Visualisere angiogenese af Multiphoton mikroskopi In Vivo i genetisk modificerede 3D-PLGA/nHAp stillads til Calvarial kritiske knogle defekt reparation

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Vi præsenterer her, en protokol for at visualisere blodkar dannelse i vivo og i realtid i 3D stilladser af multiphoton mikroskopi. Angiogenese i genetisk modificerede stilladser blev studeret i en murine calvarial kritiske knogle defekt model. Flere nye blodkar blev opdaget i gruppen behandling end kontrol.

Cite this Article

Copy Citation | Download Citations

Li, J., Jahr, H., Zheng, W., Ren, P. G. Visualizing Angiogenesis by Multiphoton Microscopy In Vivo in Genetically Modified 3D-PLGA/nHAp Scaffold for Calvarial Critical Bone Defect Repair. J. Vis. Exp. (127), e55381, doi:10.3791/55381 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Genopbygningen af kritisk størrelse knogledefekter forbliver en alvorlig klinisk problem på grund af dårlig angiogenese inden for væv-manipuleret stilladser under reparation, som giver anledning til en manglende tilstrækkelig blodforsyning og forårsager nekrose af nyt væv. Hurtig vascularization er en afgørende forudsætning for nye væv overlevelse og integration med eksisterende værten væv. De novo generation af Vaskulaturen i stilladser er et af de vigtigste skridt i at gøre knogle regenerering mere effektivt, giver mulighed for reparation væv til at vokse ind i et stillads. For at tackle dette problem, er den genetiske modifikation af en biomateriale stillads anvendes til at fremskynde angiogenese og osteogenesis. Men, visualisere og spore i vivo blodkar dannelse i realtid og i tre-dimensionelle (3D) stilladser eller nyt knoglevæv er stadig en hindring for knogle vævsmanipulering. Multiphoton mikroskopi (MPM) er en roman bio-imaging modalitet, der kan erhverve volumetriske data fra biologiske strukturer i en høj opløsning og minimalt invasiv måde. Formålet med denne undersøgelse var at visualisere angiogenese med multiphoton mikroskopi i vivo i en genetisk modificerede 3D-PLGA/nHAp stillads til calvarial kritiske knogle defekt reparation. PLGA/nHAp stilladser blev functionalized for vedvarende levering af en vækstfaktor pdgf-b genet bærer lentiviral vektorer (LV -pdgfb) for at lette angiogenese og forbedre knogle regenerering. I et stillads-implanteret calvarial kritiske knogle defekt musemodel, blodkar områder (BVAs) i PHp stilladser var betydeligt højere end i PH stilladser. Derudover steg udtryk af pdgf-b og angiogenese-relaterede gener, vWF og VEGFR2, tilsvarende. MicroCT analyse viste, at den nye knogledannelse i gruppen PHp dramatisk forbedret sammenlignet med de andre grupper. Til vores viden er det første gang multiphoton mikroskopi blev brugt i knoglen vævsmanipulering for at undersøge angiogenese i en 3D bio-nedbrydelige stillads i vivo og i realtid.

Introduction

Bone er en yderst vaskulariserede væv, der fortsætter med at remodel i løbet af en enkelt1. Hurtig og effektiv knogle regenerering af store knogledefekter som følge af traumer, ophelet, tumor resektion eller kraniofaciale misdannelser er et komplekst fysiologisk proces. Traditionelle terapeutiske metoder anvendes til knogle defekt reparation omfatter autograft og allograft implantation, men deres anvendelse indebærer flere problemer og begrænsninger, såsom begrænset tilgængelighed, væsentlig donor site sygelighed, en høj risiko for infektion, og vært immun afvisning2,3. Men kunstig knogle vin tilbyder et effektivt alternativ til at afhjælpe disse begrænsninger. De kan være fremstillet af bionedbrydelige materialer, er let at fremstille med en egnet porestørrelse og kan være genetisk modificerede4,5.

I øjeblikket har forskellige tissue engineering stilladser været ansat i udviklingen af væv-manipuleret knogle6,7. For at fremkalde knogle reparation og regeneration mere effektivt, har manipuleret biomaterialer kombineret med vækstfaktorer opstået og opnåede gode resultater8,9. Desværre begrænse kort halveringstid, let at miste aktivitet og suprafysiologiske dosering af vækstfaktorer for terapeutisk virkning deres kliniske anvendelse10. For at overvinde disse problemer, har levering af vækstfaktor gener i stedet for vækstfaktorer vist sig som en effektiv metode til at fastholde bioactivity til behandling af ossøse defekter og sygdomme11,12. Virale vektorer er lovende levering værktøjer til vævsregeneration på grund af deres høje udtrykker effektivitet13.

Blandt vækstfaktorer, blev Trombocyt-afledt vækst faktor (PDGF-BB) valgt i denne undersøgelse, fordi det er ikke kun en mitogen og chemoattractant for mesenchymale og osteogenic celler, men også en stimulans for angiogenese14,15 . Tidligere prækliniske og kliniske undersøgelser viste, at PDGF BB kunne sikkert og effektivt fremme bone reparation i parodontale ossøse defekter16,17. Nylige undersøgelser afslørede, at PDGF BB stimulerer angiogenese af motiverende endotel celle migration og spredning i vivo18,19. Derudover kan PDGF BB også gengive mesenchymale stamceller (msc) i stand til at differentiere i endothelial celler20, og denne yderligere højdepunkter MSCs potentielle rolle i neovascularization. Inducerende de novo dannelsen af Vaskulaturen i stilladser med PDGF BB er derfor et vigtigt skridt for reparation af væv vokset til stilladser i knoglen vævsmanipulering.

Defekt knogleheling er en dynamisk væv morfogenetiske proces, som kræver koordineret osteogenesis og angiogenese på reparation positioner21. Neoangiogenesis i implanterede væv-manipuleret stilladser er en afgørende forudsætning for at levere celler med næringsstoffer og ilt til vækst og overlevelse og til fjernelse af metaboliske affald. Almindeligt anvendt imaging metoder, beregnet herunder X-ray mikro-tomografi (microCT), magnetisk resonans imaging (MR), scanning elektronmikroskopi (SEM), optisk kohærens tomografi (OCT) og konfokal laser scanning mikroskopi, anvendes i stedet for Histologisk undersøgelse at opnå angiogenese oplysninger22,23. Disse metoder står imidlertid over forskellige forhindringer i visualisering og måling af neovasculature i 3D stilladser i knoglen vævsmanipulering. Multiphoton mikroskopi (MPM) er en forholdsvis ny bio-imaging teknik, der har særskilte fordelen ved samtidig visualisere celler, ekstracellulære matrix, og de omkringliggende vaskulære netværk in vivo. Det har en iboende tredimensional billeddannelse evne til dybe væv penetration og forårsager lav solskader. Derfor, i det sidste årti, MPM har fået meget opmærksomhed i biomedicinsk undersøgelser24, herunder i neurovidenskab, immunologi og stamceller dynamik. Dog er det næppe anvendes i ortopædiske forskning.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

dyrs pleje var i overensstemmelse med vejledning i pleje og brug af laboratoriet dyr i Guangdong provinsen. Alle procedurer er udført under tilsyn og godkendelse af den etiske komité for Animal forskning, Shenzhen Institutes of Advanced Technology, kinesiske Academy of Sciences.

1. lentiviral (LV) produktion

  1. klon pdgf-b cDNA ind lentiviral udtryk vektor (pLenti6/5-eGFP eller LV-eGFP) på en brugerdefineret multiple-kloning site nedstrøms cytomegalovirus selskabet benytter Spe jeg og Sal Jeg begrænsning websteder til at konstruere pLenti6/5-PDGFB-eGFP plasmid (LV - pdgfb) 25.
  2. Producerer lentiviral partikler (LV - pdgfb) fra HEK - 293 FT celler af co transfecting med virus emballage plasmider (pLP1, pLP2 og pVSV-G) ved hjælp af metoden standard calciumphosphat med chloroquin (endelig koncentration: 25 µM) 25.
  3. efter 48 h af Transfektion, høst og filtrere 500 mL af virus-holdige supernatanten med et filter (0,45 µm). Efterfølgende, koncentrere de virale partikler af ultracentrifugering ved 89.000 x g i 2 h. Resuspend i 200 µL af fosfatbufferet saltopløsning (PBS), alikvot, og opbevares ved-80 ° C.
  4. For at bestemme titer af lentivirus, inkuberes HEK293T celler med seriefremstillede fortyndet lentiviral løsning for 24 h og beregne lentiviral titer, som tidligere beskrevet 25.

2. Fabrikation af 3D-trykt PLGA/nHAp stilladser og LV immobilisering

  1. opløse 20 g af PLGA (Poly D, L-lactide-co-glycolide) materiale i 20 mL 1,4-dioxan danner en homogen opløsning. Der tilsættes 2 g af nanosized HAp (nano-hydroxyapatide) pulver (nHAp) løsning; PLGA: nHAp forhold bør være 10:1 (w/w).
  2. Blandet opløsningen omrøres kraftigt (omrøring hastighed: 1.500 omdr. / min.) ved stuetemperatur til 16 h med en magnetomrører til at danne et ensartet pasta. Fremstil det til porøse PLGA/nHAp stilladser ved hjælp af en 3D lavtemperaturs printer med en edb dyse, at indskud pasta lag på lag, bund til top, ifølge en foruddesignet model 26; pore størrelser af stilladser spænder fra 200 til 400 µm.
  3. Vakuum frysetørre stilladser for 48 h fjerne opløsningsmiddel så fuldstændigt som muligt. Blød stilladser i 75% ethanol opløsning i 1 time til sterilisation og lyophilize for at få neutrale, aseptisk stilladser.
    Bemærk: De vigtigste parametre for vakuum frysetørring omfatter kondens temperatur (° C) og vakuum grad (Pa). Under en vakuum graden af 45 Pa, PLGA/nHAp stilladser var vakuum frysetørret ved-78 ° C for 48 h grundigt fjerne opløsningsmidlet.
  4. Tilføje 10 µL af LV partikler (4,5 x 10 5) til hver PLGA/nHAp stillads (4 mm x 4 mm x 2 mm), og der inkuberes stilladser i 2 timer ved 37 ° C i en fugtig inkubator tillade adsorption.
  5. Efter immobilisering, skyl stilladser to gange med PBS fjerne ubundne LV partikler. Snap-freeze LV partikel-belagt stilladser i flydende kvælstof, lyophilize igen og opbevares ved-80 ° C til fremtidig brug.

3. In Vitro Kinetik af LV partikel frigivelse fra stilladser og LV transduktion aktivitet Assay

  1. Incubate 3D stilladser (4 mm x 4 mm x 2 mm) regnskabsmæssige LV-grøn fluorescerende proteiner (LV-eGFP, 4,5 x 10 5 LV partikler) i 1 mL af komplette DMEM i 2,0 mL kryogene hætteglas ved 37 ° C under omrystning i 5 dage.
  2. Tage en 1 mL prøve hver 12 h fra 12 timer til 120 h efter inkubation og erstatte mediet. På hvert tidspunkt, tilsættes 1 mL frisk medium i stedet for 1 mL af inkubation medium.
  3. Bruger de indsamlede medier til transduce HEK293T celler af co inkubere for 48 h. foranstaltning antallet af bioaktive LV partikler ved fastsættelsen af antallet af normal god landbrugspraksis-positive HEK293T celler ved flow flowcytometri 27.
    1. Inden transducing HEK293T celler, fjerne næringssubstratet og skyl HEK293T celler to gange med PBS. Tilføj den indsamlede medier indeholdende lentivirus frigivet fra stilladser til brønd (1 mL/hul) og kultur med HEK293T cellerne i 48 timer ved 37 ° C i en fugtig inkubator.

4. In Vitro Vurdering af knoglemarv-afledte MSC (BMSC) Migration

  1. før migration assay, forberede BMSCs at udtrykke tomat fluorescerende proteiner (BMSCs-T) og PDGF BB protein (BMSCs-P) 28.
  2. Udføre BMSC migration assay med en Boyden kammer med en 24-godt plade og polycarbonat filtre med en porestørrelse på 8 µm.
    1. Sted 0,5 mL af BMSCs (5 x 10 4) transfekteret med LV udtrykker tomat fluorescerende proteiner (BMSCs-T) i de øverste kamre. 0,5 ml af BMSCs (2 x 10 5) transfekteret med LV udtrykker PDGF BB protein (BMSCs-P) i den nederste kamre.
  3. Omfatter seks grupper i dette eksperiment og tilføje 500 µL til det nedre rum i hver brønd.
    A. blank kontrol, serumfrit medium kun
    B. FBS kontrol, medium suppleret med 10% FBS
    C. PDGF-BB kontrol, 4 ng/mL PDGF BB i serumfrit medium
    D. PDGF-BB gribe PDGF BB-gruppen (4 ng/mL) og anti-PDGF-BB (4 ng/mL) polyklonale antistof i serumfrit medium
    E. BMSC gruppe, 2 x 10 5 BMSCs i serumfrit medium
    F. BMSCs-P gruppe, 2 x 10 5 BMSCs-Pedersen i serum gratis medium.
  4. Der inkuberes i 48 h på 5% CO 2 og 37 ° C i en fugtig inkubator. Bagefter, Fjern de overflyttede celler på den nedre kammer side og samle dem til kvantificering af antallet af BMSCs-T ved flowcytometri.
    1. Fjern overflyttede celler på den nedre kammer side ved hjælp af en celle skraber og resuspend de overflyttede celler med 2 mL PBS. Kvantificere antallet af overførte BMSCs-T af flow flowcytometri 29.

5. Etablering af en Murine Calvarial kritiske knogle defekt Model og stillads Transplantation

Bemærk: mandlige BALB/c mus (7 uger gamle) blev købt fra Guangdong medicinsk laboratorium animalsk Center (Guangdong, Kina).

  1. Registrer alt 42 mandlige mus til den calvarial knogle defekt eksperimentere. Tilfældigt opdele musene i tre grupper med 14 i hver gruppe, som modtager følgende behandlinger: gruppe A, ingen implantater; Gruppe B, PH stilladser implanteret (PLGA/nHAp); og gruppe C, PHp stilladser implanteret (PLGA/nHAp/LV-pdgfb).
  2. Bedøver dyr med intraperitoneal indgift af natrium pentobarbital (50 mg/kg). Fjern skind med depilatory pasta og ren den hoved hud med 75% alkoholopløsning inden du foretager det første snit. Fix lederen af hver mus med et stereotactic instrument til at holde det stadig under kirurgi.
  3. Gøre en indledende snit med en skalpel og derefter udvide det with saks til at oprette en 1 cm lineær hud indsnit. Skrabe periosteum fra knogler i kraniet at afsløre knoglen overfladen af kraniet ved hjælp af en steril vatpind.
  4. Oprette en 4 mm-diameter kritiske størrelse defekt i venstre side af calvaria 30 ved hjælp af en trephine burr. Transplantation skafottet i knoglen defektstedets.
    Bemærk: Kritiske størrelse defekter (værdipapircentraler) var oprindelig defineret som " den mindste størrelse intraossøs sår i en bestemt ben og arter af dyr, der ikke vil heles spontant i løbet af dyret. " i dette eksperiment, 4 mm-diameter defekt er en kritisk størrelse knogle defekt, i henhold til den tidligere undersøgelse 31 , 32.
  5. Bruge oftalmologiske pincet til at flytte periosteum tilbage forsigtigt at dække operationsstedet. Sutur indridset huden med tre sting pr. cm.
  6. Udføre under pleje. Administrere den analgetiske buprenorphin (0,1 mg/kg) for at lindre smerter. Opretholde kropstemperaturen med en varmepude, indtil dyret vågner. Efterfølgende, fodre dyrene med foder og vand og optage deres aktivitet hver dag indtil slutningen af testen. Bemærk: Analgesi kan gives før proceduren afhængigt af din lokale dyrs pleje Udvalget retningslinjer.

6. In Vivo Imaging af angiogenese inden for knogle defekt med MPM

Bemærk: FITC-konjugeret 250 kD dextran (10 mg/mL) i saltvand var intravenøst sprøjtes ind i musene at opnå høj-SNR (signal til støj-forhold) billeder af nye blodkar Ifølge en tidligere undersøgelse 33. Bemærk venligst at dette er en overlevelse procedure.

  1. samle multiphoton mikroskopi (MPM) system for to-foton ophidset fluorescens (TPEF) og anden harmonisk generation signal (SHG) billeddannelse.
  2. Anaesthetize dyr med en intraperitoneal injektion med pentobarbital natrium (50 mg/kg) og immobilisere dyrene på en varme plade til at opretholde deres kropstemperatur på 37 ° C i hele eksperimenterne. Bruge 3.0% isofluran gas i 100% ilt for at opretholde tilfredsstillende anæstesi og analgesi under billedprocessen. Intraperitoneal Injicér saltvand (200 µL/dyr) for at forhindre dehydrering før imaging.
  3. Tune femtosekund Ti-safir laser til 860 nm. Oprette en 512 x 512 µm prøveudtagning område ved at scanne et par af galvo spejle og bruge NA1.0 vand-fordybelse mål linse til focusthe excitation stråle ind i prøven og til at indsamle backscattered TPEF/SHG signalet.
    Bemærk: Imaging blev udført på en hjem-build multiphoton mikroskopiske imaging system (MPM). Under imaging, en femtosekund Ti-safir laser var tunet til 860 nm som den optimale excitations bølgelængde. Laserstrålen var raster scannet på tværs af en stikprøve fly ved hjælp af et par af Drejespoleinstrument spejle. Efter at have passeret gennem en dichroic spejl af 685 nm, bjælken var fokuseret på modellen af en 20 X NA1.0 mål. De inducerede TPEF og SHG signaler blev indsamlet af de samme mål. Signalerne blev delt fra excitation laser af dichroic spejlet nævnt ovenfor og renset af en 680-nm kort-pass filter. TPEF og SHG signalerne blev indsamlet af en fiber bundt og ført til en spektrograf. Detektor på spektrograf var en lineær array af photomultiplier rør (PMTs). Kombinationen af spektrograf og lineær array PMTs tilbudt kapacitet til at optage signalet i 16 træk spektrale bands, fra 400 nm til 600 nm, med 12,5-nm intervaller. Derfor, TPEF og SHG signalerne blev opdaget på samme tid og adskilt i spektrale domæner. Desuden, for 3D imaging, en aksial motor blev brugt til at styre den billeddiagnostiske dybde. Inden for hvert billede blev angivet til 512 x 512 µm, og dybde interval blev sat til 2 µm (kontrolgruppe, 5 µm). Især, 5 steder på hver fejl var afbildet for at indsamle statistisk signifikante data, og de udvalgte imaging lokaliteter blev fordelt jævnt og tilfældigt langs defekten.
  4. Skan 5 steder på hver defekt at indsamle statistisk signifikante data for at måle fartoej formation.
    1. Brug scanning websteder jævnt og tilfældigt fordelt langs defekten. For kontrolgruppen, har inden for view (FOV) dækker både oprindelige knogle området og kanten af defekten, men for grupperne PH og PHp har FOV på implanterede skafottet.
    2. Laver et 1 cm lineær hud indsnit ved hjælp af en skalpel og sutur åben huden til fiksering til at afsløre webstedet transplantation. Bruge en sprøjte til at placere en dråbe vand mellem dypper linse og transplantationer til at danne et vandglas.
  5. Erhverve billede stakke hver 12 s over en 2 h imaging periode. Få vist og analysere volumetriske data ved hjælp af en brugerdefineret MATLAB program og sætte tal på blodkarrenes områder med ImageJ software 34 , 35.

7. Gen Expression analyse af pdgf-b og angiogenese-relaterede gener af RT-qPCR

Bemærk: PCR blev udført efter sædvanlige trin: 95 ° C til 30 s, 40 cyklusser af 95 ° C til 5 s og 60 ° C i 30 s. Post-PCR smeltning kurver bekræftet specificiteten af single-mål forstærkning, og fold ændringen af interesse i forhold til β-actin-genet blev fastsat. Reaktion for hver prøve blev testet tre gange.

  1. Høst implanteret stilladser og væv fra de eksperimentelle mus på 2, 4 og 8 uger efter operationen 36; kontrol gruppe prøver (n = 4), taget på de samme tidspunkter, bør være fra tilstødende knoglevæv.
    Bemærk: For hvert tidspunkt (2, 4 og 8 uger), euthanized mus med CO 2 indånding. Dissekere calvaria, og efterfølgende fjerne og høste de implanterede stilladser fra calvaria.
  2. Bruger en kommerciel reagens til at udtrække den samlede RNA fra hver prøve ifølge producenten ' s protokol. Bruge Reverse transkription Kit til reverse-transskribere RNA i cDNA efter fabrikanten ' s protokol.
  3. Udføre kvantitative real-time PCR ved hjælp af SYBR Green Detection System; primere er angivet i tabel 1.
Primer(5'–3')
gen frem vende
pdgfb CATCCGCTCCTTTGATGATCTT GTGCTCGGGTCATGTTCAAGT
vWF CTCTTTGGGGACGACTTCATC TCCCGAGAATGGAGAAGGAAC
VEGFR2 GAAATGACACTGGAGCCTACA AG TCCATGCTGGTCACTAACAGAA G
β-actin GTATCCATGAAATAAGTGGTTAC AGG GCAGTACATAATTTACACAGAAG CAAT

tabel 1: Pimer sæt.

8. MicroCT analyse af knogle regenerering

  1. aflive mus med CO 2 indånding ved 8 uger efter operationen. I et godt ventileret miljø, blidt sted hver mus i en ren mus bur og pumpe CO 2 gas ind i buret til anaesthetize mus inden euthanasia.
  2. Dissekere kraniet for microCT billeddannelse af knogle defekt region. Bruger følgende scanningsparametre i eksperimenter: 9 µm opløsning, Al 0,5 mm filter, 50 kV spændingen og 142 µA nuværende.
  3. Reconstruct alle billeddiagnostiske data ved hjælp af kommerciel software leveret af virksomheden. Kalibrere scanninger ved hjælp af kalibreringsfunktionen af en CTAn software.
    Bemærk: Placer en Hounsfield enhed (HU) under mus i hver scanning.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Cylindrisk porøse PLGA/nHAp scaffolds 0,6 mm i højden og 4 mm i diameter blev fabrikeret med en 3D printer. Morfologier af stilladser blev analyseret via scanning Elektron Mikroskopi og microCT. Figur 1A viser et fotografi af den implanterede stillads. MicroCT scanning viste, at mere end 85% af porerne haft størrelser spænder fra 200 til 400 µm (figur 1B). SEM imaging viste, at overfladen af skafottet havde en ru microtopography, med micropores (diameter ca. 5-10 µm), sammenkoblet inde stilladser (fig. 1 D-F). Cirka 40% af den samlede belagte LV-eGFP partikler (4,5 x 105) frigivet fra PLGA/nHAp stilladser startede med en indledende burst virkning inden for 24 timer. Bioactivity af frigivne LV virus nåede topmødet på 24 h og derefter løbende formindsket, nærmer sig til 0 på 120 h (figur 2). Disse data tyder på at bioactivity mest stillads-immobiliseret LV partikler kunne opretholdes i op til 96 timer. Migration kapacitet af MSCs-T blev observeret med FACS metode til at undersøge, om LV transporterer pdgf-b cDNA kunne udtrykke og føre til BMSC chemotaxis, som vist i figur 3. Både den positive kontrol (C) og gruppen PDGF-BB-udtrykker (F) udstillet et betydeligt højere niveau af BMSC migration end de andre 4 grupper. Derudover var migration af BMSCs i gruppe F betydeligt højere end i gruppe C. Der ikke var nogen betydelige forskelle i BMSC migration blandt de andre 4 grupper.

Angiogenese inden for knogle defekten blev vurderet fra 2 til 8 uge efter implantation af MPM scanning. Figur 4A viser en skematisk illustration af en mus under MPM scanning. Indlysende angiogenese blev fundet i grupperne PH og PHp, men blodkar var næppe kan iagttages i kontrolgruppen, hvor kun et lag af fibrøst membraner på tværs af regionen defekt dannet (figur 4B). GIF grafer viser blodkar tomographs af hver gruppe (Supplerende Data). Område af nye blodkar øges gradvis over tid i grupper PH og PHp, med lignende stigende mønstre. 8. uge syntes fartøjerne svarer i morfologi til dem observeret på det tidlige stadium; den eneste ændring var, at et stigende antal mindre fartøjer var voksende i stilladser (figur 4B). BVA af PHp-gruppen var signifikant højere end der af de andre to grupper på alle gang point (figur 4 c). Derudover var der mange kollagen deposition websteder, som angivet af SHG signaler (den grønne farve i grafer og GIF grafer) i grupperne PH og PHp, men ikke i kontrolgruppen (figur 4B).

For at præcisere forholdet mellem PDGF BB udtryk og angiogenese, sammenlignede vi gen udskrift udtryk niveauer af pdgf-b, vWFog VEGFR2 med metoden RT-qPCR på 2, 4 og 8 uger efter implantation ( Figur 5). Som forventet, blev pdgf-b udtryk væsentligt forøget i gruppen PHp på alle tidspunkter, med en 5 til 13 gange stigning sammenlignet med kontrol og PH grupper (figur 5A). Der var ingen signifikant forskel mellem kontrol og PH gruppe, og udtryk niveauet af PDGF BB forblev næsten konstant fra uge 2 til uge 8, som vist i figur 5A. MRNA udtryk niveauet af vWF og VEGFR2 i alle tre grupper øget gradvist og var den højeste i gruppen PHp på alle tre gang point (figur 5B og 5 C). For gruppen PH var der ingen Statistisk signifikans i forhold til kontrolgruppen, trods åbenlyse angiogenese (figur 4B).

Yderligere bekræfte at pdgf-b-indeholdende stilladser fremme ikke regenerering i vivo ved hjælp af kritisk størrelse calvarial defekter i mandlige BALB/c mus, microCT scanning leveret oplysninger til at vurdere knogle regeneration på 8 uger efter implantation. Som vist i figur 6, var defekter i gruppen PHp fyldt med en masse ny knogle væv indvækst i stilladser, der henviser til, at der var langt mindre ny knogle i kontrol og PH grupper.

Figure 1
Figur 1: strukturel karakterisering af et 3D PLGA/nHAp stillads. (A) fotografi af en 3D trykte stillads. (B) en microCT billede af den samlede porøsitet af skafottet. (C) microtopography af stillads overflade observeret af SEM på 60 X, 2.000 X (D), 5.000 X (E), og 10.000 X forstørrelse (F). Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2: forberedelse af Lentivirus og evaluering af Bioactivity af LV-normal god landbrugspraksis partikler. (A) skematisk repræsentation af lentiviral vektor konstruktion. Efter 48 h af Transfektion blev HEK - 293FT celler observeret under lys (B) og fluorescens felt (C) vilkår. (D) In vitro- vurdering af bioactivity af LV-normal god landbrugspraksis partikler kumulativt frigivet fra PLGA/nHAp stilladser. Alle data præsenteres som den gennemsnit ± SEM (n = 4). Venligst klik her for at se en større version af dette tal.

Figure 3
Figur 3. PDGF-BB Bioactivity som en Potent kemotaktisk faktor svar af BMSC Migration. BMSCs-T (5 x 104) var seedet oven på transwell kamre, med forskellige betingelse media placeret i bunden af afdelingerne. (A) Tom kontrol, serumfrit medium kun; (B) FBS styre, medium suppleret med 10% FBS; C PDGF BB kontrol, 4 ng/mL PDGF BB i serumfrit medium; (D) PDGF-BB gribe PDGF BB-gruppen (4 ng/mL) og anti-PDGF-BB (4 ng/mL) polyklonale antistof i serum-frit medium; (E) BMSCs gruppe, 2 x 105 BMSCs i serumfrit medium; og (F) BMSCs-P gruppe, 2 x 105 BMSCs-Pedersen i serumfrit medium. Alle data er vist som gennemsnit ± SEM (n = 4). #: sammenligning mellem gruppe C og alle andre grupper, bortset fra gruppe F, # p < 0,0001. *: sammenligning mellem gruppe F og alle andre grupper, * p < 0,05, *** p < 0,0001. Venligst klik her for at se en større version af dette tal.

Figure 4
Figur 4: Høj opløsning Multiphoton mikroskopi (SHG/TPEF) billeddannelse og kvantificering af angiogenese i regionen knogle defekt i mus Calvaria.Erikas > (A) A skematisk illustration af en mus under MPM scanning. Den orange cirkel repræsenterer defektstedets, den røde tubuli repræsenterer blodkar, og grønne repræsenterer kollagen. (B) Unoperated og opererede dyr blev scannet med MPM på 8 uger efter implantation. SHG, TPEF, SHG/TPEF flettes, og 3D-billeder vises. Den prikkede linje repræsenterer grænsen langs knogle defekt i kontrolgruppen baseret på SHG signaler. (C) blodkar område kvantificering inden for området defekten kontrol, PH og PHp fra uge 2 til uge 8 efter implantation. Alle data er vist som gennemsnit ± SEM (n = 5). : Statistisk analyse mellem grupper PH og PHp, p < 0,0001. Venligst klik her for at se en større version af dette tal.

Figure 5
Figur 5: RT-qPCR analyse af pdgf-b (A) og angiogenese-relaterede gener vWF (B) og VEGRF2 (C) udtryk i tre grupper. Prøver fra 4 dyr blev analyseret for hvert tidspunkt. #: sammenligning mellem de PHp og PH, # p < 0,05, # p < 0,01 og #p < 0,0001. *: sammenligning mellem grupperne PHp og kontrol * p < 0,05, ** p < 0,01, og *** p < 0,0001. Venligst klik her for at se en større version af dette tal.

Figure 6
Figur 6: Evaluering af In Vivo knogledannelse med MicroCT Scanning. Kontrolgruppe uden implanterede stilladser. PH gruppe inden for implanteret PLGA/nHAp stillads kun. PHp gruppe inden for implanteret PLGA/nHAp stillads modificeret af LV- pdgfb partikler. Venligst klik her for at se en større version af dette tal.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Bone er en yderst vaskulariserede væv med en enestående kapacitet til løbende at helbrede og remodel i hele levetiden for en individuel1. Vascularization er vigtigt for osteogenesis og defekt reparation. Lav vascularization begrænser bred klinisk anvendelse af væv-manipuleret knogle. Konstruere en yderst vaskulariserede væv-manipuleret knogle ifølge teorien om Biomimetik er blevet et værktøj til at reparere store segment knogledefekter. Forskellige former for stilladser har været anvendt med succes til at reparere forholdsvis små ossøse defekter. Men for kritiske knogledefekter, anvendelse af stilladser til at reparere stadig ansigter hindringer, hovedsagelig på grund af utilstrækkelig blod leverer for defekt reparation. Derfor er forbedre blodforsyningen i løbet af processen til reparation af store knogledefekter en af de store spørgsmål i vævsmanipulering.

Folk bruger bioaktive materiale-belagt stilladser til at hjælpe med at etablere de nødvendige morfogenetiske felter, der kan stimulere, rekruttere og fremme chemotaxis, differentiering og spredning af celler til neovasculature og knogle dannelsen 37. Neovasculature i væv-manipuleret stilladser er afgørende for cellerne til at modtage ilt og næringsstoffer, til fjernelse af affaldsprodukter, og i sidste ende for opfyldelsen af funktionen af stilladser. Formålet med denne undersøgelse var at undersøge angiogenese med i vivo multiphoton mikroskopi i en genetisk modificerede, 3D-trykt PLGA/nHAp stillads til calvarial kritiske knogle defekt reparation og evaluere virkningerne af knogle regenerering ved hjælp af microCT.

På trods af dramatiske resultater i knoglen vævsmanipulering, i vivo visualisering og kvantificering af neovascularization i stilladser under knogle er regenerering stadig en udfordring. Mest mikroskopisk billeddannelse systemer kan ikke give volumetriske oplysninger om angiogenese. Traditionelle Billeddannende metoder, såsom microCT, MRI og histologiske analyser, er destruktiv, komplicerede og besværlige og har lav rumlige resolutioner og lange billede erhvervelse gange38. MPM imaging er imidlertid en roman bio-imaging modalitet, der kan fange blodkar signaler i vivo i en høj opløsning og minimalt invasiv måde. Det er i stand til at opdage nye fartøjer tyndere end 10 µm (figur 4B). Udover blodkar billeder observeret vi også en masse nye kollagen deposition (den grønne farve i figur 4B) og GIF grafer i det supplerende materiale, som angivet af SHG signaler, der angiver knogledannelse væv fra en anden vinkel. Teoretisk, blodkar billeder kunne være opnået uden anvendelse af kontrastmidler. Men i den nuværende undersøgelse, vi brugte et kontraststof for at få bedre billeder og fjernet lokale hud for at sikre den korrekte scanning dybde. Dette ville være unødvendig, når kraftigere Billeddannende systemer er tilgængelige for virkelig ikke-invasive billeddannelse i fremtiden.

HAp er en biomedicinsk materiale til knogle vævsregeneration, som er meget udbredt på grund af sin gode osteoconduction og osteoinduction egenskaber. HAp har god mulighed for bindende DNA vektorer og fastholde og stabilisere vektorer, herunder virale vektorer39. I forhold til microsized HAp, nanosized HAp partikler besidder høj specifik overflade områder og derfor vise bedre cellulære adfærd og mekaniske egenskaber40. Af disse grunde er nHAp partikler en af komponenterne i stilladser. Overflade og tværsnits SEM billeder af PLGA/nHAp skafottet vist i figur 1 viser, at de fabrikerede stilladser udviser et godt sammenkoblede pore struktur og ensartet fordelt pore størrelser. Immobilisering af virus på biomateriale luftfartsselskaber kan påvirke virusaktivitet. Derfor, vi har testet bioactivity LV partikler frigives fra stilladser ved at undersøge deres Transfektion aktivitet. Release profiler af LV partikler fra stilladser og deres bioactivities var evalueres i vitro, demonstrerer de kontrollerede levering af bioaktive LV partikler for fem dage (figur 2). Desuden vores in vitro- undersøgelse fokuserede på PDGF BB potentiale til at stimulere overflytning af primære MSCs. Disse resultater tyder på, at LV partikler udtrykt bioaktive PDGF-BB og effektivt stimuleres BMSC migration.

For at bekræfte kapacitet for angiogenese og knogle regenerering i vivo, blev PHp stilladser implanteret i murine calvarial kritiske knogledefekter. Fartoej formation blev bekræftet med angiogene markører, RT-qPCR analyse og blodkar tætheder observeret med SHG/TPEF billeddannelse. Begge de to sæt eksperimenter viste, at angiogenese og blodkar dannelse blev forbedret væsentligt med behandlingen af genetisk modificerede stilladser. Disse resultater viser, at PDGF BB ikke kun direkte stimulerer angiogenese, men også fremkalder andre angiogenese-relaterede gener. I mellemtiden, microCT målinger viser at pdgf-b-indeholdende stilladser væsentligt fremmet knogledannelse sammenlignet med de uændrede stilladser, som korreleres med neovasculature i skafottet. Disse resultater viser, at genetisk modificerede, bioaktive stilladser væsentligt forbedre angiogenese og væv revitalisering.

Resultaterne præsenteres her dokumentere, at den lentivirus-medieret genetiske modifikation af stilladser letter store ossøse defekt reparation i en murine calvarial kritiske knogle defekt model, sandsynligvis gennem forbedret angiogenese. Desuden, indeholder i vivo MPM imaging et unikt værktøj til at forstå angiogenese og osteogenesis i knoglen scaffolds og giver mulighed for yderligere udredning af, om en bestemt stillads er gavnlig for neovascularization. Intravital multiphoton mikroskopi imaging giver en modalitet for forståelse af fysiologi og Patofysiologi af angiogenese i væv og stilladser. Der er dog flere begrænsninger, når du bruger denne teknik. Først, den kirurgiske forberedelse kræver særlig ekspertise. Betændelse forårsaget af ufaglærte operation formindskes betydeligt MPM imaging kvalitet. For det andet på grund af MPM imaging hastighedsbegrænsning, en specialdesignet musen hovedet indehaver er nødvendig for at reducere artefakter forårsaget af puls og åndedræt. For det tredje for langsigtet imaging, skal dyr intraperitoneal eller intravenøst injiceres med saltvand til at undgå dehydrering.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne erklærer, at de har ingen konkurrerende finansielle interesser.

Acknowledgements

Denne undersøgelse blev støttet af Shenzhen Peacock Program, Kina (nr. 110811003586331), Shenzhen grundlæggende Research Program (nr. JCYJ20150401150223631, nr. JCYJ20150401145529020 og nr. JCYJ20160331190714896), Guangdong offentlig forskning og kapacitetsopbygning særlige programmet (nr. 2015A020212030), National Natural Science Foundation i Kina (nr. 81501893), den nationale Major Basic Research Program af Kina (2013CB945503), og den SIAT Innovation Program til fremragende yngre forskere (Y5G010).

Materials

Name Company Catalog Number Comments
Poly(D,L-lactide-co-glycolide) (PLGA) Sigma P1941 L/G ratio 75:25, MW 66000-107000
Hydroxyapatite nanoparticles Sigma 702153 Average diameter < 200 nm
Chloroquine diphosphate salt Sigma C6628
FITC-conjugated 250-kD dextran Sigma FD250S
1,4-dioxane lingfeng,Shanghai 0.45 micron
Stericup filters Merck Millipore Corporation SLHV033RB
PDGF-BB Cdna Sino Biological, Inc MZ50801-G
Anti-PDGF-BB mouse polyclonal antibody  BioVision, Inc 5489-30T
PDGF-BB recombinant protein 4489-50
Calcium-phosphate transfection solution Promega Corporation E1200
L-DMEM Hyclone SH30021.01
DPBS Hyclone SH30028.01
Penicillin-Streptomycin, Liquid Thermo Fisher Scientific 15140122
FBS Thermo Fisher Scientific 10099-141
Transwell  Corning 3422
Male BALB/c mice Guangdong Medical Laboratory Animal Center 
sodium pentobarbital  Merck 1063180500
multiphoton microscopy A homemade in Shenzhen Institutes of Advanced Technology to detect two-photon excited fluorescence (TPEF) and second harmonic generation signal (SHG).
isoflurane Keyuan, Shandong 401750169
TRIzol reagent Invitrogen 15596018
PrimeScript RT Master Mix (Perfect Real Time) Takara RR420B
SYBR Premix Ex Taq (Tli RNaseH Plus) Takara RR036B
Hematoxylin and eosin Beyotime C0105
Paraffin Leica  RM2235
Ultracentrifuge OPtima L-100XP Beckman Coulter L-100XP
Low-temperature printer  Tsinghua university A homemade in Tsinghua university
LightCycler 480 instrument  Roche 5815916001
microCT Bruker 1176
commercial software Bruker
Buprenorphine

DOWNLOAD MATERIALS LIST

References

  1. Hu, X., et al. GPNMB enhances bone regeneration by promoting angiogenesis and osteogenesis: potential role for tissue engineering bone. J Cell Biochem. 114, (12), 2729-2737 (2013).
  2. Schroeder, J. E., Mosheiff, R. Tissue engineering approaches for bone repair: concepts and evidence. Injury. 42, (6), 609-613 (2011).
  3. Chiarello, E., et al. allograft and bone substitutes in reconstructive orthopedic surgery. Aging Clin Exp Res. 25, S101-S103 (2013).
  4. Elangovan, S., et al. The enhancement of bone regeneration by gene activated matrix encoding for platelet derived growth factor. Biomaterials. 35, (2), 737-747 (2014).
  5. Bouyer, M., et al. Surface delivery of tunable doses of BMP-2 from an adaptable polymeric scaffold induces volumetric bone regeneration. Biomaterials. 104, 168-181 (2016).
  6. Rezwan, K., et al. Biodegradable and bioactive porous polymer/inorganic composite scaffolds for bone tissue engineering. Biomaterials. 27, (18), 3413-3431 (2006).
  7. Burg, K. J., Porter, S., Kellam, J. F. Biomaterial developments for bone tissue engineering. Biomaterials. 21, (23), 2347-2359 (2000).
  8. Xiao, Y., et al. Modifications of collagen-based biomaterials with immobilized growth factors or peptides. Methods. 84, 44-52 (2015).
  9. Chen, G., Lv, Y. Immobilization and Application of Electrospun Nanofiber Scaffold-based Growth Factor in Bone Tissue Engineering. Curr Pharm Des. 21, (15), 1967-1978 (2015).
  10. Kofron, M. D., Li, X., Laurencin, C. T. Protein- and gene-based tissue engineering in bone repair. Curr Opin Biotechnol. 15, (5), 399-405 (2004).
  11. Chen, F. M., et al. New insights into and novel applications of release technology for periodontal reconstructive therapies. J Control Release. 149, (2), 92-110 (2011).
  12. Winn, S. R., et al. Gene therapy approaches for modulating bone regeneration. Adv Drug Deliv Rev. 42, (1-2), 121-138 (2000).
  13. Chang, P. C., et al. Adenovirus Encoding Human Platelet-Derived Growth Factor-B Delivered to Alveolar Bone Defects Exhibits Safety and Biodistribution Profiles Favorable for Clinical Use. Hum Gene Ther. 20, (5), 486-496 (2009).
  14. Phipps, M. C., Xu, Y. Y., Bellis, S. L. Delivery of Platelet-Derived Growth Factor as a Chemotactic Factor for Mesenchymal Stem Cells by Bone-Mimetic Electrospun Scaffolds. Plos One. 7, (7), (2012).
  15. Gehmert, S., et al. Angiogenesis: The role of PDGF-BB on Adiopse-tissue derived Stem Cells (ASCs). Clin Hemorheol and Microcirc. 48, (1-3), 5-13 (2011).
  16. Chang, P. C., et al. PDGF-B gene therapy accelerates bone engineering and oral implant osseointegration. Gene Ther. 17, (1), 95-104 (2010).
  17. Javed, F., et al. Significance of the platelet-derived growth factor in periodontal tissue regeneration. Arch Oral Biol. 56, (12), 1476-1484 (2011).
  18. Murali, R., et al. Biomimetic hybrid porous scaffolds immobilized with platelet derived growth factor-BB promote cellularization and vascularization in tissue engineering. J Biomed Mater Res A. 104, (2), 388-396 (2016).
  19. Andrae, J., Gallini, R., Betsholtz, C. Role of platelet-derived growth factors in physiology and medicine. Genes Dev. 22, (10), 1276-1312 (2008).
  20. Wosnitza, M., et al. Plasticity of human adipose stem cells to perform adipogenic and endothelial differentiation. Differentiation. 75, (1), 12-23 (2007).
  21. Hankenson, K. D., et al. Angiogenesis in bone regeneration. Injury. 42, (6), 556-561 (2011).
  22. Schmidt, C., et al. Rapid three-dimensional quantification of VEGF-induced scaffold neovascularisation by microcomputed tomography. Biomaterials. 30, (30), 5959-5968 (2009).
  23. Perng, C. K., et al. In Vivo Angiogenesis Effect of Porous Collagen Scaffold with Hyaluronic Acid Oligosaccharides. J Surg Res. 168, (1), 9-15 (2011).
  24. Sun, Y., et al. Imaging tissue engineering scaffolds using multiphoton microscopy. Microsc Res Tech. 71, (2), 140-145 (2008).
  25. Fan, X., et al. Noninvasive monitoring of placenta-specific transgene expression by bioluminescence imaging. PLoS One. 6, (1), e16348 (2011).
  26. Yeo, M. G., Kim, G. H. Preparation and Characterization of 3D Composite Scaffolds Based on Rapid-Prototyped PCL/β-TCP Struts and Electrospun PCL Coated with Collagen and HA for Bone Regeneration. Chem Mater. 24, (5), 903-913 (2012).
  27. Mao, Y., et al. Lentiviral Vectors Mediate Long-Term and High Efficiency Transgene Expression in HEK 293T cells. Int J Med Sci. 12, (5), 407-415 (2015).
  28. Li, J., et al. Investigation of angiogenesis in bioactive 3-dimensional poly (D,L-lactide-co-glycolide)/nano-hydroxyapatite scaffolds by in vivo multiphoton microscopy in murine calvarial critical bone defect. Acta Biomater. 42, 389-399 (2016).
  29. Abbasi, H., et al. Lentiviral vector-mediated transduction of goat undifferentiated spermatogonia. Anim Reprod Sci. 163, 10-17 (2015).
  30. Pigossi, S. C., et al. Bacterial cellulose-hydroxyapatite composites with osteogenic growth peptide (OGP) or pentapeptide OGP on bone regeneration in critical-size calvarial defect model. J Biomed Mater Res A. (2015).
  31. Bos, G. D., et al. The effect of histocompatibility matching on canine frozen bone allografts. J Bone Joint Surg Am. 65, (1), 89-96 (1983).
  32. Hollinger, J. O., Kleinschmidt, J. C. The critical size defect as an experimental model to test bone repair materials. J Craniofac Surg. 1, (1), 60-68 (1990).
  33. Hollanders, K., et al. Bevacizumab Revisited: Its Use in Different Mouse Models of Ocular Pathologies. Curr Eye Res. 40, (6), 611-621 (2015).
  34. Gao, L. QSIM: quantitative structured illumination microscopy image processing in ImageJ. Biomed Eng Online. 14, 4 (2015).
  35. Kobat, D., et al. Deep tissue multiphoton microscopy using longer wavelength excitation. Opt Express. 17, (16), 13354-13364 (2009).
  36. Lohmann, P., et al. Bone regeneration induced by a 3D architectured hydrogel in a rat critical-size calvarial defect. Biomaterials. 113, 158-169 (2016).
  37. Lv, J., et al. Enhanced angiogenesis and osteogenesis in critical bone defects by the controlled release of BMP-2 and VEGF: implantation of electron beam melting-fabricated porous Ti6Al4V scaffolds incorporating growth factor-doped fibrin glue. Biomed Mater. 10, (3), (2015).
  38. Guldberg, R. E., et al. 3D imaging of tissue integration with porous biomaterials. Biomaterials. 29, (28), 3757-3761 (2008).
  39. Boehler, R. M., et al. A PLG/HAp composite scaffold for lentivirus delivery. Biomaterials. 34, (21), 5431-5438 (2013).
  40. Heo, S. J., et al. Fabrication and characterization of novel nano- and micro-HA/PCL composite scaffolds using a modified rapid prototyping process. J Biomed Mater Res A. 89, (1), 108-116 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics