Angiogenez Multiphoton mikroskobu In Vivo genetiği değiştirilmiş 3D-PLGA/nHAp İskele tarafından grefti kritik Kemik defekti tamir için görselleştirme

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Burada, damar oluşumu içinde vivo görselleştirmek için bir iletişim kuralı mevcut ve gerçek zamanlı olarak 3D İskele tarafından multiphoton mikroskobu. Genetiği değiştirilmiş iskele anjiogenez bir fare grefti kritik Kemik defekti modelinde incelenmiştir. Daha fazla yeni kan damarları tedavi grubunda denetimlerde tespit edildi.

Cite this Article

Copy Citation | Download Citations

Li, J., Jahr, H., Zheng, W., Ren, P. G. Visualizing Angiogenesis by Multiphoton Microscopy In Vivo in Genetically Modified 3D-PLGA/nHAp Scaffold for Calvarial Critical Bone Defect Repair. J. Vis. Exp. (127), e55381, doi:10.3791/55381 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Eleştirel ölçekli kemik defektleri yeniden inşası ciddi bir klinik sorun doku Mühendisliği iskele içinde zavallı angiogenez nedeniyle artış yeterli kan akımı eksikliği için verir ve yeni doku nekrozu neden olan onarım sırasında kalır. Hızlı vaskülarizasyon yeni doku hayatta kalma ve varolan ana bilgisayar doku ile tümleştirme için hayati bir önkoşuldur. İskele damarlara de novo nesil kemik rejenerasyon daha verimli bir iskele büyümeye doku onarımı izin yapımında en önemli adımlardan biridir. Bu sorunu çözmek için bir biomaterial iskele genetik değişiklik anjiogenez ve osteogenesis hızlandırmak için kullanılır. Ancak, görselleştirme ve in vivo izleme damar oluşumu içinde gerçek-zaman ve üç boyutlu (3D) İskele veya yeni kemik dokusu hala kemik doku mühendisliği için bir engel olduğunu. Multiphoton mikroskobu (MPM) biyolojik yapıları hacimsel veri yüksek çözünürlüklü ve minimal invaziv bir şekilde elde edebilirsiniz roman bir biyo-görüntüleme yöntemi var. Bu çalışmanın amacı angiogenez multiphoton mikroskobu içinde vivo grefti kritik Kemik defekti tamir için genetik olarak değiştirilmiş bir 3D-PLGA/nHAp iskele ile görselleştirmek için yapıldı. PLGA/nHAp iskele angiogenez kolaylaştırmak amacıyla ve kemik rejenerasyon geliştirmek için lentiviral vektörler (LV -pdgfb) taşıyan bir büyüme faktörü pdgf-b gen sürekli teslimat için functionalized. Fare modeli bir iskele implante grefti kritik kemik içinde defekt, PHp iskele kan damarı alanlarında (BVAs) PH iskele önemli ölçüde daha yüksekti. Buna ek olarak, ifade pdgf-b ve anjiogenezi ilgili genler, vWF ve VEGFR2, buna bağlı olarak arttı. MicroCT analiz yeni kemik oluşumu önemli ölçüde geliştirmek PHp grubunda diğer gruplar karşılaştırıldığında belirtti. Bilgimizi, bu multiphoton mikroskobu angiogenez 3D biyolojik degradable iskele vivo içinde ve gerçek zamanlı olarak araştırmak için kemik doku mühendisliğinde kullanılan ilk seferim.

Introduction

Kemik bir bireysel1kullanım süresi boyunca yeni model devam ediyor son derece bozukluklarına bir dokudur. Büyük kemik defektleri kaynaklanan travma, sendikasız, tümör rezeksiyonu veya Fasiyal malformasyonlar hızlı ve etkin kemik rejenerasyon fizyolojik karmaşık bir süreçtir. Kemik defekti tamir için kullanılan geleneksel tedavi yaklaşımları otogrefti ve homogreft implantasyon içerir, ancak bunların kullanımı birkaç sorunları ve sınırlı kullanılabilirlik, önemli donör sitesi morbidite, enfeksiyon, yüksek riski gibi sınırlamalar içerir ve bağışıklık ret2,3ev sahipliği. Ancak, yapay Kemik Greftler bu kısıtlamaları hafifletmek için etkili bir alternatif sunuyor. Onlar biyolojik olarak parçalanabilen malzemelerden yapılmış, uygun gözenek boyutu ile olmak imal etmek kolaydır ve genetiği değiştirilmiş4,5olabilir.

Şu anda, çeşitli doku Mühendisliği iskele kemik doku Mühendisliği6,7gelişiminde istihdam edilmiştir. Kemik onarım ve rejenerasyon daha etkili bir şekilde ikna etmek için tasarlanmış Biyomalzeme büyüme faktörleri ile birlikte ortaya çıktı ve iyi sonuçlar8,9elde. Ne yazık ki, kısa yarılanma, kaybetmek kolay aktivite ve büyüme faktörleri terapötik etkinlik için doz supraphysiological kendi klinik uygulama10sınırlayın. Bu sorunların üstesinden gelmek için büyüme faktörü genler büyüme faktörleri yerine teslim bioactivity kemik defektleri ve hastalıkları11,12tedavisi için sürdürebilmek için etkili bir yaklaşım olarak kanıtlanmıştır. Viral vektörleridir umut verici teslim nedeniyle verimliliği13ifade onların yüksek doku rejenerasyonu için araçlar.

Çünkü bu sadece bir mitojenle ve chemoattractant Mezenkimal ve Osteojenik hücreler için aynı zamanda bir uyarıcı angiogenez14,15 büyüme faktörleri arasında trombosit-türevi büyüme faktörü (PDGF-BB) Bu çalışmada seçildi . Önceki preklinik ve klinik çalışmalarda PDGF-BB güvenli ve etkili kemik onarım periodontal kemik defektleri16,17teşvik gösterdi. Son yıllarda yapılan çalışmalarda PDGF-BB motive edici endotel hücre göç ve nükleer silahların yayılmasına karşı vivo içinde18,19tarafından angiogenez uyarır saptandı. Ayrıca, PDGF-BB de Mezenkimal Kök hücre (MSCs) endotel hücreleri20ve daha fazla bu vurguları potansiyel rolü MSCs neovaskülarizasyon ayırt yeteneğine işleyebilir. Bu nedenle, damarlara iskele PDGF-BB ile de novo oluşumu inducing iskele kemik doku Mühendisliği büyüdü doku onarımı için önemli bir adım.

Kemik defekti şifa koordine osteogenesis ve anjiogenezi tamir pozisyonlar21gerektiren bir dinamik doku morfogenetik bir süreçtir. Neoangiogenesis içine yerleştirilmiş doku Mühendisliği iskele hücrelere besin ve oksijen gelişim ve hayatta kalma ve metabolik atık ile temini için gerekli bir önceden gerekli olduğunu. Yaygın olarak kullanılan görüntüleme yöntemleri, x-ışını dahil olmak üzere mikro tomografi (microCT), manyetik rezonans görüntüleme (MRG), tarama elektron mikroskobu (SEM), optik Koherens tomografi (OCT) ve confocal lazer mikroskobu, tarama yerine uygulanan hesaplanan Histolojik inceleme angiogenez bilgi22,23elde etmek için. Ancak, bu yöntemleri görselleştirme ve kemik doku Mühendisliği 3D iskele neovasculature ölçme çeşitli engellerle. Multiphoton mikroskobu (MPM) aynı anda hücreler, hücre dışı Matriks, görselleştirme ve damar ağları çevreleyen farklı avantajı vardır nispeten yeni bir biyo-görüntüleme tekniği olduğunu içinde vivo. Bu derin doku penetrasyon için doğal bir üç boyutlu görüntüleme özelliği sahip ve düşük duyarlilik neden olur. Bu nedenle, son on yılda çok ilgi gibi biyomedikal araştırmalar neuroscience, İmmünoloji ve kök hücre dinamiği dahil24, MPM kazanmıştır. Ancak, bu zar zor ortopedik araştırmalarında kullanılır.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

bakım ve kullanım, laboratuvar hayvanları, Guangdong Eyaleti Kılavuzu ile uyumlu hayvan bakımı yapıldı. Tüm yordamları denetim ve Etik Komitesi hayvan araştırma, Shenzhen İleri Teknoloji Enstitüleri, Çin Bilimler Akademisi için onay altında gerçekleştirilmiştir.

1. lentiviral (LV) üretim

  1. klon pdgf-b cDNA (pLenti6/5-eGFP veya LV-eGFP) lentiviral ifade vektör bir özel çoklu klonlama, içine site aşağı Spe kullanarak Sitomegalovirüs düzenleyicinin ben ve Sal Ben 25 pLenti6/5-PDGFB-eGFP plazmid (LV - pdgfb) oluşturmak için kısıtlama siteleri.
  2. Lentiviral parçacıklar (LV - pdgfb) virüs ambalaj plazmid (pLP1, pLP2 ve pVSV-G) ile birlikte transfecting tarafından HEK - 293 FT hücrelerden üretmek klorokin ile standart Kalsiyum fosfat yöntemiyle (son konsantrasyonu: 25 µM) 25.
  3. transfection 48 saat sonra hasat ve virüs içeren 500 mL filtre filtre (0,45 µm) ile süpernatant. Daha sonra viral parçacıkların ultrasantrifüj 89,000 x g 2 h. Resuspend 200 µL serum (PBS), aliquot fosfat tamponlu için de tarafından konsantre ve depolamak-80 ° C.
  4. Lentivirus titresi belirlemek için 24 h için seri olarak seyreltilmiş lentiviral çözüm HEK293T hücrelerle kuluçkaya ve yukarıda açıklanan 25 olarak lentiviral titresi hesaplamak.

2. PLGA/nHAp iskele 3D baskılı ve LV immobilizasyon imalatı

  1. Dissolve 20 g PLGA (Poli D, L-lactide-co-glycolide) malzeme homojen bir çözüm oluşturmak için 1,4-dioxane 20 ml. Mikro HAp (nano-hydroxyapatide) toz (nHAp) 2 g ekleyin; PLGA: nHAp oranı 10:1 (w/w) olmalıdır.
  2. Karışık çözüm stir şiddetle (hız karıştırma: 1500 devir/dakika) 16 h düzgün bir hamur oluşturmak için bir manyetik karıştırıcı kullanarak için oda sıcaklığında. İçine Yapıştır katman katman, alt üst, mevduat bilgisayarlı bir meme ile 3D düşük sıcaklık yazıcı kullanan gözenekli PLGA/nHAp iskele göre önceden tasarlanmış modeli 26 imal; İskele gözenek boyutları aralığı 200 ile 400 µm.
  3. Vakum için solvent gibi tamamen kaldırmak 48 h iskele şeytanibir. % 75 etanol çözüm sterilizasyon için 1 h iskele ıslatın ve tarafsız, aseptik iskele almak için lyophilize.
    Not: yoğuşma sıcaklığı (° C) ve vakum derecesi (Pa) vakum dağılması için önemli parametreleri içerir. Bir vakum derecesi 45 altında Pa, PLGA/nHAp iskele iyice çözücü kaldırmak 48 h için-78 ° C'de dondurulmuş vakum edildi.
  4. Ekleyin 10 µL LV parçacıkların (4.5 x 10 5) ve her PLGA/nHAp (4 x 4 x 2 mm) İskele yapısı-İskele adsorpsiyon izin vermek için oksijen bir kuluçka 37 ° C'de 2 h için kuluçkaya.
  5. İskele ilişkisiz LV parçacıkları kaldırmak için iki kez PBS ile immobilizasyon sonra durulayın. Ek-LV parçacık kaplı iskele sıvı azot donma, tekrar lyophilize ve-80 ° c ileride kullanmak üzere saklamak.

3. Vitro Kinetik LV parçacık sürüm iskele ve LV iletim etkinliği tahlil

  1. Incubate 3D İskele (4 x 4 x 2 mm) taşıma LV-yeşil flüoresan protein (LV-eGFP, 4.5 x 10 5 LV parçacıklar) 2.0 ml kriyojenik tam DMEM 1 ml şişeleri 37 ° C'de 5 gün boyunca sallayarak ile.
  2. 120 h sonrası kuluçka 12 h her 12 h 1 mL örnek almak ve orta yerine. Her zaman yere, 1 mL 1 mL kuluçka orta yerine taze orta ekleyin.
  3. HEK293T hücreleri 48 h. GFP pozitif HEK293T belirleyerek tarafından biyoaktif LV parçacıkları sayısı hücreleri tarafından Akış Sitometresi 27 ölçü için ortak tarafından kuluçka transduce için toplanan medya kullanın.
    1. HEK293T hücre transducing önce kültür orta kaldırın ve HEK293T hücrelerle iki kez PBS durulayın. Lentivirus içeren toplanan medya serbest iskele iyi (1 mL/de) eklemek ve bir oksijen kuluçka 37 ° C'de 48 h için HEK293T hücreler kültür.

4. Vitro Kemik iliği türevi MSC (BMSC) geçiş değerlendirilmesi

  1. domates floresan protein (BMSCs-T) ve PDGF-BB protein (BMSCs-P) 28 ifade BMSCs geçiş tahlil önce hazırlayın.
  2. BMSC geçiş tahlil Boyden Odası 8 µm gözenek büyüklüğü ile 24-şey plaka ve Polikarbonat filtreleri kullanarak gerçekleştirmek.
    1. Yer BMSCs 0.5 mL (5 x 10 4) transfected ile domates floresan protein (BMSCs-T) üst odalarında ifade LV. BMSCs 0,5 mL yerleştirin (2 x 10 5) transfected LV PDGF-BB protein (BMSCs-P) daha düşük odalarında ifade ile.
  3. Bu denemeye altı gruba dahil ve 500 µL her şey alt bölüme ekleyin.
    A. Denetim, serum-Alerjik orta sadece boş
    B. FBS denetim, orta % 10 ile desteklenmiş FBS
    C. PDGF-BB kontrolü, 4 ng/mL PDGF-BB serum-Alerjik orta
    ö. PDGF-BB ele geçirmek grup, PDGF-BB (4 ng/mL) ve anti-PDGF-BB (4 ng/mL) poliklonal antikor Serum-Alerjik orta
    E. BMSC grup, 2 x 10 5 BMSCs serum-Alerjik orta
    F. BMSCs-P grubu, 2 x 10 5 BMSCs-P serum özgür ortamda.
  4. % 5 CO 2 ve 37 ° C oksijen kuluçka 48 s kuluçkaya. Daha sonra geçirilen hücre alt odası tarafında kaldırma ve Akış Sitometresi tarafından BMSCs-T sayısı miktar için koleksiyon yapıyorum.
    1. Alt odası üzerinde geçirilen hücrelerin hücre kazıyıcı kullanarak yan ve PBS 2 mL geçirilen hücrelerle resuspend kaldır. Akış Sitometresi 29 tarafından geçirilen BMSCs-T sayısını ölçmek.

5. Kurulması bir fare grefti kritik Kemik defekti modeli ve İskele nakli

Not: erkek BALB/c fare (7 hafta eski) Guangdong tıbbi laboratuvar hayvan Merkezi'nden (Guangdong, Çin) satın.

  1. Kayıt toplam 42 erkek farelerde kemik grefti hatası için denemeler yapın. Rasgele üç gruba, her grupta aşağıdaki tedaviler almak on dört ile fareler bölün: Grup A, hiçbir implantlar; Grup B, PH iskele implante (PLGA/nHAp); ve C grubu, implante PHp İskele (PLGA/nHAp/LV-pdgfb).
  2. Sodyum Fentobarbital (50 mg/kg) mayi yönetim hayvanlarla anestezi. Kürk depilatory yapıştır ile çıkarın ve ilk kesi yapmadan önce baş cilt %75 Alkol çözeltisi ile temizleyin. Hala ameliyat sırasında tutmak için stereotaktik bir enstrüman ile her fare başkanı düzeltmek.
  3. İlk kesik bir neşter ile yapmak ve sonra zekâ büyütmek1-cm doğrusal cilt kesi oluşturmak için s makas. Kafatasının bir steril pamuklu çubukla kullanarak kafatası kemik yüzeyine ortaya çıkarmak için kemikten kapaklarini kazımak.
  4. Trephine burr 30 calvaria sol tarafında bir 4 mm çaplı kritik boyutu kusur oluşturmak için kullanın. İskele Kemik defekti siteye nakli.
    Not: Kritik boyut defektleri (CSDs) ilk olarak tanımlanmış olan " en küçük boyutunu intraosseous yara belirli kemik ve hayvan yaşamı boyunca kendiliğinden sarılmayacak hayvan tür " bu deneyde, 4 mm çaplı kusur bir kritik boyutu kemik kusurdur göre daha önce 31 , 32 çalışma.
  5. Oftalmik forseps kapaklarini geri hafifçe cerrahi sitesi kapsayacak şekilde taşımak için kullanın. Cm başına üç dikiş ile kazıma deri dikiş.
  6. Post-operational bakım gerçekleştirmek. Ağrı gidermek için analjezik buprenorfin (0.1 mg/kg) yönetmek için. Hayvan uyanır kadar bir Isıtma yastığı ile vücut ısısını korumak. Daha sonra yiyecek ve su ile hayvan besleme ve faaliyetlerini her gün test sonuna kadar kayıt. Not: Analjezi yordama bağlı olarak senin yerel hayvan bakımı Komitesi yönergeleri. önce yönetilemez duruma gelir

6. Vivo Angiogenez içinde Kemik defekti MPM ile görüntüleme

Not: FITC Birleşik 250 kD dextran (10 mg/mL) serum fizyolojik içinde intravenöz yüksek-SNR (sinyal-gürültü oranı) görüntü yeni kan damarlarının elde etmek fareler enjekte bir önceki çalışmada 33 göre. Bu bir hayatta kalma yordam. unutmayın ki

  1. İki fotonlu heyecanlı floresan (TPEF) ve ikinci harmonik üretimi sinyal (SHG) görüntüleme için multiphoton mikroskobu (MPM) sistemi montajı.
  2. Fentobarbital sodyum (50 mg/kg) mayi bir enjeksiyon hayvanlarla uyuşturan ve hayvanlar üzerinde deneyler boyunca 37 ° C'de onların vücut ısısını korumak için ısıtma yüzeyi hareketsiz. %3.0 isoflurane gaz % 100 oksijen tatmin edici anestezi ve analjezi görüntüleme işlemi sırasında korumak için kullanın. İntraperitoneally görüntüleme önce su kaybı önlemek için (200 µL/hayvan) serum enjekte.
  3. Tune için 860 Ti-Sapphire femtosecond lazer nm. Bir çift galvo aynalar tarayarak bir 512 x 512 µm örnekleme alanı oluşturmak ve NA1.0 su-daldırma objektif lens focusthe uyarma ışın için örnek içine ve backscattered TPEF/SHG sinyal toplamak için kullanın.
    Not: Görüntüleme bir ev-yapı multiphoton mikroskobik görüntüleme sistemi (MPM) gerçekleştirildi. Görüntüleme sırasında bir Ti-Sapphire femtosecond lazer 860 için ayarlanmıştı nm olarak en uygun uyarma dalga boyu. Lazer ışını bir çift galvanometre aynalar kullanarak örnek uçağa taranan raster yapıldı. 685 bir dikroik aynadan geçtikten sonra nm, ışın bir 20 X NA1.0 hedefi tarafından numune üzerinde duruldu. İndüklenen TPEF ve SHG sinyalleri aynı amaç tarafından toplanmıştır. Sinyalleri uyarma lazer yukarıda belirtilen ve 680 nm kısa geçiren Filtre tarafından arıtılmış dikroik ayna tarafından ayrılmış. TPEF ve SHG sinyalleri bir lif paket tarafından toplanmış ve yürütülen bir spektrograf. Spektrograf üzerinde Dedektör photomultiplier tüp (PMTs) doğrusal bir dizi yapıldı. Spektrograf ve doğrusal dizi PMTs ile birlikte 400 16 üst üste spektral bantlarında sinyal kaydedebilir yeteneği teklif nm 600 nm, 12,5-nm aralıklarla. Bu nedenle, TPEF ve SHG sinyalleri aynı zamanda tespit ve spektral etki alanlarına ayrılmış. Ayrıca, 3D görüntüleme için görüntüleme derinliğini kontrol etmek için bir Aksiyel motor kullanıldı. Her resmin 512 x 512 µm için kuruldu ve derinlik aralığı 2 µm (kontrol grubu, 5 mikron) kuruldu. Özellikle, her kusur 5 sitelerinde istatistiksel olarak anlamlı veri toplamak için yansıma ve seçilen görüntü siteleri kusur eşit ve rastgele dağıtıldı.
  4. Damar oluşumu ölçmek için istatistiksel olarak anlamlı veri toplamak üzere her kusur sitelerinde tarama 5.
    1. Kullanımı tarama siteleri kusur eşit ve rastgele dağıtılmış. Kontrol grubu için orijinal kemik alan ve defekt kenarından (FOV) kapak görüntüleme alanında sahip ama PH ve PHp grubu için FOV implante iskele üzerinde olan.
    2. Bir neşter kullanarak bir 1 cm doğrusal cilt kesi yapmak ve açık cilt nakli site ortaya çıkarmak için fiksasyon için dikiş. Bir damla su daldırma objektif ve su bardağı oluşturmak üzere nakli arasında yerleştirmek için bir şırınga kullanın.
  5. Edinme resmi yığar her 12 dönem Imaging bir 2s bitti. Görüntülemek ve özel bir MATLAB programı kullanarak hacimsel veri analiz ve ImageJ yazılım 34 , 35 ile kan damarı alanları ölçmek.

7. Gen ifade analizi pdgf-b ve anjiogenezi ilgili genler tarafından RT-qPCR

Not: PCR gerçekleştirilen her zamanki adımları takip: 30 95 ° C s, 40 devredir 5 95 ° c s ve 30 s. Post-PCR erime için 60 ° C tek hedef amplifikasyon özgüllük eğrileri doğruladı ve β-aktin göre faiz gen kat değişikliği tespit edildi. Tepki her örnek için üç kez test edildi.

  1. Hasat implante iskele ve deneysel fareler 2, 4 ve 8 hafta sonrası işlemi 36 dokulardan; grup örnekleri kontrol (n = 4), aynı zaman zamanlarda alınan, bitişik kemik dokusundan olmalıdır.
    Not: her zaman noktası (2, 4 ve 8 hafta), CO 2 inhalasyon ile fareler euthanized. Calvaria incelemek ve, daha sonra kaldırmak ve calvaria dan implante iskele hasat.
  2. Her örnek üreticiye göre toplam RNA ayıklamak için ticari bir reaktif kullanın ' s protokolü. Tersine çevirmek için ters transkripsiyon seti kullanın-RNA üretici takip cDNA uyarlamak ' s protokolü.
  3. SYBR yeşil algılama sistemi; kullanarak gerçekleştir nicel gerçek zamanlı PCR astar Tablo 1 ' de listelenen.
Primer(5'–3')
Gen İleri ters
pdgfb CATCCGCTCCTTTGATGATCTT GTGCTCGGGTCATGTTCAAGT
vWF CTCTTTGGGGACGACTTCATC TCCCGAGAATGGAGAAGGAAC
VEGFR2 GAAATGACACTGGAGCCTACA AG TCCATGCTGGTCACTAACAGAA G
β-aktin GTATCCATGAAATAAGTGGTTAC AGG GCAGTACATAATTTACACAGAAG CAAT

Tablo 1: Pimer kümeleri.

8. kemik rejenerasyon analizini MicroCT

  1. 8 hafta sonrası operasyonda CO 2 inhalasyon ile Euthanize fareler. İyi havalandırılmış bir ortamda, yavaşça her fare temiz fare kafesin içine yerleştirin ve ötenazi önce fareler uyuşturan kafes içine CO 2 gaz pompa.
  2. Kafatası kemik defekti bölgesinin microCT görüntüleme için incelemek. Kullanıcı aşağıdaki tarama parametrelerini deneylerde: 9 µm çözünürlük, Al 0,5 mm filtre, 50 kV gerilim ve 142 µA geçerli.
  3. ReconYapı ticari yazılım kullanarak tüm görüntüleme verileri şirket tarafından sağlanan. CTAn yazılım kalibrasyon işlevini kullanarak tarar kalibre.
    Not: her taramada Hounsfield birim (HU) fareler altında yerleştirin.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Silindirik gözenekli PLGA/nHAp 0.6 mm içinde yükseklik iskele ve 4 mm çapında bir 3D printerlere harcama maddeler ile fabrikasyon. İskele türleri Morfoloji elektron mikroskobu ve microCT tarama yolu ile analiz edildi. Şekil 1A implante iskele fotoğrafı gösterir. MicroCT tarama fazla % 85 gözenekleri 200 ile 400 µm (şekil 1B) bedenleri vardı ortaya koydu. SEM görüntüleme iskele yüzeyinin İskele (şekil 1 D-F) içinde birbirine micropores (çapları yaklaşık 5-10 µm) ile bir kaba microtopography olduğunu gösterdi. Kaplamalı LV-eGFP parçacıklar toplam miktarı yaklaşık % 40 (4.5 x 105) 24 saat içinde bir ilk patlama etkisi ile başladı PLGA/nHAp iskele serbest. 0 120 h (Şekil 2) olarak yaklaşan 24 h Zirvesi'nde ulaştı ve sonra sürekli olarak azalmış, yayımlanan LV virüs bioactivity. Bu veriler en iskele immobilize LV parçacıkların bioactivity 96 s için muhafaza olabilir gösterir. MSCs-T geçiş kapasitesini pdgf-b cDNA taşıyan LV ve hızlı yol için BMSC Kemotaksis, gösterildiği gibi araştırmaya FACS yöntemi ile gözlenmiştir şekil 3. Pozitif kontrol (C) ve (F) PDGF BB ifade grubu BMSC geçiş 4 diğer gruplar daha anlamlı olarak daha yüksek bir düzeyde sergiledi. Buna ek olarak, BMSCs F grubu içinde geçirilmesi önemli ölçüde grup c daha yüksek BMSC geçiş 4 diğer gruplar arasında hiçbir önemli farklılıklar vardı.

Angiogenez Kemik defekti içinde 2 den 8 hafta sonrası implantasyon için tarama MPM tarafından değerlendirildi. Şekil 4A MPM tarama altında bir fare bir şematik çizimde gösterilmektedir. Açık angiogenez PH ve PHp gruplarında algılandı ancak nerede sadece kusur bölge genelinde fibröz membranlar tabakası (şekil 4B) oluşan zar zor observable kontrol grubunda kan damarları vardı. GIF grafikleri her grubun (Ek veri) damar tomographs göster. Yeni kan damarları alan yavaş yavaş zaman içinde gruplar PH ve PHp, benzer artan desenlerle arttı. 8 hafta, damarlar içinde morfolojisi benzer bu erken aşamada gözlenen ortaya çıktı; giderek artan sayıda daha küçük damarları İskele (4B rakam) büyüyordu tek değişiklikti. PHp grubu BVA iki diğer grupları hiç puan (şekil 4 c) zaman önemli ölçüde daha yüksektir. Ayrıca, birçok kollajen birikimi sitesi, SHG sinyalleri (grafikler ve GIF grafikleri yeşil renk) PH ve PHp gruplarının ama kontrol grubu (şekil 4B) gösterildiği gibi vardı.

PDGF-BB ifade ve anjiogenezi arasındaki ilişkiyi açıklamak için biz gen transkript ifade düzeyleri pdgf-b, vWFve VEGFR2 2, 4 ve 8 hafta sonrası implantasyon ( RT-qPCR yöntemi ile karşılaştırıldığında Şekil 5). Beklendiği gibi pdgf-b ifade önemli ölçüde tüm zaman puan, PHp grubuna denetim ve PH grupları (şekil 5A) göre 5 - 13 kat artarak yükseltilmiştir. Denetim ve PH grup arasında anlamlı bir fark vardı ve PDGF-BB ifade düzeyini neredeyse şekil 5A' gösterildiği gibi hafta 8, 2 haftadan sabit kaldı. Üç grup mRNA ifade seviyelerinde vWF ve VEGFR2 yavaş yavaş arttı ve PHp grubu içinde olduğunu üç puan (şekil 5B ve 5 C) zaman. PH grubu için açık angiogenez (şekil 4B) rağmen kontrol grubuna göre istatistiksel önemi vardı.

Daha fazla bu pdgf-bonaylamak için-içeren iskele teşvik kemik rejenerasyon vivo içinde eleştirel ölçekli grefti kusurları erkek BALB/c farelerde kullanarak, microCT tarama sağlanan bilgi kemik rejenerasyon 8 hafta değerlendirmek için sonrası implantasyon. Oysa kontrol ve bunu PH daha az yeni kemik şekil 6' da gösterildiği gibi kusurları PHp grubunda yeni kemik dokusu ingrowth iskele içinde bir kitle doluydu.

Figure 1
Şekil 1: yapısal bir 3D PLGA/nHAp iskele karakterizasyonu. (A)bir 3D yazdırılan iskele fotoğrafı. İskele genel porozite (B) A microCT görüntüsü. (C) İskele yüzeyinin microtopography gözlenen SEM tarafından 60 X, 2.000 X (D), 5000 X (E) ve 10.000 X büyütme (F). Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 2
Resim 2: Lentivirus ve Bioactivity LV-GFP parçacıkların değerlendirilmesi hazırlanması. (A)lentiviral vektör yapı şematik gösterimi. Transfection, 48 saat sonra HEK - 293FT hücreleri ışık (B) ve floresan alan (C) koşulları altında tespit edildi. (D) bioactivity üst üste PLGA/nHAp iskele yayımlanan LV-GFP parçacıkların vitro değerlendirilmesi. Tüm veriler ortalama ± SEM sunulmaktadır (n = 4). Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 3
Şekil 3. BMSC göçün güçlü kemotaktik faktör yanıt olarak PDGF-BB Bioactivity. BMSCs-T (5 x 104) üstüne transwell chambers, çeşitli koşul medya odaları altına yerleştirilir ile seribaşı. (A)boş kontrolü, serum-Alerjik orta sadece; (B) FBS kontrol, % 10 ile desteklenmiş orta FBS; (C) PDGF-BB kontrolü, 4 ng/mL PDGF-BB serum serbest ortamda; (D) PDGF-BB ele geçirmek grup, PDGF-BB (4 ng/mL) ve anti-PDGF-BB (4 ng/mL) poliklonal antikor serum-Alerjik orta; (E) BMSCs, 2 x 105 BMSCs serum-Alerjik orta grup; ve (F) BMSCs-P grup, 2 x 105 BMSCs-P serum-Alerjik orta. Tüm veriler ortalama ± SEM gösterilir (n = 4). #: Grup C ve F, # p grubu dışında tüm diğer gruplar arasında karşılaştırma < 0,0001. *: F Grubu ve diğer gruplar arasında karşılaştırma * p < 0,05, *** p < 0,0001. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 4
Şekil 4: Yüksek çözünürlüklü Multiphoton mikroskobu (SHG/TPEF) görüntüleme ve miktar angiogenez fare Calvaria Kemik defekti bölgesinde.Trong > MPM tarama altında bir fare (A) A şematik gösterimi. Turuncu daire kusuru sitesinde, kırmızı tübüllerin kan damarları temsil ve yeşil kollajen temsil eder. (B) Unoperated ve işletilen hayvan MPM ile 8 hafta sonrası implantasyonu tarandı. SHG, TPEF, SHG/TPEF birleştirilmiş ve 3D görüntü gösterilir. Noktalı çizgi boyunca SHG sinyalleri alan kontrol grubu kemik üründe sınır gösterir. (C) damar alan miktar defekt alanı içinde denetim, PH ve PHp hafta 2 hafta 8 sonrası implantasyon için. Tüm veriler ortalama ± SEM gösterilir (n = 5). : İstatistiksel analiz grupları PH ve PHp, p arasında < 0,0001. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 5
Şekil 5: Pdgf-b (a)ve anjiogenezi ile ilgili genleri vWF (B) ve VEGRF2 (C) ifade üç grupta RT-qPCR analizi. Örnekleri 4 hayvanlardan her zaman noktası için analiz. #: PHp ve PH grupları, # p arasında karşılaştırma < 0,05, # p < 0,01 ve #p < 0,0001. *: PHp ve kontrol grupları arasında karşılaştırma * p < 0,05, ** p < 0,01, ve *** p < 0,0001. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 6
Şekil 6: Vivo içinde kemik oluşumunu MicroCT tarama ile değerlendirilmesi. Kontrol grubunda implante iskele olmadan. PH grup içinde PLGA/nHAp iskele sadece implante. PHp grubu içinde implante PLGA/nHAp İskele yapısı-İskele LV- pdgfb moleküller tarafından değiştirilmiş. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Kemik sürekli iyileştirmek ve bir bireysel1ömür boyu yeni model için benzersiz bir kapasite ile son derece bozukluklarına bir dokudur. Vaskülarizasyon düzeyini osteogenesis ve arıza onarım için önemlidir. Düşük vaskülarizasyon kemik doku Mühendisliği geniş klinik uygulama sınırlar. Son derece bozukluklarına doku Mühendisliği kemik Biyomimetik teorisine göre inşa büyük kesimi kemik kusurları onarmak için bir araç haline gelmiştir. İskele çeşitli nispeten küçük kemik defektleri onarmayı başarıyla uygulandı. Ancak, kritik kemik defektleri, hala yüzleri engeller, onarmak için iskele uygulanması için esas olarak yetersiz kan nedeniyle arıza onarım için kaynağı. Bu nedenle, kan akımı büyük kemik defektleri onarma işlemi sırasında doku Mühendisliği önemli konulardan biri geliştirmektedir.

İnsanlar biyoaktif malzeme kaplı iskele teşvik, işe ve Kemotaksis, farklılaşma ve neovasculature ve kemik oluşumu için gerekli hücrelerin çoğalması teşvik gerekli morfogenetik alanları kurmak için yardımcı olması için kullanın 37. Neovasculature doku Mühendisliği iskele hücrelere oksijen ve besinlerin çöplerimiz, kaldırılması için almak için gerekli olan ve sonuçta iskele fonksiyonu yerine getirilmesi için. Bu çalışmada hedefleri anjiogenez bir genetik olarak değiştirilmiş, 3D baskılı PLGA/nHAp iskele grefti kritik Kemik defekti tamir için in vivo multiphoton mikroskobu ile araştırmaya ve kemik rejenerasyon kullanarak etkilerini değerlendirmek için idi microCT.

Kemik doku Mühendisliği, VIVO görselleştirme ve İskele neovaskülarizasyon miktar kemik sırasında dramatik başarıları rağmen rejenerasyon hala bir sorundur. En mikroskobik görüntüleme sistemleri üzerinde angiogenez hacimsel bilgi sağlayamıyoruz. MicroCT, MRI ve histolojik analizler, gibi geleneksel görüntüleme yöntemleri yıkıcı, karmaşık ve zahmetli ve düşük kayma sahiptir ve uzun resim alma38kez. Ancak, MPM görüntüleme kan damarı yakalayabilir roman bir biyo-görüntüleme yöntemidir vivo içinde yüksek-kararlılık ve minimal invaziv bir şekilde sinyalleri vardır. Yeni gemiler 10 µm (şekil 4B) ince tespit edebilmektedir. Kan damarı görüntüler yanı sıra, biz de yeni kollajen birikimi (şekil 4B yeşil renkte) ve ek malzeme GIF grafiklerde bir kitle kemik doku oluşumunu başka bir açıdan belirtmek SHG sinyalleri gösterildiği gibi gözlenen. Teorik olarak, kan damarı görüntülerin kontrast ajanları kullanmadan elde edilebilir. Ancak, mevcut çalışmada, bir kontrast Aracısı daha iyi görüntüler elde etmek için kullanılan ve uygun tarama derinlik sağlamak için yerel cilt kaldırıldı. Daha güçlü görüntüleme sistemleri gerçekten non-invaziv görüntüleme için gelecekte kullanılabilir olduğunda bu gereksiz olacaktır.

Hap'ı, iyi osteoconduction ve osteoindiksiyon özellikleri nedeniyle yaygın olarak kullanılan kemik doku rejenerasyonu için biyomedikal bir malzemedir. HAp DNA vektörel çizimler bağlama ve istinat ve Vektörler, viral vektörler39da dahil olmak üzere sabit iyi özelliği vardır. Microsized HAp karşılaştırıldığında, mikro HAp parçacıklar yüksek belirli yüzey alanları sahip ve bu nedenle daha iyi hücresel davranış ve mekanik özellikleri40göster. Bu nedenlerden dolayı nHAp parçacıklar iskele bileşenlerden biridir. Şekil 1'deki PLGA/nHAp iskele yüzey ve kesitsel SEM görüntüleri gösterir fabrikasyon iskele iyi birbirine bağlı gözenek yapısı ve düzgün dağıtılmış gözenek boyutları sergilemek. Virüs biomaterial taşıyıcıları üzerine immobilizasyon virüs etkinliğini etkileyebilir. Bu nedenle, bioactivity transfection faaliyetlerini inceleyerek iskele yayımlanan LV parçacıkların test ettik. İskele ve onların bioactivities LV parçacıkların yayın profilleri değerlendirilmiş vitrobiyoaktif LV parçacıkların kontrollü teslimat beş gündür (Şekil 2) gösteren, vardı. Ayrıca, bizim vitro çalışma PDGF-BB potansiyeli birincil MSCs göç teşvik üzerinde duruldu. Bu sonuçlar LV parçacıklar ifade biyoaktif PDGF-BB ve etkili bir şekilde uyarılmış BMSC geçiş öneririz.

Angiogenez ve kemik rejenerasyon vivo içindekapasiteli onaylamak için PHp iskele fare grefti kritik kemik defektleri implante edildi. Damar oluşumu anjiogenik işaretleri, RT-qPCR analiz ve damar yoğunluğu ile SHG/TPEF görüntülemede gözlenen doğrulandı. Deneyler iki kümesi her ikisi de anjiogenez ve damar oluşumu genetiği değiştirilmiş iskele tedavisi ile belirgin bir biçimde iyileştirilmiş gösterdi. Bu sonuçlar PDGF-BB sadece doğrudan angiogenez uyarır, ancak aynı zamanda diğer angiogenez ilgili genler neden olmaktadır gösterir. Bu arada, o pdgf-bmicroCT ölçümleri göstermek-iskele önemli ölçüde içeren terfi olan iskele neovasculature ile iyi kemik oluşumu değiştirilmemiş iskele için karşılaştırıldığında. Bu sonuçları, genetik olarak değiştirilmiş, biyoaktif iskele önemli ölçüde anjiogenez ve doku rejenerasyonu geliştirmek gösterir.

Burada sunulan sonuçlar iskele lentivirus-aracılı genetik değişiklik büyük Kemik defekti tamir büyük olasılıkla yoluyla geliştirilmiş angiogenez bir fare grefti kritik Kemik defekti modelindeki kolaylaştırır gösterilmektedir. Ayrıca, in vivo MPM görüntüleme anjiogenez ve osteogenesis kemik anlamak için eşsiz bir araç iskele ve belirli bir iskele neovaskülarizasyon için yararlı olup daha fazla aydınlatma sağlar sağlar. İntravital multiphoton mikroskobu görüntüleme fizyolojisi ve patofizyolojisi angiogenez doku ve İskele anlamak için bir yöntem sağlar. Ancak, bu tekniği kullanırken bazı sınırlamaları vardır. İlk olarak, cerrahi hazırlık belirli uzmanlık gerektirir. İltihap vasıfsız işlemi tarafından neden olduğu kalite Imaging MPM önemli ölçüde azalır. İkinci olarak, hız sınırlama Imaging MPM nedeniyle, özel olarak tasarlanmış fare kafa tutucu kalp ve solunum neden eserler azaltmak için gereklidir. Üçüncü olarak, uzun vadeli görüntüleme için hayvanlar intraperitoneally veya intravenöz su kaybı önlemek için serum enjekte gerekir.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar onlar rakip hiçbir mali çıkarları var bildirin.

Acknowledgements

Bu çalışmada Shenzhen tavus kuşu Program tarafından Çin (No. 110811003586331), Shenzhen temel araştırma programı (No desteklenmiştir JCYJ20150401150223631, No. JCYJ20150401145529020 ve No JCYJ20160331190714896), Guangdong ortak araştırma ve kapasite geliştirme özel Program (No. 2015A020212030), Çin (No. 81501893) Ulusal Doğa Bilimleri temeli, Çin (2013CB945503), ulusal Major Basic araştırma programı ve Mükemmel genç araştırmacılar (Y5G010) için SIAT yenilik Program.

Materials

Name Company Catalog Number Comments
Poly(D,L-lactide-co-glycolide) (PLGA) Sigma P1941 L/G ratio 75:25, MW 66000-107000
Hydroxyapatite nanoparticles Sigma 702153 Average diameter < 200 nm
Chloroquine diphosphate salt Sigma C6628
FITC-conjugated 250-kD dextran Sigma FD250S
1,4-dioxane lingfeng,Shanghai 0.45 micron
Stericup filters Merck Millipore Corporation SLHV033RB
PDGF-BB Cdna Sino Biological, Inc MZ50801-G
Anti-PDGF-BB mouse polyclonal antibody  BioVision, Inc 5489-30T
PDGF-BB recombinant protein 4489-50
Calcium-phosphate transfection solution Promega Corporation E1200
L-DMEM Hyclone SH30021.01
DPBS Hyclone SH30028.01
Penicillin-Streptomycin, Liquid Thermo Fisher Scientific 15140122
FBS Thermo Fisher Scientific 10099-141
Transwell  Corning 3422
Male BALB/c mice Guangdong Medical Laboratory Animal Center 
sodium pentobarbital  Merck 1063180500
multiphoton microscopy A homemade in Shenzhen Institutes of Advanced Technology to detect two-photon excited fluorescence (TPEF) and second harmonic generation signal (SHG).
isoflurane Keyuan, Shandong 401750169
TRIzol reagent Invitrogen 15596018
PrimeScript RT Master Mix (Perfect Real Time) Takara RR420B
SYBR Premix Ex Taq (Tli RNaseH Plus) Takara RR036B
Hematoxylin and eosin Beyotime C0105
Paraffin Leica  RM2235
Ultracentrifuge OPtima L-100XP Beckman Coulter L-100XP
Low-temperature printer  Tsinghua university A homemade in Tsinghua university
LightCycler 480 instrument  Roche 5815916001
microCT Bruker 1176
commercial software Bruker
Buprenorphine

DOWNLOAD MATERIALS LIST

References

  1. Hu, X., et al. GPNMB enhances bone regeneration by promoting angiogenesis and osteogenesis: potential role for tissue engineering bone. J Cell Biochem. 114, (12), 2729-2737 (2013).
  2. Schroeder, J. E., Mosheiff, R. Tissue engineering approaches for bone repair: concepts and evidence. Injury. 42, (6), 609-613 (2011).
  3. Chiarello, E., et al. allograft and bone substitutes in reconstructive orthopedic surgery. Aging Clin Exp Res. 25, S101-S103 (2013).
  4. Elangovan, S., et al. The enhancement of bone regeneration by gene activated matrix encoding for platelet derived growth factor. Biomaterials. 35, (2), 737-747 (2014).
  5. Bouyer, M., et al. Surface delivery of tunable doses of BMP-2 from an adaptable polymeric scaffold induces volumetric bone regeneration. Biomaterials. 104, 168-181 (2016).
  6. Rezwan, K., et al. Biodegradable and bioactive porous polymer/inorganic composite scaffolds for bone tissue engineering. Biomaterials. 27, (18), 3413-3431 (2006).
  7. Burg, K. J., Porter, S., Kellam, J. F. Biomaterial developments for bone tissue engineering. Biomaterials. 21, (23), 2347-2359 (2000).
  8. Xiao, Y., et al. Modifications of collagen-based biomaterials with immobilized growth factors or peptides. Methods. 84, 44-52 (2015).
  9. Chen, G., Lv, Y. Immobilization and Application of Electrospun Nanofiber Scaffold-based Growth Factor in Bone Tissue Engineering. Curr Pharm Des. 21, (15), 1967-1978 (2015).
  10. Kofron, M. D., Li, X., Laurencin, C. T. Protein- and gene-based tissue engineering in bone repair. Curr Opin Biotechnol. 15, (5), 399-405 (2004).
  11. Chen, F. M., et al. New insights into and novel applications of release technology for periodontal reconstructive therapies. J Control Release. 149, (2), 92-110 (2011).
  12. Winn, S. R., et al. Gene therapy approaches for modulating bone regeneration. Adv Drug Deliv Rev. 42, (1-2), 121-138 (2000).
  13. Chang, P. C., et al. Adenovirus Encoding Human Platelet-Derived Growth Factor-B Delivered to Alveolar Bone Defects Exhibits Safety and Biodistribution Profiles Favorable for Clinical Use. Hum Gene Ther. 20, (5), 486-496 (2009).
  14. Phipps, M. C., Xu, Y. Y., Bellis, S. L. Delivery of Platelet-Derived Growth Factor as a Chemotactic Factor for Mesenchymal Stem Cells by Bone-Mimetic Electrospun Scaffolds. Plos One. 7, (7), (2012).
  15. Gehmert, S., et al. Angiogenesis: The role of PDGF-BB on Adiopse-tissue derived Stem Cells (ASCs). Clin Hemorheol and Microcirc. 48, (1-3), 5-13 (2011).
  16. Chang, P. C., et al. PDGF-B gene therapy accelerates bone engineering and oral implant osseointegration. Gene Ther. 17, (1), 95-104 (2010).
  17. Javed, F., et al. Significance of the platelet-derived growth factor in periodontal tissue regeneration. Arch Oral Biol. 56, (12), 1476-1484 (2011).
  18. Murali, R., et al. Biomimetic hybrid porous scaffolds immobilized with platelet derived growth factor-BB promote cellularization and vascularization in tissue engineering. J Biomed Mater Res A. 104, (2), 388-396 (2016).
  19. Andrae, J., Gallini, R., Betsholtz, C. Role of platelet-derived growth factors in physiology and medicine. Genes Dev. 22, (10), 1276-1312 (2008).
  20. Wosnitza, M., et al. Plasticity of human adipose stem cells to perform adipogenic and endothelial differentiation. Differentiation. 75, (1), 12-23 (2007).
  21. Hankenson, K. D., et al. Angiogenesis in bone regeneration. Injury. 42, (6), 556-561 (2011).
  22. Schmidt, C., et al. Rapid three-dimensional quantification of VEGF-induced scaffold neovascularisation by microcomputed tomography. Biomaterials. 30, (30), 5959-5968 (2009).
  23. Perng, C. K., et al. In Vivo Angiogenesis Effect of Porous Collagen Scaffold with Hyaluronic Acid Oligosaccharides. J Surg Res. 168, (1), 9-15 (2011).
  24. Sun, Y., et al. Imaging tissue engineering scaffolds using multiphoton microscopy. Microsc Res Tech. 71, (2), 140-145 (2008).
  25. Fan, X., et al. Noninvasive monitoring of placenta-specific transgene expression by bioluminescence imaging. PLoS One. 6, (1), e16348 (2011).
  26. Yeo, M. G., Kim, G. H. Preparation and Characterization of 3D Composite Scaffolds Based on Rapid-Prototyped PCL/β-TCP Struts and Electrospun PCL Coated with Collagen and HA for Bone Regeneration. Chem Mater. 24, (5), 903-913 (2012).
  27. Mao, Y., et al. Lentiviral Vectors Mediate Long-Term and High Efficiency Transgene Expression in HEK 293T cells. Int J Med Sci. 12, (5), 407-415 (2015).
  28. Li, J., et al. Investigation of angiogenesis in bioactive 3-dimensional poly (D,L-lactide-co-glycolide)/nano-hydroxyapatite scaffolds by in vivo multiphoton microscopy in murine calvarial critical bone defect. Acta Biomater. 42, 389-399 (2016).
  29. Abbasi, H., et al. Lentiviral vector-mediated transduction of goat undifferentiated spermatogonia. Anim Reprod Sci. 163, 10-17 (2015).
  30. Pigossi, S. C., et al. Bacterial cellulose-hydroxyapatite composites with osteogenic growth peptide (OGP) or pentapeptide OGP on bone regeneration in critical-size calvarial defect model. J Biomed Mater Res A. (2015).
  31. Bos, G. D., et al. The effect of histocompatibility matching on canine frozen bone allografts. J Bone Joint Surg Am. 65, (1), 89-96 (1983).
  32. Hollinger, J. O., Kleinschmidt, J. C. The critical size defect as an experimental model to test bone repair materials. J Craniofac Surg. 1, (1), 60-68 (1990).
  33. Hollanders, K., et al. Bevacizumab Revisited: Its Use in Different Mouse Models of Ocular Pathologies. Curr Eye Res. 40, (6), 611-621 (2015).
  34. Gao, L. QSIM: quantitative structured illumination microscopy image processing in ImageJ. Biomed Eng Online. 14, 4 (2015).
  35. Kobat, D., et al. Deep tissue multiphoton microscopy using longer wavelength excitation. Opt Express. 17, (16), 13354-13364 (2009).
  36. Lohmann, P., et al. Bone regeneration induced by a 3D architectured hydrogel in a rat critical-size calvarial defect. Biomaterials. 113, 158-169 (2016).
  37. Lv, J., et al. Enhanced angiogenesis and osteogenesis in critical bone defects by the controlled release of BMP-2 and VEGF: implantation of electron beam melting-fabricated porous Ti6Al4V scaffolds incorporating growth factor-doped fibrin glue. Biomed Mater. 10, (3), (2015).
  38. Guldberg, R. E., et al. 3D imaging of tissue integration with porous biomaterials. Biomaterials. 29, (28), 3757-3761 (2008).
  39. Boehler, R. M., et al. A PLG/HAp composite scaffold for lentivirus delivery. Biomaterials. 34, (21), 5431-5438 (2013).
  40. Heo, S. J., et al. Fabrication and characterization of novel nano- and micro-HA/PCL composite scaffolds using a modified rapid prototyping process. J Biomed Mater Res A. 89, (1), 108-116 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics