Visualisierung von Angiogenese durch Multiphoton Mikroskopie In Vivo in gentechnisch veränderten 3D-PLGA/nHAp Gerüst für Calvarial kritische Knochen defekt Reparatur

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Hier präsentieren wir ein Protokoll zur Blutgefäß Bildung in Vivo zu visualisieren und in Echtzeit in 3D Gerüste multiphoton Mikroskopie. Angiogenese in gentechnisch veränderten Gerüste wurde in einem murinen calvarial kritische Knochen-defekt-Modell untersucht. Mehr neue Blutgefäße waren in der Behandlungsgruppe als Kontrollen erkannt.

Cite this Article

Copy Citation | Download Citations

Li, J., Jahr, H., Zheng, W., Ren, P. G. Visualizing Angiogenesis by Multiphoton Microscopy In Vivo in Genetically Modified 3D-PLGA/nHAp Scaffold for Calvarial Critical Bone Defect Repair. J. Vis. Exp. (127), e55381, doi:10.3791/55381 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Die Rekonstruktion der kritisch große Knochendefekte bleibt ein ernstes klinische Problem wegen schlechten Angiogenese im Tissue-Engineering Gerüste während der Reparatur, die führt zu einem Mangel an ausreichender Blutversorgung und Nekrose des neuen Gewebes verursacht. Rasche Vaskularisierung ist eine wesentliche Voraussetzung für das neue Gewebe überleben und Integration mit bestehenden Wirtsgewebe. Die de-Novo -Generation des Gefäßsystems in Gerüste ist einer der wichtigsten Schritte bei der Herstellung Knochenregeneration effizienter, so dass Reparatur Gewebe in ein Gerüst zu wachsen. Um dieses Problem zu lösen, wird die gentechnische Veränderung von einem Biomaterial Gerüst zur Angiogenese und Osteogenesis beschleunigen. Allerdings ist Visualisierung und tracking in Vivo Blutgefäß-Bildung in Echtzeit und im dreidimensionalen (3D) Gerüste oder neues Knochengewebe noch ein Hindernis für das Bone Tissue Engineering. Multiphoton Mikroskopie (MPM) ist eine neuartige Bio-Imaging-Modalität, die volumetrische Daten aus biologischer Strukturen in hoher Auflösung und minimal-invasive Weise erwerben kann. Ziel dieser Studie war es, Angiogenese mit multiphoton Mikroskopie in Vivo in einer gentechnisch veränderten 3D-PLGA/nHAp Gerüst für die calvarial kritische Knochen defekt Reparatur zu visualisieren. PLGA/nHAp Gerüste wurden für die nachhaltige Lieferung eines Wachstumsfaktors Pdgf-b Gens tragen Lentivirale Vektoren (LV -Pdgfb) Angiogenese zur Erleichterung und Verbesserung der Knochenregeneration funktionalisiert. In einem Gerüst-implantierten calvarial kritische Knochen defekte Maus-Modell, die Blutgefäß-Bereiche (BVAs) in PHp Gerüste waren deutlich höher als bei PH-Gerüste. Darüber hinaus erhöht sich der Ausdruck von Pdgf-b und Angiogenese-Genen, vWF und VEGFR2, entsprechend. MicroCT-Analyse ergab, dass die Knochenneubildung in der PHp Group erheblich verbessert im Vergleich zu den anderen Gruppen. Unseres Wissens ist dies das erste Mal multiphoton Mikroskopie im Knochen Gewebe-Engineering verwendet wurde, um die Angiogenese in einem 3D biologisch abbaubaren Gerüst in Vivo und in Echtzeit zu untersuchen.

Introduction

Knochen ist ein stark vaskularisierte Gewebe, die auch weiterhin während der Laufzeit eines einzelnen1umzugestalten. Die schnelle und effektive Knochenregeneration von großen Knochendefekten infolge Trauma, Pseudarthrose, Tumor Resektionen oder kraniofaziale Fehlbildungen ist ein komplexer physiologischer Vorgang. Traditionelle therapeutische Ansätze verwendet für Knochen defekt Reparatur Autotransplantation und Allograft-Implantierung unter anderem ihre Verwendung umfasst mehrere Probleme und Einschränkungen, z. B. begrenzte Verfügbarkeit, wichtiger Geber Website Morbidität, ein hohes Risiko der Infektion, und Hosten Sie Immunabwehr2,3. Künstliche Knochentransplantate bieten jedoch eine effiziente Alternative um diese Einschränkungen zu lindern. Sie können aus biologisch abbaubaren Materialien hergestellt werden, sind einfach zu fabrizieren werden mit einer geeigneten Porengröße und können genetisch veränderten4,5.

Verschiedene Gewebe-engineering-Gerüste sind derzeit in der Entwicklung von Tissue-Engineering Knochen6,7eingesetzt worden. Knochen-Reparatur und Regeneration effektiver induzieren, veränderte Biomaterialien kombiniert mit Wachstumsfaktoren entstanden und erzielt gute Ergebnisse8,9. Leider begrenzen die kurze Halbwertszeit, leicht zu verlieren-Aktivität und Supraphysiological Dosierung von Wachstumsfaktoren für die therapeutische Wirksamkeit ihrer klinischen Anwendung10. Um diese Probleme zu überwinden, wurde die Lieferung von Wachstumsfaktor Genen anstelle von Wachstumsfaktoren als einen wirksamen Ansatz zu Bioaktivität zur Behandlung von knöcherner Defekte und Krankheiten11,12nachgewiesen. Virale Vektoren sind vielversprechende Lieferung Werkzeuge für die Geweberegeneration aufgrund ihrer hohen Effizienz13zum Ausdruck zu bringen.

Unter den Wachstumsfaktoren wurde Platelet-derived Wachstumsfaktor (PDGF-BB) in dieser Studie ausgewählt, weil es nicht nur ein Mitogen und Lockstoffgradient für mesenchymale und osteogene Zellen, sondern auch ein Stimulans für Angiogenese14,15 ist . Präklinische und klinische Studien zeigten, dass PDGF-BB Knochen Reparatur parodontalen knöcherner Defekte16,17sicher und effektiv fördern könnte. Neuere Studien gezeigt, dass PDGF-BB Angiogenese durch motivierende Endothelzellen Migration und Proliferation in Vivo18,19stimuliert. Außerdem kann PDGF-BB auch mesenchymalen Stammzellen (MSCs) in der Lage, Differenzierung in Endothelzellen20, und diese weitere Highlights die potenzielle Rolle von MSCs in Neovaskularisation machen. Induzieren die de Novo Bildung des Gefäßsystems in Gerüste mit PDGF-BB ist daher ein wichtiger Schritt für die Reparatur von Gewebe zu Gerüste in Knochen Gewebe-Engineering entwickelt.

Knochenheilung defekt ist ein dynamisches Gewebe morphogenetischen Prozess, der koordinierte Osteogenesis und Angiogenese bei der Reparatur von Positionen21erfordert. Neoangiogenese in implantierten Tissue-Engineering Gerüste ist eine wesentliche Voraussetzung für die Versorgung der Zellen mit Nährstoffen und Sauerstoff für Wachstum und überleben und zum Entfernen von Stoffwechselschlacken. Häufig verwendet, bildgebende Verfahren, berechnete Mikro-einschließlich Röntgen Computertomographie (MicroCT), Magnet-Resonanz-Tomographie (MRI), Rasterelektronenmikroskopie (SEM), Optische Kohärenztomografie (OCT) und konfokale Laser-scanning-Mikroskopie, anstelle von angewendet werden histologische Untersuchung Angiogenese Informationen22,23zu erhalten. Diese Methoden stehen jedoch verschiedene Hindernisse zu visualisieren und Neovasculature in 3D Gerüste im Knochen Tissue Engineering zu messen. Multiphoton Mikroskopie (MPM) ist eine vergleichsweise neue Bio-Imaging-Technik, die den entscheidenden Vorteil gleichzeitig Zellen, extrazelluläre Matrix, die Visualisierung und die umliegenden vaskulärer Netzwerken hat in-vivo. Es besitzt eine inhärente dreidimensionale Bildgebung Fähigkeit für tiefe Gewebe eindringen und verursacht geringe lichtbedingten. Daher hat MPM in den letzten zehn Jahren viel Aufmerksamkeit in biomedizinischen Studien24, darunter in Neurowissenschaften, Immunologie und Stammzellen Dynamik gewonnen. Es ist jedoch kaum in der orthopädischen Forschung verwendet.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

die Pflege der Tiere wurde in Einklang mit dem Leitfaden für die Pflege und Nutzung des Labor Tiere der Provinz Guangdong. Alle Verfahren wurden unter der Aufsicht und Genehmigung der Ethikkommission für Animal Research, Shenzhen Institute of Advanced Technology, Chinese Academy of Sciences durchgeführt.

1. Lentivirale (LV) Produktion

  1. Klon der Pdgf-b cDNA in einen Lentivirale Ausdruck Vektor (pLenti6/5-eGFP oder LV-eGFP) eine benutzerdefinierte Multiple-Klonen Website stromabwärts von der Zytomegalievirus Projektträger mit Spe ich und Sal Ich Restriktionsschnittstellen zu konstruieren der pLenti6/5-PDGFB-eGFP Plasmid (LV - Pdgfb) 25.
  2. Produzieren Lentivirale Partikel (LV - Pdgfb) von HEK - 293 FT Zellen durch Zusammenarbeit mit Virus Verpackung Plasmide (pLP1, pLP2 und pVSV-G) transfecting mit der standard-Calcium-Phosphat-Methode mit Chloroquin (Endkonzentration: 25 µM) 25.
  3. nach 48 h Transfektion, Ernte und Filtern 500 mL von Virus-haltigen überstand mit einem Filter (0,45 µm). Anschließend die Viruspartikel durch Ultrazentrifugation 89.000 x g für 2 h. Aufschwemmen in 200 µL des Phosphat-gepufferte Kochsalzlösung (PBS), aliquoten zu konzentrieren, und Lagern bei-80 ° c
  4. Ermitteln die Titer von Lentivirus, brüten HEK293T Zellen mit seriell verdünnte Lentivirale Lösung für 24 h und berechnen der Lentivirale Titer, wie zuvor beschrieben 25.

2. Herstellung von 3D-gedruckten PLGA/nHAp Gerüste und LV Immobilisierung

  1. auflösen 20 g der PLGA (Poly-D, L-Lactid-co-Glykolids) Material in 20 mL 1,4-Dioxan, eine homogene Lösung zu bilden. 2 g von nanoskaligen HAp (Nano-Hydroxyapatide) Pulver (nHAp) der Projektmappe hinzufügen; die PLGA: nHAp Verhältnis 10:1 (w/w) werden sollen.
  2. Gemischte Lösung kräftig rühren (rühren Drehzahl: 1.500 u/min) bei Raumtemperatur für 16 h mit einem Magnetrührer zu einer einheitlichen Paste. Fertigen sie in porösen PLGA/nHAp Gerüste mit einem 3D-Drucker Niedertemperatur-mit einer computergesteuerten Düse, die Einlagen der Paste Schicht für Schicht, von unten nach oben, nach einer vordefinierten Modell 26; die Porengrößen von den Gerüsten reichen von 200 bis 400 µm.
  3. Vakuum Gefriertrocknen Gerüste für 48 h, Lösemittel möglichst vollständig zu entfernen. Genießen Sie die Gerüste in 75 % Ethanol Lösung für 1 h für Sterilisation und neutral, aseptische Gerüste zu lyophilize.
    Hinweis: Die wichtigsten Parameter für Vakuum Gefriertrocknung gehören die Kondensationstemperatur (° C) und Vakuumgrad (Pa). Unter einem Vakuumgrad 45 Pa, die PLGA/nHAp Gerüste wurden Vakuum gefriergetrocknet bei-78 ° C für 48 h um das Lösungsmittel gründlich zu entfernen.
  4. Fügen Sie 10 µL LV Partikel (4,5 x 10 5) zu jedem PLGA/nHAp Gerüst (4 x 4 x 2 mm) und inkubieren Sie die Gerüste für 2 h bei 37 ° C in einem befeuchteten Inkubator ermöglicht Adsorption.
  5. Nach Immobilisierung, spülen Sie die Gerüste zweimal mit PBS auf ungebundene LV Partikel zu entfernen. Snap-Freeze LV Partikel-beschichtete Gerüste in flüssigem Stickstoff, wieder lyophilize und bei-80 ° C für eine spätere Verwendung zu speichern.

3. In-vitro- Kinetik der LV Freisetzung von Partikeln von Gerüsten und LV Transduktion Activity Assay

  1. inkubieren 3D Gerüste (4 x 4 x 2 mm) mit LV-grün fluoreszierendes Protein (LV-eGFP, 4.5 x 10 5 LV-Partikel) in 1 mL der kompletten DMEM in kryogenen 2,0 mL Fläschchen bei 37 ° C mit Schütteln für 5 Tage.
  2. Nehmen Sie eine 1 mL Probe alle 12 h 12 h bis 120 h nach Inkubation und ersetzen Sie das Medium. Zu jedem Zeitpunkt fügen Sie 1 mL frisches Medium anstelle von 1 mL der Inkubation Medium.
  3. Die gesammelten Medien nutzen, um HEK293T Zellen durch Co Inkubation für 48 h. Maßnahme die Anzahl der bioaktiven LV-Teilchen durch die Bestimmung der Anzahl der GFP-positiven HEK293T von Flow Cytometry 27 Zellen transduzieren.
    1. Vor transducing die HEK293T Zellen, entfernen Sie das Kulturmedium und spülen die HEK293T Zellen zweimal mit PBS. Fügen Sie das gesammelte Medium mit Lentivirus befreit die Gerüste zum Brunnen (1 mL/Na) und Kultur mit den HEK293T Zellen für 48 h bei 37 ° C in einem befeuchteten Inkubator.

4. In-vitro- Bewertung von Knochenmark stammenden MSC (BMSC) Migration

  1. vor der Migration Test vorbereiten BMSCs Ausdruck Tomate fluoreszierenden Proteins (BMSCs-T) und PDGF-BB Protein (BMSCs-P) 28.
  2. Führen die BMSC Migration Assay mit einer Boyden Kammer mit einer 24-Well-Platte und Polycarbonat Filter mit einer Porengröße von 8 µm.
    1. Ort 0,5 mL BMSCs (5 x 10 4) mit LV ausdrücken Tomaten fluoreszierenden Proteins (BMSCs-T) in den oberen Kammern transfiziert. Platzieren Sie 0,5 mL BMSCs (2 x 10-5) mit LV mit dem Ausdruck PDGF-BB Protein (BMSCs-P) in den unteren Kammern transfiziert.
  3. Gehören sechs Gruppen in diesem Experiment und das untere Fach jedes gut 500 µL hinzu.
    A. blank Kontrolle, serumfreien Medium nur
    B. FBS Kontrolle, mittlere ergänzt mit 10 % FBS
    C. PDGF-BB-Kontrolle, 4 ng/mL PDGF-BB in serumfreien Medium
    D. PDGF-BB nutzen PDGF-BB-Gruppe (4 ng/mL) und polyklonalen Antikörper Anti-PDGF-BB (4 ng/mL) serumfreien Medium
    E. BMSC Gruppe, 2 x 10 5 BMSCs in serumfreien Medium
    F. BMSCs-P-Gruppe, 2 x 10 5 BMSCs-P im Serum freie Mitte.
  4. Inkubieren Sie für 48 Stunden bei 5 % CO 2 und 37 ° C in einem befeuchteten Inkubator. Danach entfernen Sie die migrierten Zellen auf der unteren Seite der Kammer und sammeln sie für die Quantifizierung der Anzahl der BMSCs-T von Durchflusszytometrie.
    1. Entfernen migrierte Zellen auf die untere Kammer Seite mit einem Schaber Zelle und die migrierten Zellen mit 2 mL PBS aufzuwirbeln. Quantifizieren Sie die Anzahl der migrierten BMSCs-T von Flow Cytometry 29.

5. Einrichtung eines murinen Calvarial kritischer Mangel Knochenmodell und Gerüst Transplantation

Hinweis: männliche BALB/c Mäuse (7 Wochen alt) aus Guangdong Medical Laboratory Animal Center (Guangdong, China) erworben wurden.

  1. Enroll insgesamt 42 männliche Mäuse für den calvarial Knochendefekt experimentieren. Nach dem Zufallsprinzip teilen die Mäuse in drei Gruppen, mit vierzehn Jahren in jeder Gruppe, die die folgenden Behandlungen erhalten: Gruppe A, keine Implantate; Gruppe B, PH-Gerüste implantiert (PLGA/nHAp); und Gruppe C, PHp Gerüste implantiert (PLGA/nHAp/LV-Pdgfb).
  2. Betäuben der Tiere mit der intraperitonealer Verabreichung von Natrium-Pentobarbital (50 mg/kg). Entfernen Sie Fell mit Enthaarungscreme Paste und reinigen Sie der Kopfhaut mit 75 % Alkohollösung vor dem ersten Schnitt. Der Leiter der jede Maus mit einem stereotaktischen Instrument zu halten, noch während der Operation zu beheben.
  3. Einen ersten Einschnitt mit einem Skalpell machen und dann vergrößern Sie es Witzh-Schere um einen linearen Hautschnitt von 1 cm zu erstellen. Kratzen der Knochenhaut vom Knochen des Schädels, die Knochenoberfläche des Schädels mit einem sterilen Wattestäbchen zu offenbaren.
  4. Mithilfe einen Trephine Grat um einen Durchmesser von 4 mm kritische Größe Defekt auf der linken Seite der Calvaria 30 zu erstellen. Das Gerüst in die Knochen-defekt-Website zu verpflanzen.
    Hinweis: Kritische Größe Mängel (CSDs) waren ursprünglich definiert als " die kleinste Größe intraossäre aufgewickelt in einem bestimmten Knochen und Tierarten, die während der Lebensdauer des Tieres nicht spontan heilen wird " In diesem Experiment, 4 mm Durchmesser defekt ist eine kritische Größe Knochendefekt nach den vorher studieren 31 , 32.
  5. Verwenden ophthalmologischen Zange um das Periost wieder sanft an der Operationsstelle zu decken. Naht die eingeschnittene Haut mit drei Stichen pro cm.
  6. Postoperative Pflege durchführen. Verwalten Sie die analgetische Buprenorphin (0,1 mg/kg), Schmerzen zu lindern. Pflegen Sie die Körpertemperatur mit einem Heizkissen, bis das Tier erwacht. Danach füttern Sie die Tiere mit Futter und Wasser und zeichnen Sie ihre Aktivitäten jeden Tag bis zum Ende des Tests. Hinweis: Analgesie kann verabreicht werden, vor dem Eingriff abhängig von Ihrem lokalen Tierpflege Ausschuss Leitlinien.

6. In Vivo Bildgebung der Angiogenese innerhalb der Knochendefekt mit MPM

Hinweis: FITC konjugiert 250 kD Dextran (10 mg/mL) in Kochsalzlösung wurde intravenös injiziert in Mäuse zu hoher SNR (Signal-Rausch-Verhältnis) Bilder von neuen Blutgefässen zu erhalten nach einer früheren Studie 33. Bitte beachten Sie, dass dies ein Überleben Verfahren.

  1. bauen die multiphoton Mikroskopie (MPM) System für zwei-Photonen aufgeregt Fluoreszenz (TPEF) und zweiten harmonischen Generation Signal (SHG) Imaging.
  2. Betäuben der Tiere eine intraperitoneale Injektion von Pentobarbital-Natrium (50 mg/kg) und die Tiere auf eine Heizplatte, ihre Körpertemperatur auf 37 ° C während der Experimente zu immobilisieren. Verwenden Sie 3,0 % Isofluran Gas in 100 % Sauerstoff in den imaging-Prozess weiterhin zufriedenstellende Anästhesie und Analgesie. Intraperitoneale Injektion Kochsalzlösung (200 µL/Tier) um Austrocknung vor Bildgebung zu verhindern.
  3. Melodie der Femtosekunden Ti-Saphir-Laser auf 860 nm. Erstellen Sie eine 512 x 512 µm Stichprobenraum durch Scannen von ein paar Galvo-Spiegel und verwenden NA1.0 eintauchen in Wasser Objektiv Focusthe Erregung Strahl in die Probe und das rückgestreute Signal TPEF/SHG zu sammeln.
    Hinweis: Die Bildgebung erfolgte auf einem Heim-Build multiphoton mikroskopischen imaging System (MPM). Während der Aufnahme, ein Femtosekunden Ti-Saphir-Laser wurde abgestimmt auf 860 nm als optimale Erregung Wellenlänge. Der Laserstrahl wurde Raster über ein Probe-Flugzeug mit einem Paar von Galvanometer Spiegel gescannt. Nach dem Durchlaufen eines dichroitischen Spiegels von 685 nm, der Strahl konzentrierte sich auf die Probe durch ein 20 X NA1.0 Ziel. Die induzierte TPEF und SHG-Signale wurden durch den gleichen Zweck gesammelt. Die Signale wurden vom Laser Erregung durch die dichroitischen Spiegel oben erwähnt und durch einen 680 nm-kurz-Pass-Filter gereinigt aufgeteilt. Die TPEF und SHG-Signale wurden von einem Faserbündel gesammelt und führte zu einem Spektrographen. Der Detektor auf der Spektrograph wurde eine lineare Anordnung von Photomultiplier Tubes (PMTs). Die Kombination von Spektrographen und linear-Array PMTs angeboten die Möglichkeit, das Signal aufzeichnen in 16 aufeinanderfolgenden Spektralbändern von 400 nm bis 600 nm, 12,5 nm Abständen. Daher wurden die TPEF und SHG-Signale gleichzeitig erkannt und in spektralen Bereichen getrennt. Darüber hinaus nutzte ein axialer Motor für 3D-Bildgebung, die bildgebende Tiefe steuern. Bereich der jedes Bild war auf 512 x 512 µm, und das tiefe Intervall war bis 2 µm (Kontrollgruppe, 5 µm) eingestellt. Insbesondere, 5 Seiten auf jeden Fehler wurden abgebildet, um statistisch signifikante Daten zu sammeln, und die ausgewählten bildgebenden Sites verteilten sich gleichmäßig und zufällig entlang des Mangels.
  4. Scan 5 Seiten auf jeden Fehler statistisch signifikante Daten zum Schiff Bildung Messen sammeln.
    1. Verwendung Scan Seiten gleichmäßig und zufällig verteilt entlang des Mangels. Für die Kontrollgruppe haben das Sichtfeld (FOV) Abdeckung der ursprünglichen Knochenbereich und dem Rand des Mangels anzuzeigen, aber für den pH-Wert und PHp Gruppen der FOV auf dem implantierten Schafott.
    2. Machen einen 1 cm linear Hautschnitt mit einem Skalpell und Naht die offene Haut die Fixierung die Transplantation Website offenbaren. Eine Spritze, um einen Tropfen Wasser zwischen dem DIP Objektiv und Transplantationen bilden ein Wasserglas zu platzieren verwenden.
  5. Acquire Bild stapelt alle 12 s über eine 2 h imaging-Periode. Anzeigen und analysieren volumetrische Daten mit einem benutzerdefinierten MATLAB-Programm und quantifizieren die Blutgefäß-Bereiche mit ImageJ Software 34 , 35.

7. Gene Expression Analysis von Pdgf-b und Angiogenese-Genen durch RT-qPCR

Hinweis: PCR wurde nach den üblichen Schritten durchgeführt: 95 ° C für 30 s, 40 Zyklen von 95 ° C für 5 s und 60 ° C für 30 S. Post-PCR-schmelzen Kurven bestätigt die Besonderheit des einzelnes Ziel Verstärkung, und die Falte Veränderung des Gens von Interesse im Vergleich zu β-Aktin bestimmt war. Die Reaktion für jede Probe wurde dreimal getestet.

  1. Ernte implantiert, Gerüste und Gewebe aus der experimentellen Mäuse bei 2, 4 und 8 Wochen nach der Operation 36; Kontrollproben Gruppe (n = 4), zu den gleichen Zeitpunkten genommen, von benachbarten Knochengewebe sollte.
    Hinweis: Zu jedem Zeitpunkt (2, 4 und 8 Wochen), die Mäuse mit CO 2 Inhalation eingeschläfert. Sezieren die Calvaria, anschließend entfernen und ernten die implantierten Gerüste aus der Calvaria.
  2. Eine kommerzielle Reagenz verwenden, um die Gesamt-RNS von jeder Probe nach Angaben des Herstellers zu extrahieren ' s-Protokoll. Die Reverse Transkription-Kit verwenden, um umzukehren-Transkription die RNA in cDNA nach Hersteller ' s Protokoll.
  3. Führen quantitative Real-Time PCR mit SYBR Green Detection System; die Primer sind in Tabelle 1 aufgeführten.
Primer(5'–3')
gen nach vorn umgekehrte
Pdgfb CATCCGCTCCTTTGATGATCTT GTGCTCGGGTCATGTTCAAGT
vWF CTCTTTGGGGACGACTTCATC TCCCGAGAATGGAGAAGGAAC
VEGFR2 GAAATGACACTGGAGCCTACA AG TCCATGCTGGTCACTAACAGAA G
β-Aktin GTATCCATGAAATAAGTGGTTAC AGG GCAGTACATAATTTACACAGAAG CAAT

Tabelle 1: Pimer Sets.

8. MicroCT-Analyse der Knochenregeneration

  1. einschläfern Mäuse mit CO 2 Inhalation bei 8 Wochen nach der Operation. In einer gut belüfteten Umgebung sanft jede Maus in einen Käfig sauber Maus zu platzieren und Pumpen CO 2-Gas in den Käfig zu betäuben die Mäuse vor der Euthanasie.
  2. Sezieren den Schädel für die MicroCT Darstellung von der Knochen-defekt-Region. Benutzer der folgenden Scan-Parameter in den Experimenten: 9 µm Auflösung, Al-0,5 mm-Filter, 50 kV Spannung und aktuellen 142 µA.
  3. Reconvon der Gesellschaft erbrachten Struct alle Bilddaten mit kommerzieller Software. Kalibrieren Sie die Scans mit der Kalibrierfunktion einer CTAn-Software.
    Hinweis: Stellen Sie ein Hounsfield Gerät (HU) unter die Mäuse in jedem Scan.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Zylindrischen porösen PLGA/nHAp Gerüste in der Höhe 0,6 mm und 4 mm im Durchmesser mit einem 3D-Drucker hergestellt wurden. Die Morphologien der Gerüste wurden per scanning Electron Microscopy und MicroCT analysiert. Abbildung 1A zeigt das Foto von dem implantierten Gerüst. Scannen von MicroCT ergab, dass mehr als 85 % der Poren Größen von 200 bis 400 µm (Abbildung 1 b) hatte. SEM Bildgebung gezeigt, dass die Oberfläche des Gerüstes hatte eine grobe Struktur, mit Mikroporen (Durchmesser ca. 5-10 µm), die im Inneren der Gerüste (Abbildung 1 D-F) miteinander verbunden. Etwa 40 % des Gesamtbetrages der beschichteten LV-eGFP Partikel (4,5 x 105) befreit die PLGA/nHAp Gerüste begann mit einem ersten Ausbruch Effekt innerhalb von 24 h. Die Bioaktivität der veröffentlichten LV Viren erreichten Gipfel bei 24 h und dann kontinuierlich vermindert, Annäherung an 0 120 h (Abbildung 2). Diese Daten deuten darauf hin, dass die Bioaktivität der meisten Gerüst immobilisiert LV Partikel bis zu 96 Stunden aufrechterhalten werden könne. Die Migration Kapazität des MSCs-T wurde mit dem FACS-Verfahren zu untersuchen, ob LV Pdgf-b cDNA tragen könnte zum Ausdruck bringen und zu BMSC Chemotaxis führen, wie in gezeigt beobachtet Abbildung 3. Die Positivkontrolle (C) und PDGF-BB-mit dem Ausdruck ihrer Gruppe (F) ein deutlich höheres Maß an BMSC Migration als die anderen 4 Gruppen ausgestellt. Darüber hinaus wurde die Migration von BMSCs in der Gruppe F deutlich höher als in Gruppe C. Es gab keine signifikanten Unterschiede in der BMSC Migration zwischen den 4 Gruppen.

Angiogenese in den Knochendefekt wurde ab dem 2. in der 8. Woche nach der Implantation von MPM Scannen bewertet. Abbildung 4A zeigt eine schematische Darstellung einer Maus unter MPM zu scannen. Offensichtliche Angiogenese in den Gruppen PH und PHp erkannt wurde, aber Blutgefäße waren kaum zu beobachten in der Kontrollgruppe, wo nur eine Schicht von faserigen Membranen in der gesamten Region defekt gebildet (Abbildung 4 b). Die GIF-Grafiken zeigen die Blutgefäß-Tomographen der einzelnen Gruppen (Supplementary Data). Bereich der Bildung neuer Blutgefäße stieg allmählich im Laufe der Zeit in Gruppen PH und PHp, mit immer wiederkehrenden Mustern. In der 8. Woche erschien die Schiffe ähnlich Morphologie im frühen Stadium; die einzige Änderung war, dass eine wachsende Zahl von kleineren Schiffen in Gerüste (Abbildung 4 b) wuchs. Das BVA der PHp Group war deutlich höher als das der anderen beiden Gruppen überhaupt Punkte (Abbildung 4 Mal). Darüber hinaus gab es viele Kollagen Ablagerung Standorte, wie durch SHG signalisiert (die grüne Farbe in die Grafiken und GIF-Grafiken) in den Gruppen PH und PHp, aber nicht in der Kontrollgruppe (Abbildung 4 b).

Um das Verhältnis von PDGF-BB Ausdruck und Angiogenese zu klären, verglichen wir die gen Transkript Ausdruck Niveaus des Pdgf-b, vWFund VEGFR2 mit der RT-qPCR-Methode bei 2, 4 und 8 Wochen nach der Implantation ( Abbildung 5). Wie erwartet, wurde Pdgf-b Ausdruck deutlich in der PHp Group zu allen Zeitpunkten, mit einem 5 bis 13 mal Anstieg im Vergleich zu der Kontrolle und PH-Gruppen (Abb. 5A) erhöht. Gab es keinen signifikanten Unterschied zwischen Steuerung und PH-Gruppe, und die Expression von PDGF-BB fast konstant von Woche 2, Woche 8, wie in Abbildung 5Adargestellt. Die mRNA-Expression-Niveaus von vWF und VEGFR2 in allen drei Gruppen schrittweise erhöht und überhaupt das höchste in der PHp Group wurden drei Zeitpunkten (Abbildung 5 b und 5 C). Für die PH-Gruppe gab es keine statistische Signifikanz im Vergleich zu der Kontrollgruppe trotz offensichtlicher Angiogenese (Abbildung 4 b).

Weiter bestätigen, dass Pdgf-b-enthaltenden Gerüste fördern Bone Regeneration in Vivo mit kritisch Größe calvarial Mängel bei männlichen Mäusen BALB/c, MicroCT Scannen Angaben zur Beurteilung der Knochenregeneration nach 8 Wochen nach der Implantation. Wie in Abbildung 6dargestellt, wurden Mängel in der PHp Group mit einer Masse von neuen Knochen Gewebe einwachsen in die Gerüste gefüllt, während gab es viel weniger Knochenneubildung bei der Kontrolle und PH-Gruppen.

Figure 1
Abbildung 1: strukturelle Charakterisierung leski 3D PLGA/nHAp. (A) Foto 3D gedruckte leski. (B) ein MicroCT Bild der gesamten Porosität des Gerüstes. (C) die Struktur der Oberfläche Gerüst von SEM bei 60 X 2.000 X (D), 5.000 X beobachtet (E), und 10.000 X Vergrößerung (F). Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 2
Abbildung 2: Vorbereitung der Lentivirus und Bewertung der Bioaktivität der LV-GFP Partikel. (A) schematische Darstellung der Lentivirale Vektor-Konstrukt. Nach 48 h Transfektion wurden HEK - 293 FT Zellen unter Licht (B) und Fluoreszenz (C) Freilandbedingungen beobachtet. (D) In-vitro- Bewertung die Bioaktivität der LV-GFP Partikel kumulativ aus PLGA/nHAp Gerüste entlassen. Alle Daten sind als Mittelwert ± SEM vorgestellt (n = 4). Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 3
Abbildung 3. PDGF-BB Bioaktivität als potente chemotaktische Faktor Antwort BMSC Migration. BMSCs-T (5 x 104) wurden auf der Oberseite Transwell Kammern mit verschiedenen Zustand Medien platziert in den Boden der Kammern ausgesät. (A) Blindkontrolle, serumfreien Medium nur; (B) FBS steuern, Medium ergänzt mit 10 % FBS; (C) PDGF-BB-Kontrolle, 4 ng/mL PDGF-BB in serumfreien Medium; (D) PDGF-BB nutzen PDGF-BB-Gruppe (4 ng/mL) und polyklonalen Antikörper Anti-PDGF-BB (4 ng/mL) in serumfreien Medium; (E) BMSCs Gruppe, 2 x 105 BMSCs in serumfreien Medium; und (F) BMSCs-P-Gruppe, 2 x 105 BMSCs-P in serumfreien Medium. Alle Daten sind als Mittelwert ± SEM dargestellt (n = 4). #: Vergleich zwischen Gruppe C und alle anderen Gruppen, außer F, # p-Gruppe < 0,0001. *: Vergleich zwischen Gruppe F und alle anderen Gruppen * p < 0,05, *** p < 0,0001. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 4
Abbildung 4: Hochauflösender Multiphoton Mikroskopie (SHG/TPEF) Bildgebung und Quantifizierung der Angiogenese im Großraum Knochen Defekt der Maus Calvaria.Trong > (A) A schematische Darstellung einer Maus unter MPM zu scannen. Der orange Kreis stellt die defekt-Website, die roten Tubuli darstellen Blutgefäße und das Grün steht für Kollagen. (B) Unoperated und operierten Tieren wurden 8 Wochen nach der Implantation mit MPM gescannt. SHG, TPEF, SHG/TPEF zusammengeführt und 3D Bilder angezeigt werden. Die gestrichelte Linie stellt die Grenze entlang der Knochendefekt in der Kontrollgruppe, die anhand der SHG Signale. (C) Blutgefäß Bereich Quantifizierung im Bereich mangels Kontrolle, PH und PHp von Woche 2 bis 8. Woche nach der Implantation. Alle Daten sind als Mittelwert ± SEM dargestellt (n = 5). : Statistische Analyse zwischen Gruppen PH und PHp, p < 0,0001. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 5
Abbildung 5: RT-qPCR Analyse der Pdgf-b (A) und Angiogenese-Genen vWF (B) und VEGRF2 (C) Ausdruck in drei Gruppen. Proben aus 4 Tiere wurden für jeden Zeitpunkt analysiert. #: Vergleich zwischen den Gruppen PHp und PH, # p < 0,05, # p < 0,01 und #p < 0,0001. *: Vergleich zwischen den PHp und Kontrollgruppen * p < 0,05, ** p < 0.01 und *** p < 0,0001. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 6
Abbildung 6: Bewertung der In Vivo Knochenbildung mit MicroCT scannen. Kontrollgruppe ohne implantierten Gerüste. PH-Gruppe innerhalb von implantierten PLGA/nHAp Gerüst nur. PHp-Gruppe innerhalb von implantierten PLGA/nHAp Gerüst durch den LV- Pdgfb Partikeln modifiziert. Bitte klicken Sie hier für eine größere Version dieser Figur.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Knochen ist ein stark vaskularisierte Gewebe mit einer einzigartigen Kapazität kontinuierlich zu heilen und während der gesamten Lebensdauer eines einzelnen1umzugestalten. Das Niveau der Vaskularisierung ist wichtig für Osteogenesis und defekt Reparatur. Niedrige Vaskularisierung begrenzt die breite klinische Anwendung von Tissue-Engineering Knochen. Bau eines stark vaskularisierte Tissue-Engineering Knochens nach der Theorie der Bionik ist ein Werkzeug für die Reparatur von Knochendefekten großes Segment geworden. Verschiedene Arten von Gerüsten haben erfolgreich eingesetzt, um vergleichsweise kleine knöcherner Defekte zu reparieren. Aber für kritische Knochendefekten, die Anwendung von Gerüsten, Gesichter Hindernisse noch zu reparieren hauptsächlich aufgrund unzureichender Blut liefern Sie für defekt Reparatur. Daher ist die Verbesserung der Blutversorgung während des Prozesses der Reparatur von großen Knochendefekten eines der wichtigsten Themen im Tissue Engineering.

Menschen nutzen bioaktive Material beschichtet Gerüste um zu helfen, um die notwendigen morphogenetischen Felder zu etablieren, die stimulieren, rekrutieren und fördern die Chemotaxis, Differenzierung und Proliferation der Zellen für Neovasculature und Knochen Bildung benötigt 37. Neovasculature in Tissue-Engineering Gerüste ist wichtig für die Zellen mit Sauerstoff und Nährstoffen, für die Beseitigung von Abfallstoffen, erhalten und letztlich für die Erfüllung der Funktion von Gerüsten. Die Ziele dieser Studie waren Angiogenese mit in Vivo multiphoton Mikroskopie in einer gentechnisch veränderten, 3D-gedruckten PLGA/nHAp Gerüst für die calvarial kritische Knochen defekt Reparatur untersuchen und bewerten die Auswirkungen der Verwendung von Knochen regeneration MicroCT.

Trotz dramatischer Erfolge im Knochen Gewebe-Engineering, in Vivo Visualisierung und Quantifizierung der Neovaskularisation in Gerüste während Knochen ist Regeneration nach wie vor eine Herausforderung. Die meisten mikroskopische bildgebende Systemen sind nicht in der Lage, volumetrische Informationen über Angiogenese. Traditionelle bildgebende Verfahren, wie MicroCT, MRI und histologische Analysen sind destruktiv, kompliziert und umständlich und geringer räumlicher Auflösung und lange Bildaufnahme Mal38. MPM-Bildgebung ist jedoch, dass eine neuartige Bio-Imaging-Modalität, die Blutgefäße zu erfassen, kann in Vivo in hoher Auflösung und minimal-invasive Weise signalisiert. Es ist in der Lage, neue Schiffe dünner als 10 µm (Abbildung 4 b) zu erkennen. Neben Blutgefäß Bilder beobachteten wir auch eine Masse an neuen Ablagerung von Kollagen (die grüne Farbe in Abbildung 4 b) und die GIF-Grafiken in das ergänzende Material wie durch SHG Signale, die Knochenbildung Gewebe aus einem anderen Blickwinkel zu zeigen. Theoretisch konnte Blutgefäß Bilder abgerufen werden, ohne die Verwendung von Kontrastmitteln. Jedoch in der vorliegenden Studie ein Kontrastmittel verwendet, um bessere Bilder zu erhalten und lokale Haut Sicherstellung die richtige Scan Tiefe entfernt. Dies wäre unnötig, wenn leistungsfähigere bildgebende Systeme in der Zukunft für die wirklich nicht-invasive Bildgebung zur Verfügung stehen.

HAp ist eine biomedizinische Material für Knochen Geweberegeneration, das aufgrund seiner guten Osteokonduktion und Osteoinduction Eigenschaften weit verbreitet ist. HAp hat gute Fähigkeit des Bindens DNA-Vektoren und Beibehaltung und Vektoren, darunter Virenvektoren39zu stabilisieren. Im Vergleich zu Microsized HAp, nanoskaligen HAp Partikel besitzen hohe spezifische Flächen und zeigen daher besser zellulären Verhalten und mechanischen Eigenschaften40. Aus diesen Gründen sind nHAp Teilchen ein Bestandteil der Gerüste. Die Oberfläche und Cross-sectional SEM Bilder der PLGA/nHAp Gerüst in Abbildung 1 dargestellte zeigt, dass gefertigte Gerüste eine gut vernetzte Porenstruktur und gleichmäßig verteilte Porengrößen aufweisen. Die Immobilisierung des Virus auf Biomaterial Träger kann Viren-Aktivität beeinflussen. Also testeten wir die Bioaktivität der LV Partikel aus der Gerüste durch die Untersuchung ihrer Transfektion Tätigkeit entlassen. Die Freigabe Profile der LV-Partikeln aus der Gerüste und ihre Bioactivities waren bewertet in Vitro, demonstrieren die kontrollierte Lieferung von bioaktiven LV-Partikel für fünf Tage (Abbildung 2). Darüber hinaus konzentriert sich unsere in-vitro- Studie über das Potenzial von PDGF-BB, die Migration von primären MSCs zu stimulieren. Diese Ergebnisse deuten darauf hin, dass die LV-Partikel bioaktiven PDGF-BB und effektiv stimuliert BMSC Migration zum Ausdruck gebracht.

Um die Kapazität für die Angiogenese und Knochen Regeneration in Vivobestätigen, wurden PHp-Gerüste in murinen calvarial kritische Knochendefekte implantiert. Schiff-Formation wurde mit angiogenen Marker, RT-qPCR Analyse und Blutgefäß dichten beobachtet mit SHG/TPEF Bildgebung bestätigt. Sowohl die zwei Sätze von Experimenten gezeigt, dass die Angiogenese und Blutgefäß-Bildung im Umgang mit gentechnisch veränderten Gerüste deutlich verbessert wurden. Diese Ergebnisse deuten darauf hin, dass PDGF-BB nicht nur direkt stimuliert die Angiogenese, sondern auch Angiogenese-Genen induziert. Unterdessen MicroCT Messungen zeigen, dass Pdgf-b-mit Gerüsten wesentlich gefördert Knochenbildung, die im Vergleich zu den unveränderten Gerüste sind und gut mit den Neovasculature in das Gerüst korreliert. Diese Ergebnisse deuten darauf hin, dass gentechnisch veränderte, bioaktive Scaffolds Angiogenese und Geweberegeneration erheblich verbessern.

Die hier vorgestellten Ergebnisse zeigen, dass die Lentivirus-vermittelten gentechnische Veränderung von Gerüsten große knöcherner defekt Reparatur in einem murinen calvarial kritischen defekt Knochenmodell, wahrscheinlich durch verbesserte Angiogenese erleichtert. In Vivo MPM-Bildgebung bietet darüber hinaus ein einzigartiges Werkzeug, Angiogenese und Osteogenesis im Knochen zu verstehen Gerüste und ermöglicht weitere Aufklärung, ob ein bestimmter Gerüst Neovaskularisation nützt. Multiphoton intravitalen Mikroskopie Imaging bietet eine Modalität für das Verständnis der Physiologie und Pathophysiologie der Angiogenese in Geweben und Gerüste. Allerdings gibt es einige Einschränkungen, wenn Sie diese Technik verwenden. Erstens erfordert die chirurgische Vorbereitung besonderen Expertise. Entzündungen, die durch unqualifizierte Bedienung wird die MPM Bildqualität erheblich verringern. Zweitens ist aufgrund der MPM imaging Geschwindigkeitsbegrenzung, ein speziell angefertigte Maus Kopf Halter erforderlich, um die Elemente verursacht durch Herzschlag und Atmung zu reduzieren. Drittens müssen für langfristige Belichtung Tieren intraperitoneal oder intravenös mit Kochsalzlösung um Austrocknung zu verhindern injiziert werden.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren erklären, dass sie keine finanziellen Interessenkonflikte.

Acknowledgements

Diese Studie wurde unterstützt durch das Shenzhen Pfau Programm, China (Nr. 110811003586331), Shenzhen Basic Research-Programm (No. JCYJ20150401150223631, Nr. JCYJ20150401145529020 und Nr. JCYJ20160331190714896), Guangdong öffentliche Forschung und Kapazitätsaufbau Sonderprogramm (Nr. 2015A020212030), National Natural Science Foundation of China (Nr. 81501893), das National Major Basic Forschungsprogramm von China (2013CB945503), und die SIAT Innovationsprogramm für exzellente junge Forscher (Y5G010).

Materials

Name Company Catalog Number Comments
Poly(D,L-lactide-co-glycolide) (PLGA) Sigma P1941 L/G ratio 75:25, MW 66000-107000
Hydroxyapatite nanoparticles Sigma 702153 Average diameter < 200 nm
Chloroquine diphosphate salt Sigma C6628
FITC-conjugated 250-kD dextran Sigma FD250S
1,4-dioxane lingfeng,Shanghai 0.45 micron
Stericup filters Merck Millipore Corporation SLHV033RB
PDGF-BB Cdna Sino Biological, Inc MZ50801-G
Anti-PDGF-BB mouse polyclonal antibody  BioVision, Inc 5489-30T
PDGF-BB recombinant protein 4489-50
Calcium-phosphate transfection solution Promega Corporation E1200
L-DMEM Hyclone SH30021.01
DPBS Hyclone SH30028.01
Penicillin-Streptomycin, Liquid Thermo Fisher Scientific 15140122
FBS Thermo Fisher Scientific 10099-141
Transwell  Corning 3422
Male BALB/c mice Guangdong Medical Laboratory Animal Center 
sodium pentobarbital  Merck 1063180500
multiphoton microscopy A homemade in Shenzhen Institutes of Advanced Technology to detect two-photon excited fluorescence (TPEF) and second harmonic generation signal (SHG).
isoflurane Keyuan, Shandong 401750169
TRIzol reagent Invitrogen 15596018
PrimeScript RT Master Mix (Perfect Real Time) Takara RR420B
SYBR Premix Ex Taq (Tli RNaseH Plus) Takara RR036B
Hematoxylin and eosin Beyotime C0105
Paraffin Leica  RM2235
Ultracentrifuge OPtima L-100XP Beckman Coulter L-100XP
Low-temperature printer  Tsinghua university A homemade in Tsinghua university
LightCycler 480 instrument  Roche 5815916001
microCT Bruker 1176
commercial software Bruker
Buprenorphine

DOWNLOAD MATERIALS LIST

References

  1. Hu, X., et al. GPNMB enhances bone regeneration by promoting angiogenesis and osteogenesis: potential role for tissue engineering bone. J Cell Biochem. 114, (12), 2729-2737 (2013).
  2. Schroeder, J. E., Mosheiff, R. Tissue engineering approaches for bone repair: concepts and evidence. Injury. 42, (6), 609-613 (2011).
  3. Chiarello, E., et al. allograft and bone substitutes in reconstructive orthopedic surgery. Aging Clin Exp Res. 25, S101-S103 (2013).
  4. Elangovan, S., et al. The enhancement of bone regeneration by gene activated matrix encoding for platelet derived growth factor. Biomaterials. 35, (2), 737-747 (2014).
  5. Bouyer, M., et al. Surface delivery of tunable doses of BMP-2 from an adaptable polymeric scaffold induces volumetric bone regeneration. Biomaterials. 104, 168-181 (2016).
  6. Rezwan, K., et al. Biodegradable and bioactive porous polymer/inorganic composite scaffolds for bone tissue engineering. Biomaterials. 27, (18), 3413-3431 (2006).
  7. Burg, K. J., Porter, S., Kellam, J. F. Biomaterial developments for bone tissue engineering. Biomaterials. 21, (23), 2347-2359 (2000).
  8. Xiao, Y., et al. Modifications of collagen-based biomaterials with immobilized growth factors or peptides. Methods. 84, 44-52 (2015).
  9. Chen, G., Lv, Y. Immobilization and Application of Electrospun Nanofiber Scaffold-based Growth Factor in Bone Tissue Engineering. Curr Pharm Des. 21, (15), 1967-1978 (2015).
  10. Kofron, M. D., Li, X., Laurencin, C. T. Protein- and gene-based tissue engineering in bone repair. Curr Opin Biotechnol. 15, (5), 399-405 (2004).
  11. Chen, F. M., et al. New insights into and novel applications of release technology for periodontal reconstructive therapies. J Control Release. 149, (2), 92-110 (2011).
  12. Winn, S. R., et al. Gene therapy approaches for modulating bone regeneration. Adv Drug Deliv Rev. 42, (1-2), 121-138 (2000).
  13. Chang, P. C., et al. Adenovirus Encoding Human Platelet-Derived Growth Factor-B Delivered to Alveolar Bone Defects Exhibits Safety and Biodistribution Profiles Favorable for Clinical Use. Hum Gene Ther. 20, (5), 486-496 (2009).
  14. Phipps, M. C., Xu, Y. Y., Bellis, S. L. Delivery of Platelet-Derived Growth Factor as a Chemotactic Factor for Mesenchymal Stem Cells by Bone-Mimetic Electrospun Scaffolds. Plos One. 7, (7), (2012).
  15. Gehmert, S., et al. Angiogenesis: The role of PDGF-BB on Adiopse-tissue derived Stem Cells (ASCs). Clin Hemorheol and Microcirc. 48, (1-3), 5-13 (2011).
  16. Chang, P. C., et al. PDGF-B gene therapy accelerates bone engineering and oral implant osseointegration. Gene Ther. 17, (1), 95-104 (2010).
  17. Javed, F., et al. Significance of the platelet-derived growth factor in periodontal tissue regeneration. Arch Oral Biol. 56, (12), 1476-1484 (2011).
  18. Murali, R., et al. Biomimetic hybrid porous scaffolds immobilized with platelet derived growth factor-BB promote cellularization and vascularization in tissue engineering. J Biomed Mater Res A. 104, (2), 388-396 (2016).
  19. Andrae, J., Gallini, R., Betsholtz, C. Role of platelet-derived growth factors in physiology and medicine. Genes Dev. 22, (10), 1276-1312 (2008).
  20. Wosnitza, M., et al. Plasticity of human adipose stem cells to perform adipogenic and endothelial differentiation. Differentiation. 75, (1), 12-23 (2007).
  21. Hankenson, K. D., et al. Angiogenesis in bone regeneration. Injury. 42, (6), 556-561 (2011).
  22. Schmidt, C., et al. Rapid three-dimensional quantification of VEGF-induced scaffold neovascularisation by microcomputed tomography. Biomaterials. 30, (30), 5959-5968 (2009).
  23. Perng, C. K., et al. In Vivo Angiogenesis Effect of Porous Collagen Scaffold with Hyaluronic Acid Oligosaccharides. J Surg Res. 168, (1), 9-15 (2011).
  24. Sun, Y., et al. Imaging tissue engineering scaffolds using multiphoton microscopy. Microsc Res Tech. 71, (2), 140-145 (2008).
  25. Fan, X., et al. Noninvasive monitoring of placenta-specific transgene expression by bioluminescence imaging. PLoS One. 6, (1), e16348 (2011).
  26. Yeo, M. G., Kim, G. H. Preparation and Characterization of 3D Composite Scaffolds Based on Rapid-Prototyped PCL/β-TCP Struts and Electrospun PCL Coated with Collagen and HA for Bone Regeneration. Chem Mater. 24, (5), 903-913 (2012).
  27. Mao, Y., et al. Lentiviral Vectors Mediate Long-Term and High Efficiency Transgene Expression in HEK 293T cells. Int J Med Sci. 12, (5), 407-415 (2015).
  28. Li, J., et al. Investigation of angiogenesis in bioactive 3-dimensional poly (D,L-lactide-co-glycolide)/nano-hydroxyapatite scaffolds by in vivo multiphoton microscopy in murine calvarial critical bone defect. Acta Biomater. 42, 389-399 (2016).
  29. Abbasi, H., et al. Lentiviral vector-mediated transduction of goat undifferentiated spermatogonia. Anim Reprod Sci. 163, 10-17 (2015).
  30. Pigossi, S. C., et al. Bacterial cellulose-hydroxyapatite composites with osteogenic growth peptide (OGP) or pentapeptide OGP on bone regeneration in critical-size calvarial defect model. J Biomed Mater Res A. (2015).
  31. Bos, G. D., et al. The effect of histocompatibility matching on canine frozen bone allografts. J Bone Joint Surg Am. 65, (1), 89-96 (1983).
  32. Hollinger, J. O., Kleinschmidt, J. C. The critical size defect as an experimental model to test bone repair materials. J Craniofac Surg. 1, (1), 60-68 (1990).
  33. Hollanders, K., et al. Bevacizumab Revisited: Its Use in Different Mouse Models of Ocular Pathologies. Curr Eye Res. 40, (6), 611-621 (2015).
  34. Gao, L. QSIM: quantitative structured illumination microscopy image processing in ImageJ. Biomed Eng Online. 14, 4 (2015).
  35. Kobat, D., et al. Deep tissue multiphoton microscopy using longer wavelength excitation. Opt Express. 17, (16), 13354-13364 (2009).
  36. Lohmann, P., et al. Bone regeneration induced by a 3D architectured hydrogel in a rat critical-size calvarial defect. Biomaterials. 113, 158-169 (2016).
  37. Lv, J., et al. Enhanced angiogenesis and osteogenesis in critical bone defects by the controlled release of BMP-2 and VEGF: implantation of electron beam melting-fabricated porous Ti6Al4V scaffolds incorporating growth factor-doped fibrin glue. Biomed Mater. 10, (3), (2015).
  38. Guldberg, R. E., et al. 3D imaging of tissue integration with porous biomaterials. Biomaterials. 29, (28), 3757-3761 (2008).
  39. Boehler, R. M., et al. A PLG/HAp composite scaffold for lentivirus delivery. Biomaterials. 34, (21), 5431-5438 (2013).
  40. Heo, S. J., et al. Fabrication and characterization of novel nano- and micro-HA/PCL composite scaffolds using a modified rapid prototyping process. J Biomed Mater Res A. 89, (1), 108-116 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics