्च संवहनी ऊतक है लगातार चंगा करने के लिए और एक व्यक्ति के जीवनकाल भर में remodel1। आस्टियोजेनेसिस और दोष मरम्मत के लिए vascularization का स्तर महत्वपूर्ण है । कम vascularization ऊतक इंजीनियर हड्डी के व्यापक नैदानिक आवेदन सीमा । biomimetics के सिद्धांत के अनुसार एक उच्च संवहनी ऊतक इंजीनियर हड्डी का निर्माण बड़े खंड हड्डी दोषों की मरंमत के लिए एक उपकरण बन गया है । विभिन्न प्रकार के पाड़ों को सफलतापूर्वक तुलनात्मक रूप से छोटे osseous दोषों की मरंमत के लिए लागू किया गया है । हालांकि, महत्वपूर्ण अस्थि दोषों के लिए, मचान के आवेदन अभी भी बाधाओं का सामना, मुख्य रूप से दोष की मरंमत के लिए अपर्याप्त रक्त की आपूर्ति के कारण । इसलिए, बड़ी हड्डी दोषों की मरंमत की प्रक्रिया के दौरान रक्त की आपूर्ति में सुधार ऊतक इंजीनियरिंग में प्रमुख मुद्दों में से एक है ।

लोग सक्रिय सामग्री लेपित पाड़ों का उपयोग करने के लिए आवश्यक morphogenetic क्षेत्रों है कि उत्तेजित कर सकते है स्थापित करने में मदद, भर्ती, और chemotaxis, भेदभाव को बढ़ावा देने, और neovasculature और अस्थि गठन के लिए आवश्यक कोशिकाओं के प्रसार ३७. Neovasculature ऊतक में इंजीनियर मचान कोशिकाओं के लिए आवश्यक है ऑक्सीजन और पोषक तत्वों को प्राप्त करने के लिए, अपशिष्ट उत्पादों को हटाने के लिए, और अंत में पाड़ों के समारोह की पूर्ति के लिए । इस अध्ययन के उद्देश्यों के साथ angiogenesis की जांच करने के लिए थे vivo multiphoton माइक्रोस्कोपी में एक आनुवंशिक रूप से संशोधित, 3डी-प्रिंटेड PLGA/nHAp पाड़ के लिए calvarial क्रिटिकल बोन दोष मरम्मत और का उपयोग कर हड्डी पुनर्जनन के प्रभाव का मूल्यांकन करने के लिए microCT ।

अस्थि ऊतक इंजीनियरिंग में नाटकीय उपलब्धियों के बावजूद, vivo में दृश्य और ठहराव में neovascularization के अस्थि पुनर्जनन के दौरान मचान अभी भी एक चुनौती है । अधिकांश सूक्ष्म इमेजिंग प्रणालियों angiogenesis पर volumetric जानकारी प्रदान करने में असमर्थ हैं । पारंपरिक इमेजिंग तरीकों, जैसे microCT, एमआरआई, और ऊतकीय विश्लेषण, विनाशकारी, जटिल, और श्रमसाध्य है और कम स्थानिक संकल्प और लंबी छवि अधिग्रहण बार३८। हालांकि, MPM इमेजिंग एक उपंयास जैव इमेजिंग रूपरेखा है कि vivo में एक उच्च संकल्प और ंयूनतम इनवेसिव तरीके में रक्त वाहिका संकेतों पर कब्जा कर सकते हैं । यह 10 µm (चित्रा 4B) से पतले नए जहाजों का पता लगाने में सक्षम है । रक्त वाहिका छवियों के अलावा, हम भी नए कोलेजन जमाव के एक बड़े पैमाने पर (चित्रा 4B में हरे रंग और पूरक सामग्री में GIF रेखांकन), के रूप में स्वसहायता समूहों संकेत है, जो एक और कोण से हड्डी ऊतक गठन संकेत द्वारा संकेत के रूप में मनाया । सैद्धांतिक रूप से, रक्त वाहिका छवियों के विपरीत एजेंटों के उपयोग के बिना प्राप्त किया जा सकता है । हालांकि, वर्तमान अध्ययन में, हम बेहतर छवियों को पाने के लिए एक विपरीत एजेंट का इस्तेमाल किया और उचित स्कैनिंग गहराई सुनिश्चित करने के लिए स्थानीय त्वचा हटा दिया । यह अनावश्यक होगा जब अधिक शक्तिशाली इमेजिंग सिस्टम वास्तव में गैर इनवेसिव इमेजिंग के लिए भविष्य में उपलब्ध हैं ।

पड़ना अस्थि ऊतक पुनर्जनन कि व्यापक रूप से अपने अच्छे osteoconduction और osteoinduction लक्षण के कारण प्रयोग किया जाता है के लिए एक बायोमेडिकल सामग्री है । पड़ना बंधन डीएनए वैक्टर और बनाए रखने और स्थिर वैक्टर वायरल वैक्टर३९सहित की अच्छी क्षमता है । microsized पड़ना की तुलना में, nanosized पड़ना कणों उच्च विशिष्ट सतह क्षेत्रों के अधिकारी और इसलिए बेहतर सेलुलर व्यवहार और यांत्रिक गुणों को दिखाने४०। इन कारणों के लिए, nHAp कणों पाड़ों के घटकों में से एक हैं । PLGA/nHAp पाड़ की सतह और पार अनुभागीय SEM छवियां 1 चित्रा में दिखाया गया है कि गढ़े पाड़ प्रदर्शन एक अच्छी तरह से परस्पर ताकना संरचना और समान रूप से वितरित ताकना आकार दर्शाता है । जीवाणुओं पर वायरस के स्थिरीकरण वायरस गतिविधि को प्रभावित कर सकते हैं । इसलिए, हम उनके अभिकर्मक गतिविधि की जांच द्वारा पाड़ों से जारी LV कणों की प्रतिक्रिया का परीक्षण किया । पाड़ों से एल. वी. कणों की रिलीज प्रोफाइल और उनकी इन विट्रो मेंमूल्यांकन किया गया था, पांच दिनों के लिए सक्रिय LV कणों के नियंत्रित वितरण का प्रदर्शन (चित्रा 2). इसके अलावा, हमारे इन विट्रो अध्ययन PDGF की क्षमता पर ध्यान केंद्रित-बीबी प्राथमिक MSCs के प्रवास को प्रोत्साहित करने के लिए । इन परिणामों का सुझाव है कि एल. वी. कणों PDGF-बीबी और प्रभावी ढंग से उत्तेजित BMSC प्रवासन सक्रिय व्यक्त की है ।

angiogenesis और vivo मेंहड्डी पुनर्जनन के लिए क्षमता की पुष्टि करने के लिए, PHp पाड़ों murine calvarial महत्वपूर्ण अस्थि दोषों में प्रत्यारोपित किया गया । पोत गठन angiogenic मार्करों के साथ की पुष्टि की थी, आरटी qPCR विश्लेषण, और रक्त वाहिका घनत्व स्वसहायता समूहों/TPEF इमेजिंग के साथ मनाया । प्रयोगों के दोनों सेट के दोनों का प्रदर्शन किया है कि angiogenesis और रक्त वाहिका गठन आनुवंशिक रूप से संशोधित पाड़ों के उपचार के साथ काफी सुधार हुआ । इन परिणामों से संकेत मिलता है कि PDGF-BB न केवल सीधे angiogenesis को उत्तेजित करता है, लेकिन यह भी अन्य angiogenesis से संबंधित जीन लाती है. इस बीच, microCT माप प्रदर्शित करता है कि pdgf-बीयुक्त पाड़ काफी संशोधित पाड़, जो पाड़ में neovasculature के साथ अच्छी तरह से संबद्ध की तुलना में हड्डी गठन को बढ़ावा दिया । इन परिणामों से संकेत मिलता है कि आनुवंशिक रूप से संशोधित, सक्रिय पाड़ काफी angiogenesis और ऊतक पुनर्जनन में सुधार होगा ।

यहां प्रस्तुत परिणाम प्रदर्शित करता है कि पाड़ों के lentivirus मध्यस्थता आनुवंशिक संशोधन एक murine calvarial क्रिटिकल बोन दोष मॉडल, सुधार angiogenesis के माध्यम से होने की संभावना में बड़े osseous दोष मरंमत की सुविधा । इसके अलावा, vivo में MPM इमेजिंग angiogenesis और अस्थि पाड़ों में आस्टियोजेनेसिस को समझने के लिए एक अनूठा उपकरण प्रदान करता है और एक निश्चित पाड़ neovascularization के लिए फायदेमंद है या नहीं के आगे elucidation सक्षम बनाता है । Intravital multiphoton माइक्रोस्कोपी इमेजिंग ऊतकों और पाड़ों में फिजियोलॉजी और angiogenesis के pathophysiology को समझने के लिए एक मोडल प्रदान करता है । हालांकि, इस तकनीक का उपयोग करते समय कई सीमाएं हैं । सबसे पहले, शल्य तैयारी विशेष विशेषज्ञता की आवश्यकता है । सूजन unअकुशल आपरेशन के कारण काफी MPM इमेजिंग गुणवत्ता में कमी होगी । दूसरा, MPM इमेजिंग गति सीमा के कारण, एक कस्टम डिजाइन माउस सिर धारक को दिल की धड़कन और श्वसन की वजह से कलाकृतियों को कम करने की जरूरत है । तीसरा, लंबी अवधि के इमेजिंग के लिए, जानवरों intraperitoneally या नसों के साथ निर्जलीकरण को रोकने के लिए खारा के साथ इंजेक्शन होना चाहिए ।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों की घोषणा है कि वे कोई प्रतिस्पर्धा वित्तीय हितों की है ।

Acknowledgements

इस अध्ययन के शेन्ज़ेन मोर कार्यक्रम, चीन (सं. ११०८११००३५८६३३१), शेन्ज़ेन बुनियादी अनुसंधान कार्यक्रम (सं. JCYJ20150401150223631, सं. JCYJ20150401145529020, और सं. JCYJ20160331190714896), गुआंग्डोंग सार्वजनिक अनुसंधान और क्षमता निर्माण विशेष कार्यक्रम (सं. 2015A020212030), चीन के राष्ट्रीय प्राकृतिक विज्ञान फाउंडेशन (सं. ८१५०१८९३), चीन के राष्ट्रीय प्रमुख बुनियादी अनुसंधान कार्यक्रम (2013CB945503), और सियाट नवाचार कार्यक्रम के लिए उत्कृष्ट युवा शोधकर्ताओं (Y5G010) ।

Materials

Name Company Catalog Number Comments
Poly(D,L-lactide-co-glycolide) (PLGA) Sigma P1941 L/G ratio 75:25, MW 66000-107000
Hydroxyapatite nanoparticles Sigma 702153 Average diameter < 200 nm
Chloroquine diphosphate salt Sigma C6628
FITC-conjugated 250-kD dextran Sigma FD250S
1,4-dioxane lingfeng,Shanghai 0.45 micron
Stericup filters Merck Millipore Corporation SLHV033RB
PDGF-BB Cdna Sino Biological, Inc MZ50801-G
Anti-PDGF-BB mouse polyclonal antibody  BioVision, Inc 5489-30T
PDGF-BB recombinant protein 4489-50
Calcium-phosphate transfection solution Promega Corporation E1200
L-DMEM Hyclone SH30021.01
DPBS Hyclone SH30028.01
Penicillin-Streptomycin, Liquid Thermo Fisher Scientific 15140122
FBS Thermo Fisher Scientific 10099-141
Transwell  Corning 3422
Male BALB/c mice Guangdong Medical Laboratory Animal Center 
sodium pentobarbital  Merck 1063180500
multiphoton microscopy A homemade in Shenzhen Institutes of Advanced Technology to detect two-photon excited fluorescence (TPEF) and second harmonic generation signal (SHG).
isoflurane Keyuan, Shandong 401750169
TRIzol reagent Invitrogen 15596018
PrimeScript RT Master Mix (Perfect Real Time) Takara RR420B
SYBR Premix Ex Taq (Tli RNaseH Plus) Takara RR036B
Hematoxylin and eosin Beyotime C0105
Paraffin Leica  RM2235
Ultracentrifuge OPtima L-100XP Beckman Coulter L-100XP
Low-temperature printer  Tsinghua university A homemade in Tsinghua university
LightCycler 480 instrument  Roche 5815916001
microCT Bruker 1176
commercial software Bruker
Buprenorphine

DOWNLOAD MATERIALS LIST

References

  1. Hu, X., et al. GPNMB enhances bone regeneration by promoting angiogenesis and osteogenesis: potential role for tissue engineering bone. J Cell Biochem. 114, (12), 2729-2737 (2013).
  2. Schroeder, J. E., Mosheiff, R. Tissue engineering approaches for bone repair: concepts and evidence. Injury. 42, (6), 609-613 (2011).
  3. Chiarello, E., et al. allograft and bone substitutes in reconstructive orthopedic surgery. Aging Clin Exp Res. 25, S101-S103 (2013).
  4. Elangovan, S., et al. The enhancement of bone regeneration by gene activated matrix encoding for platelet derived growth factor. Biomaterials. 35, (2), 737-747 (2014).
  5. Bouyer, M., et al. Surface delivery of tunable doses of BMP-2 from an adaptable polymeric scaffold induces volumetric bone regeneration. Biomaterials. 104, 168-181 (2016).
  6. Rezwan, K., et al. Biodegradable and bioactive porous polymer/inorganic composite scaffolds for bone tissue engineering. Biomaterials. 27, (18), 3413-3431 (2006).
  7. Burg, K. J., Porter, S., Kellam, J. F. Biomaterial developments for bone tissue engineering. Biomaterials. 21, (23), 2347-2359 (2000).
  8. Xiao, Y., et al. Modifications of collagen-based biomaterials with immobilized growth factors or peptides. Methods. 84, 44-52 (2015).
  9. Chen, G., Lv, Y. Immobilization and Application of Electrospun Nanofiber Scaffold-based Growth Factor in Bone Tissue Engineering. Curr Pharm Des. 21, (15), 1967-1978 (2015).
  10. Kofron, M. D., Li, X., Laurencin, C. T. Protein- and gene-based tissue engineering in bone repair. Curr Opin Biotechnol. 15, (5), 399-405 (2004).
  11. Chen, F. M., et al. New insights into and novel applications of release technology for periodontal reconstructive therapies. J Control Release. 149, (2), 92-110 (2011).
  12. Winn, S. R., et al. Gene therapy approaches for modulating bone regeneration. Adv Drug Deliv Rev. 42, (1-2), 121-138 (2000).
  13. Chang, P. C., et al. Adenovirus Encoding Human Platelet-Derived Growth Factor-B Delivered to Alveolar Bone Defects Exhibits Safety and Biodistribution Profiles Favorable for Clinical Use. Hum Gene Ther. 20, (5), 486-496 (2009).
  14. Phipps, M. C., Xu, Y. Y., Bellis, S. L. Delivery of Platelet-Derived Growth Factor as a Chemotactic Factor for Mesenchymal Stem Cells by Bone-Mimetic Electrospun Scaffolds. Plos One. 7, (7), (2012).
  15. Gehmert, S., et al. Angiogenesis: The role of PDGF-BB on Adiopse-tissue derived Stem Cells (ASCs). Clin Hemorheol and Microcirc. 48, (1-3), 5-13 (2011).
  16. Chang, P. C., et al. PDGF-B gene therapy accelerates bone engineering and oral implant osseointegration. Gene Ther. 17, (1), 95-104 (2010).
  17. Javed, F., et al. Significance of the platelet-derived growth factor in periodontal tissue regeneration. Arch Oral Biol. 56, (12), 1476-1484 (2011).
  18. Murali, R., et al. Biomimetic hybrid porous scaffolds immobilized with platelet derived growth factor-BB promote cellularization and vascularization in tissue engineering. J Biomed Mater Res A. 104, (2), 388-396 (2016).
  19. Andrae, J., Gallini, R., Betsholtz, C. Role of platelet-derived growth factors in physiology and medicine. Genes Dev. 22, (10), 1276-1312 (2008).
  20. Wosnitza, M., et al. Plasticity of human adipose stem cells to perform adipogenic and endothelial differentiation. Differentiation. 75, (1), 12-23 (2007).
  21. Hankenson, K. D., et al. Angiogenesis in bone regeneration. Injury. 42, (6), 556-561 (2011).
  22. Schmidt, C., et al. Rapid three-dimensional quantification of VEGF-induced scaffold neovascularisation by microcomputed tomography. Biomaterials. 30, (30), 5959-5968 (2009).
  23. Perng, C. K., et al. In Vivo Angiogenesis Effect of Porous Collagen Scaffold with Hyaluronic Acid Oligosaccharides. J Surg Res. 168, (1), 9-15 (2011).
  24. Sun, Y., et al. Imaging tissue engineering scaffolds using multiphoton microscopy. Microsc Res Tech. 71, (2), 140-145 (2008).
  25. Fan, X., et al. Noninvasive monitoring of placenta-specific transgene expression by bioluminescence imaging. PLoS One. 6, (1), e16348 (2011).
  26. Yeo, M. G., Kim, G. H. Preparation and Characterization of 3D Composite Scaffolds Based on Rapid-Prototyped PCL/β-TCP Struts and Electrospun PCL Coated with Collagen and HA for Bone Regeneration. Chem Mater. 24, (5), 903-913 (2012).
  27. Mao, Y., et al. Lentiviral Vectors Mediate Long-Term and High Efficiency Transgene Expression in HEK 293T cells. Int J Med Sci. 12, (5), 407-415 (2015).
  28. Li, J., et al. Investigation of angiogenesis in bioactive 3-dimensional poly (D,L-lactide-co-glycolide)/nano-hydroxyapatite scaffolds by in vivo multiphoton microscopy in murine calvarial critical bone defect. Acta Biomater. 42, 389-399 (2016).
  29. Abbasi, H., et al. Lentiviral vector-mediated transduction of goat undifferentiated spermatogonia. Anim Reprod Sci. 163, 10-17 (2015).
  30. Pigossi, S. C., et al. Bacterial cellulose-hydroxyapatite composites with osteogenic growth peptide (OGP) or pentapeptide OGP on bone regeneration in critical-size calvarial defect model. J Biomed Mater Res A. (2015).
  31. Bos, G. D., et al. The effect of histocompatibility matching on canine frozen bone allografts. J Bone Joint Surg Am. 65, (1), 89-96 (1983).
  32. Hollinger, J. O., Kleinschmidt, J. C. The critical size defect as an experimental model to test bone repair materials. J Craniofac Surg. 1, (1), 60-68 (1990).
  33. Hollanders, K., et al. Bevacizumab Revisited: Its Use in Different Mouse Models of Ocular Pathologies. Curr Eye Res. 40, (6), 611-621 (2015).
  34. Gao, L. QSIM: quantitative structured illumination microscopy image processing in ImageJ. Biomed Eng Online. 14, 4 (2015).
  35. Kobat, D., et al. Deep tissue multiphoton microscopy using longer wavelength excitation. Opt Express. 17, (16), 13354-13364 (2009).
  36. Lohmann, P., et al. Bone regeneration induced by a 3D architectured hydrogel in a rat critical-size calvarial defect. Biomaterials. 113, 158-169 (2016).
  37. Lv, J., et al. Enhanced angiogenesis and osteogenesis in critical bone defects by the controlled release of BMP-2 and VEGF: implantation of electron beam melting-fabricated porous Ti6Al4V scaffolds incorporating growth factor-doped fibrin glue. Biomed Mater. 10, (3), (2015).
  38. Guldberg, R. E., et al. 3D imaging of tissue integration with porous biomaterials. Biomaterials. 29, (28), 3757-3761 (2008).
  39. Boehler, R. M., et al. A PLG/HAp composite scaffold for lentivirus delivery. Biomaterials. 34, (21), 5431-5438 (2013).
  40. Heo, S. J., et al. Fabrication and characterization of novel nano- and micro-HA/PCL composite scaffolds using a modified rapid prototyping process. J Biomed Mater Res A. 89, (1), 108-116 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics