Visualización de angiogénesis por microscopía multifotón En Vivo en modificados genéticamente 3D-PLGA/nHAp andamio para Calvarial críticos de la reparación del defecto óseo

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Aquí, presentamos un protocolo para visualizar la formación de vasos sanguíneos en vivo y en tiempo real en 3D andamios por microscopía multifotón. Angiogénesis en andamios modificados genéticamente fue estudiada en un modelo de defecto murino hueso calvarial de crítica. Más nuevos vasos sanguíneos fueron detectados en el grupo de tratamiento que en los controles.

Cite this Article

Copy Citation | Download Citations

Li, J., Jahr, H., Zheng, W., Ren, P. G. Visualizing Angiogenesis by Multiphoton Microscopy In Vivo in Genetically Modified 3D-PLGA/nHAp Scaffold for Calvarial Critical Bone Defect Repair. J. Vis. Exp. (127), e55381, doi:10.3791/55381 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

La reconstrucción de defectos óseos de tamaño crítico sigue siendo un grave problema clínico debido a la pobre angiogénesis dentro tejido-dirigida andamios durante la reparación, que da lugar a una falta de suficiente riego sanguíneo y provoca la necrosis de los tejidos nuevos. Rápida vascularización es un requisito vital para la supervivencia de tejidos nuevos e integración con el existente tejido anfitrión. La generación de novo de vasculatura en andamios es uno de los pasos más importantes en la fabricación más eficiente, lo que permite reparar el tejido que crece en un andamio de la regeneración ósea. Para abordar este problema, la modificación genética de un andamio de biomaterial se utiliza para acelerar la angiogénesis y osteogénesis. Sin embargo, visualización y seguimiento en vivo formación de vasos sanguíneos en tiempo real y en tres dimensiones (3D) andamios o nuevo tejido óseo sigue siendo un obstáculo para la ingeniería de tejido óseo. Microscopía multifotón (MPM) es una modalidad de proyección de imagen de bio novela que puede adquirir datos volumétricos de estructuras biológicas de forma mínimamente invasiva y alta resolución. El objetivo de este estudio fue visualizar la angiogénesis con microscopía multifotón en vivo en un andamio de 3D-PLGA/nHAp genéticamente modificado para la reparación del defecto hueso calvarial crítica. Andamios PLGA/nHAp fueron funcionalizados para la entrega sostenida de un gen de factor de crecimiento pdgf-b con vectores lentivirales (LV -pdgfb) para facilitar la angiogénesis y a mejorar la regeneración ósea. En un hueso calvarial de crítico implantado andamio defecto modelo de ratón, las áreas de vasos sanguíneos (BVAs) en PHp andamios fueron significativamente mayores que en PH andamios. Además, la expresión de pdgf-b y genes relacionados con la angiogénesis, vWF y VEGFR2, aumentado correspondientemente. MicroCT análisis indicó que la nueva formación de hueso en el grupo de PHp mejorada dramáticamente en comparación con los otros grupos. A nuestro conocimiento, esta es la primera vez microscopía multifotón fue utilizado en ingeniería del tejido fino del hueso para investigar la angiogénesis en un andamio biodegradable 3D en vivo y en tiempo real.

Introduction

El hueso es un tejido altamente vascularizado que continúa para remodelar durante la vida de un individuo1. La regeneración ósea rápida y eficaz de los defectos de hueso grande como resultado de trauma, no sindical, resecciones tumorales o malformaciones craneofaciales es un proceso fisiológico complejo. Enfoques terapéuticos tradicionales utilizados para la reparación del defecto óseo incluyen implantación de autoinjerto y aloinjerto, pero su uso implica varios problemas y limitaciones, tales como la disponibilidad limitada, morbosidad del sitio donante importante, un alto riesgo de infección, y la sede de rechazo inmune2,3. Sin embargo, injertos óseos artificiales ofrecen una alternativa eficiente para paliar estas limitaciones. Pueden ser hechos de materiales biodegradables, son fáciles de fabricar con un tamaño de poro adecuado y pueden ser modificados genéticamente4,5.

En la actualidad, se han empleado varios andamios de ingeniería de tejidos en el desarrollo de la ingeniería de tejido óseo6,7. Para inducir la regeneración y reparación óseas más eficazmente, Biomateriales Ingeniería combinadas con factores de crecimiento han surgido y logra buenos resultados8,9. Por desgracia, la vida media corta, fácil perder actividad y dosis supraphysiological de factores de crecimiento para la eficacia terapéutica limitan su uso clínico10. Para superar estos problemas, la entrega de genes del factor de crecimiento en lugar de factores de crecimiento se ha demostrado como un enfoque eficaz para mantener la actividad biológica para el tratamiento de defectos oseos y enfermedades11,12. Vectores virales son prometedor entrega herramientas para la regeneración de los tejidos debido a su alta expresando eficiencia13.

Entre los factores de crecimiento, factor de crecimiento derivado de plaquetas (PDGF-BB) fue seleccionado en este estudio porque es un mitógeno y chemoattractant para las células mesenquimales y osteogénicos, sino un estimulante de la angiogénesis14,15 . Anteriores estudios clínicos y preclínicos demostraron que PDGF-BB podría con seguridad y efectivamente promover la reparación ósea en defectos oseos periodontales16,17. Estudios recientes revelaron que el PDGF-BB estimula angiogénesis por motivar la célula endotelial proliferación y la migración en vivo18,19. Además, PDGF-BB puede también hacer que las células madre mesenquimales (MSCs) capaces de diferenciarse en células endoteliales20y este destaca más el papel potencial de MSCs en neovascularización. Por lo tanto, inducir la formación de novo de vasculatura en andamios con PDGF-BB es un paso importante para la reparación de tejido crecido en andamios en ingeniería del tejido fino del hueso.

Defecto de hueso curativo es un proceso morfogenético de tejido dinámico que requiere osteogénesis coordinada y angiogénesis en la reparación de posiciones21. Neoangiogénesis en andamios de ingeniería de tejido implantados es un requisito previo esencial para el suministro de células con nutrientes y oxígeno para el crecimiento y la supervivencia y para la eliminación de desechos metabólicos. Utilizan métodos de la proyección de imagen, incluyendo rayos x micro-computarizada tomografía (microCT), la proyección de imagen de resonancia magnética (MRI), microscopía electrónica (SEM), tomografía de coherencia óptica (OCT) y el láser confocal de la microscopia, la exploración se aplican en lugar de examinación histológica para obtener angiogénesis información22,23. Sin embargo, estos métodos enfrentan a diversos obstáculos en la visualización y medición occidentalización en andamios 3D en ingeniería del tejido fino del hueso. Microscopía multifotón (MPM) es una técnica de bio-proyección de imagen relativamente nueva que tiene la clara ventaja de simultáneamente visualizar células, matriz extracelular y redes vasculares en vivo. Posee una capacidad inherente de proyección de imagen tridimensional para la penetración de tejido profundo y provoca fotodaño baja. Por lo tanto, en la última década, el MPM ha ganado mucha atención en estudios biomédicos24, incluyendo en neurociencias, la inmunología y la dinámica de la célula de vástago. Sin embargo, apenas se utiliza en la investigación ortopédica.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

el cuidado de los animales fue en cumplimiento de la guía para el cuidado y uso de laboratorio animales de la provincia de Guangdong. Todos los procedimientos fueron realizados bajo la supervisión y aprobación del Comité de ética para la investigación Animal, institutos de avanzada tecnología de Shenzhen, de la Academia China de Ciencias.

1. lentivirales (LV) producción

  1. clon de cDNA de pdgf-b en un vector de expresión lentivirales (pLenti6/5-eGFP o LV-eGFP) en un múltiple encargo-clonación sitio aguas abajo del promotor de citomegalovirus con Spe I y Sal I sitios de restricción para construir el plásmido pLenti6/5-PDGFB-eGFP (LV - pdgfb) 25.
  2. Producir partículas lentivirales (LV - pdgfb) de las células HEK - 293 pies por transferencia junto con los plásmidos de empaquetado de virus (pLP1 pLP2 y pVSV G) utilizando el método estándar de fosfato de calcio con cloroquina (concentración final: 25 μm) 25.
  3. después de 48 h de la transfección, la cosecha y filtro de virus que contiene 500 mL sobrenadante con un filtro (0.45 μm). Posteriormente, las partículas virales se concentran por ultracentrifugación a 89.000 x g durante 2 h. resuspender en 200 μL de tampón fosfato solución salina (PBS), alícuota y almacenar a -80 ° C.
  4. Para determinar la concentración de lentivirus, incubar las células HEK293T con lentivirales en serie diluido por 24 h y calcular el título lentivirales, como se describió anteriormente 25.

2. Fabricación de andamios PLGA/nHAp 3D impreso e inmovilización de LV

  1. disolver 20 g de PLGA (poli D, L-lactide-co-glicólido) material en 20 mL de 1, 4-dioxano para formar una solución homogénea. Añadir 2 g de combinar polvo de HAp (nano-hydroxyapatide) (nHAp) a la solución; el EGLP: nHAp ratio debe ser 10:1 (w/w).
  2. Agitar vigorosamente la solución mezclada (revolvimiento de velocidad: 1.500 rpm) a temperatura ambiente durante 16 h con un agitador magnético hasta para formar una pasta uniforme. Fabricar en andamios porosos de PLGA/nHAp utilizando una impresora 3D de baja temperatura con un inyector automatizado que deposita en el fondo de capa por capa, pegar a la tapa, según un modelo prediseñado 26; los tamaños de poro de las matrices de soporte van desde 200 a 400 μm.
  3. Vacío liofilización los andamios durante 48 h para quitar el solvente tan completamente como sea posible. Remoje las matrices de soporte en solución de etanol 75% durante 1 h para la esterilización y liofilizar para conseguir andamios neutros, asépticos.
    Nota: Los parámetros principales para liofilización vacío incluyen la temperatura de condensación (° C) y el grado de vacío (Pa). Bajo un grado de vacío de 45 Pa, los andamios PLGA/nHAp eran vacío liofilizada a-78 ° C por 48 h eliminar completamente el disolvente.
  4. Añadir 10 μl de partículas LV (4.5 x 10 5) a cada PLGA/nHAp andamio (4 x 4 x 2 mm) e incubar los andamios por 2 h a 37 ° C en una incubadora humidificada para permitir la adsorción.
  5. Después de la inmovilización, enjuague los andamios dos veces con PBS para eliminar las partículas de LV. Snap freeze los andamios recubiertos en partículas de LV en nitrógeno líquido, liofilizar otra vez y almacenar a-80 ° C para su uso futuro.

3. In Vitro Cinética de liberación de partículas de LV de andamios y ensayo de actividad de transducción LV

  1. incubar andamios 3D (4 x 4 x 2 mm) con LV-proteína verde fluorescente (LV-eGFP, 4,5 x 10 5 LV partículas) en 1 mL de DMEM completo en criogénico 2,0 mL frascos a 37 º C con agitación durante 5 días.
  2. Se toma una muestra de 1 mL cada 12 h de 12 h a 120 h de incubación post y cambiar el medio. En cada momento, añadir 1 mL de medio fresco en lugar de 1 mL de medio de incubación.
  3. Usar los medios de comunicación recogidos para transducir las células HEK293T por Co incubar durante 48 h. medida el número de partículas bioactivas de LV por determinar el número de GFP-positivas HEK293T células por citometría de flujo 27.
    1. Antes de transducción de las células HEK293T, retire el medio de cultivo y enjuague las células HEK293T dos veces con PBS. Añadir los medios recogidos con lentivirus liberados de los andamios al pozo (1 mL/pocillo) y de la cultura con las células HEK293T durante 48 h a 37 ° C en una incubadora humidificada.

4. In Vitro Evaluación de la médula ósea MSC (CMMo) migración

  1. antes del ensayo de migración, preparar BMSCs expresando la proteína fluorescente de tomate (BMSCs-T) y de proteína (BMSCs-P) de PDGF-BB 28.
  2. Realizar el análisis de la migración de CMMo con un compartimiento de Boyden usando una placa de 24 pozos y filtros de policarbonato con un tamaño de poro de 8 μm.
    1. Lugar 0,5 mL de BMSCs (5 x 10 4) transfected con LV expresan la proteína fluorescente de tomate (BMSCs-T) en las cámaras superiores. Colocar 0,5 mL de BMSCs (2 x 10 5) transfected con LV expresando proteínas PDGF-BB (BMSCs-P) en las cámaras inferiores.
  3. Incluyen seis grupos en este experimento y agregar 500 μl del compartimiento inferior de cada pocillo.
    A. control, medio libre de suero de blanco sólo
    control B. FBS, medio suplementado con 10% FBS
    control C. PDGF-BB, PDGF-BB de 4 ng/mL en medio libre de suero
    D. PDGF-BB agarrar grupo, PDGF-BB (4 ng/mL) y anticuerpos policlonales anti-PDGF-BB (4 ng/mL) en medio libre de suero
    Grupo CMMo E., 2 x 10 5 BMSCs en medio libre de suero
    Grupo F. BMSCs-P, 2 x 10 5 P BMSCs en medio libre de suero.
  4. Incubar durante 48 h en 5% CO 2 y a 37 ° C en una incubadora humidificada. Luego, eliminar las células migradas en el lado inferior de la cámara y recogerlos para la cuantificación del número de BMSCs-T por citometría de flujo.
    1. Quitar las células migradas en la cámara baja lado usando un raspador celular y resuspender las células migradas con 2 mL de PBS. Cuantificar el número de T-BMSCs migrado por citometría de flujo 29.

5. Establecimiento de un Calvarial crítico hueso defecto modelo murino y trasplante del andamio

Nota: ratones machos BALB/c (7 semanas) fueron compradas de Guangdong médica centro de animales de laboratorio (Guangdong, China).

Experimentan de ratones machos
  1. inscribir un total de 42 para el defecto del hueso calvarial. Los ratones se dividen al azar en tres grupos, con catorce en cada grupo que recibir los siguientes tratamientos: Grupo A, no implantes; Grupo B, PH andamios implantaron (PLGA/nHAp); y grupo C, PHp andamios implantados (nHAp/PLGA/LV-pdgfb).
  2. Anestesiar los animales con la administración intraperitoneal de pentobarbital sódico (50 mg/kg). Quitar la piel con Pasta depilatoria y limpiar la piel de la cabeza con una solución de alcohol 75% antes de hacer la primera incisión. Fijar la cabeza de cada ratón con un instrumento estereotáctico para mantenerlo inmóvil durante la cirugía.
  3. Hacer una incisión inicial con bisturí y luego agrandarlo ingenioHS tijeras para crear una incisión en la piel lineal de 1 cm. Raspe el periostio del hueso del cráneo a la superficie del hueso del cráneo usando un hisopo de algodón estéril.
  4. Utilizar una fresa trépano para crear un defecto de tamaño crítico de 4 mm de diámetro en el lado izquierdo de la calvaria 30. Transplante el andamio en el sitio de defecto óseo.
    Nota: Defectos de tamaño crítico (CSD) se definición originalmente como " el tamaño más pequeño intraóseo de la herida en un hueso determinado y especies de animales que no se curan espontáneamente durante la vida del animal. " en este experimento, el defecto de 4 mm de diámetro es un defecto de tamaño crítico hueso, según el estudio previamente 31 , 32.
  5. Utilizar fórceps oftálmicos para retroceder el periostio suavemente para cubrir el sitio quirúrgico. Suturar la piel Incisa con tres puntadas por cm.
  6. Realizar cuidado post-operatorio. Administrar la buprenorfina analgésica (0.1 mg/kg) para aliviar el dolor. Mantener la temperatura del cuerpo con una almohada hasta que el animal se despierta. Posteriormente, alimentar los animales con alimentos y agua y registrar su actividad todos los días hasta el final de la prueba. Nota: Se puede administrar Analgesia antes del procedimiento dependiendo de su cuidado de los animales local Comité directrices.

6. En Vivo Proyección de imagen de angiogénesis en el defecto óseo con MPM

Nota: dextrano de las kD 250 (10 mg/mL) en solución salina, conjugado con FITC se inyectó por vía intravenosa en ratones para obtener alta SNR (signal to noise ratio) imágenes de vasos sanguíneos nuevos según un estudio anterior 33. Tenga en cuenta que se trata de un procedimiento de supervivencia.

  1. montar el sistema de microscopía multifotón (MPM) para imágenes de señal (SHG) de segunda generación armónica y dos fotones fluorescencia emocionada (TPEF).
  2. Anestesiar los animales con una inyección intraperitoneal de pentobarbital sódico (50 mg/kg) e inmovilizar los animales en una placa calefactora para mantener su temperatura corporal a 37 ° C a lo largo de los experimentos. Use 3.0% isoflurano gas en 100% de oxígeno para mantener la analgesia y la anestesia satisfactoria durante el proceso de proyección de imagen. Inyectar por vía intraperitoneal una solución salina (200 μL/animal) para evitar la deshidratación antes de la proyección de imagen.
  3. Tune el láser de femtosegundo Ti zafiro a 860 nm. Crear un área de 512 x 512 μm muestreo mediante la exploración de un par de espejos galvo y usar objetivo de inmersión en agua NA1.0 al haz de excitación focusthe en la muestra y para recoger la señal de retrodispersión TPEF/SHG.
    Nota: La imagen fue realizada en un sistema generador de imágenes microscópico multifotón de construir casa (MPM). Durante la proyección de imagen, un láser de femtosegundo Ti zafiro fue sintonizado a 860 nm como la longitud de onda de excitación óptima. El rayo láser fue trama escaneado a través de un plano de la muestra utilizando un par de espejos del galvanómetro. Después de pasar por un espejo dicroico de 685 nm, la viga se centró en la muestra por un objetivo de 20 X NA1.0. Las señales inducidas de TPEF y SHG fueron recogidas por el mismo objetivo. Las señales se separó de la excitación láser por el espejo dicroico mencionados anteriormente y purificada por un filtro de paso corto de 680 nm. Las señales de TPEF y SHG fueron recogidas por un paquete de la fibra y llevó a cabo un espectrógrafo. El detector en el espectrógrafo fue un arsenal linear de los tubos de fotomultiplicador (PMTs). La combinación del espectrógrafo y PMTs arsenal linear ofrece la capacidad de grabar la señal en bandas espectrales consecutivas 16, de 400 nm a 600 nm, 12,5 nm a intervalos. Por lo tanto, las señales de TPEF y SHG se detecta al mismo tiempo y separadas en dominios espectrales. Además, para imágenes en 3D, un motor axial fue utilizado para controlar la profundidad de la proyección de imagen. El área de cada imagen se estableció en 512 x 512 μm y 2 μm (grupo control, 5 μm) ajustó el intervalo de profundidad. En particular, 5 sitios de cada defecto se reflejada para recoger datos estadísticamente significativos, y los sitios de proyección de imagen seleccionados se distribuyeron aleatoriamente y uniformemente a lo largo del defecto.
  4. 5 analizar sitios en cada defecto para recoger datos estadísticamente significativos para medir la formación de vasos.
    1. Uso exploración sitios aleatoriamente y uniformemente distribuidos a lo largo del defecto. Para el grupo control, tienen el campo de la cubierta (FOV) del área original del hueso y el borde del defecto, pero para los grupos PH y PHp, con el FOV en el andamio implantado.
    2. Hacer una incisión de 1 cm lineal de la piel con un bisturí y suturar la piel abierta a la fijación para revelar el sitio de trasplante. Utilice una jeringa para colocar una gota de agua entre el lente de inmersión y trasplantes para formar un vaso de agua.
  5. Adquirir imagen pilas cada 12 s en un 2 h, periodo de la proyección de imagen. Mostrar y analizar datos volumétricos mediante un programa personalizado de MATLAB y cuantificar las áreas de vasos sanguíneos con ImageJ software 34 , 35.

7. Análisis de expresión génica de Genes relacionados con la angiogénesis por RT-qPCR y pdgf-b

Nota: PCR se realizó siguiendo los pasos habituales: 95 ° C por 30 s, 40 ciclos de 95 ° C durante 5 s y 60 ° C durante 30 s. Post-PCR fusión curvas confirmaron la especificidad de la amplificación de solo objetivo, y se determinó el cambio de doblez del gen de interés con respecto a β-actina. La reacción para cada muestra fue probada tres veces.

  1. Cosecha implantados los andamios y los tejidos de los ratones experimentales en 2, 4 y 8 semanas después de la operación 36; las muestras del grupo de control (n = 4), tomadas en los mismos puntos de tiempo, debe ser de tejido óseo adyacente.
    Nota: En cada momento (2, 4 y 8 semanas), sacrificados a los ratones con la inhalación de CO 2. Diseccionar el calvaria y, posteriormente, retire y cosechar los andamios implantados del calvaria.
  2. Utilizar un reactivo comercial para extraer el ARN total de cada muestra según el fabricante ' protocolo de s. Utilizar el Kit de transcripción inversa para invertir-transcribir el ARN en ADNc tras el fabricante ' Protocolo s.
  3. Realizar PCR en tiempo real cuantitativa utilizando el sistema de detección de SYBR Green; los iniciadores se enumeran en la tabla 1.
Primer(5'–3')
Gene hacia adelante revés
pdgfb CATCCGCTCCTTTGATGATCTT GTGCTCGGGTCATGTTCAAGT
vWF CTCTTTGGGGACGACTTCATC TCCCGAGAATGGAGAAGGAAC
VEGFR2 GAAATGACACTGGAGCCTACA AG TCCATGCTGGTCACTAACAGAA G
β-actina GTATCCATGAAATAAGTGGTTAC AGG CAAT GCAGTACATAATTTACACAGAAG

tabla 1: conjuntos de Pimer.

8. MicroCT análisis de la regeneración del hueso

  1. Euthanize ratones con inhalación de CO 2 en operación después de 8 semanas. En un ambiente bien ventilado, con cuidado coloque cada ratón en una jaula del ratón limpio y bomba de gas de CO 2 en la jaula para anestesiar los ratones antes de la eutanasia.
  2. Diseque el cráneo para microCT proyección de imagen de la región del defecto óseo. Usuario los siguientes parámetros en los experimentos de exploración: 9 μm de resolución, Al filtro de 0.5 mm, 50 kV voltaje y actual 142 μA.
  3. Recon
  4. estructura todos los datos de proyección de imagen usando software comercial proporcionan por la empresa. Calibrar las exploraciones utilizando la función de calibración de un software de CTAn.
    Nota: Coloque una unidad de Hounsfield (HU) en los ratones en cada escaneo.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

PLGA poroso cilíndrico/nHAp andamios 0,6 mm de altura y 4 mm de diámetro fueron fabricados con una impresora 3D. Las morfologías de los andamios se analizaron mediante análisis de microscopia electrónica y microCT. Figura 1A se muestra la fotografía del andamio implantado. MicroCT exploración reveló que más del 85% de los poros tenía tamaños que van desde 200 a 400 μm (figura 1B). Proyección de imagen de SEM demostró que la superficie del andamio una microtopografía áspero, con microporos (diámetros aproximadamente 5-10 μm) que interconectan dentro de las matrices de soporte (figura 1D-F). Aproximadamente el 40% de la cantidad total de partículas revestidas de LV-eGFP (4.5 x 105) liberados de los andamios PLGA/nHAp comenzados con un efecto de estallido inicial dentro de las 24 h. La bioactividad de los virus liberados de LV a cumbre a las 24 h y luego continuamente disminuye, acercándose a 0 a las 120 h (figura 2). Estos datos indican que la actividad biológica de las partículas del LV más inmovilizada de andamio podría mantenerse hasta 96 h. La capacidad de migración de las MSCs-T se observó con el método FACS para investigar si LV con cDNA de pdgf-b podría expresar y llevar a la quimiotaxis CMMo, como se muestra en figura 3. El control positivo (C) y el grupo de PDGF-BB-expresión (F) exhibieron un nivel significativamente mayor de migración CMMo que los otros 4 grupos. Además, la migración de BMSCs en el Grupo F fue significativamente mayor que en el grupo C. No hubo diferencias significativas en la migración de CMMo entre los otros 4 grupos.

Angiogénesis en el defecto óseo evaluaron desde la 2ª al 8ª semana tras el implante MPM exploración. Figura 4A muestra una ilustración esquemática de un ratón bajo análisis de MPM. Obvio angiogénesis fue detectada en los grupos PH y PHp, pero los vasos sanguíneos eran apenas observables en el grupo control, donde sólo una capa de membranas fibrosas en toda la región de defecto de forma (Figura 4B). Los gráficos GIF muestran los tomógrafos de vasos sanguíneos de cada grupo (Datos complementarios). El área de nuevos vasos sanguíneos aumenta gradualmente con el tiempo en grupos PH y PHp, con patrones cada vez más similares. En la semana 8, los vasos aparecieron morfología similares a los observados en la etapa temprana; el único cambio fue que un número creciente de pequeñas embarcaciones fue creciendo en andamios (Figura 4B). La BVA del grupo PHp fue significativamente mayor que los otros dos grupos en todo momento puntos (figura 4). Además, había muchos sitios de deposición de colágeno, indicado por las señales de SHG (el color verde en los gráficos y los gráficos GIF) en los grupos PH y PHp, pero no en el grupo control (Figura 4B).

Para clarificar la relación de la expresión de PDGF-BB y la angiogénesis, se compararon los niveles de expresión de gene transcripción de pdgf-b, vWFy VEGFR2 con el método de RT-qPCR en 2, 4 y 8 semanas post-implantación ( Figura 5). Como era de esperar, pdgf-b expresión fue aumentada significativamente en el grupo de PHp en todos los puntos de tiempo, con un aumento de 5 a 13 veces en comparación con el control y los grupos PH (figura 5A). No hubo diferencias significativas entre el control y el grupo de PH, y el nivel de expresión de PDGF-BB casi se mantuvo constante desde la semana 2 a semana 8, como se muestra en la figura 5A. Poco a poco aumentaron los niveles de expresión de mRNA de vWF y VEGFR2 en los tres grupos y fueron los más altos en el grupo de PHp en todo momento tres puntos (figura 5B y 5C). Para el grupo de PH, no hubo ninguna significación estadística en comparación con el grupo de control, a pesar de la obvia angiogénesis (Figura 4B).

Para confirmar aún más que pdgf-b-que contienen andamios promoción hueso regeneración en vivo usando críticamente tamaño defecto calvarial en ratones BALB/c machos, microCT análisis suministran información para evaluar la regeneración ósea en 8 semanas Tras la implantación. Como se muestra en la figura 6, defectos en el grupo de PHp se llenaron de una masa de nuevo crecimiento de tejido óseo en los andamios, que hubo mucho menos nuevo hueso en los grupos de PH y control.

Figure 1
Figura 1: caracterización estructural de un andamio PLGA/nHAp 3D. (A) fotografía de un andamio de impresión 3D. (B) un microCT imagen de la porosidad total del andamio. (C) la microtopografía de la superficie de andamio observadas por SEM (D), 60 X, 2.000 X 5.000 X (E) y 10.000 aumentos (F). Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2: preparación de los Lentivirus y evaluación de la bioactividad de las partículas del LV-GFP. (A) representación esquemática de la construcción de vectores lentivirales. Después de 48 h de la transfección, se observaron células HEK - 293 pies bajo condiciones de campo (C) de la fluorescencia y luz (B). (D) evaluación In vitro de la actividad biológica de las partículas del LV-GFP acumulativamente liberado de PLGA/nHAp andamios. Todos los datos se presentan como la media ± SEM (n = 4). Haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3. Bioactividad de PDGF-BB como Factor Quimiotáctico potente respuesta de migración CMMo. T BMSCs (5 x 104) fueron sembradas en la parte superior transwell cámaras, con diferentes medios de comunicación de estado colocados en la parte inferior de las cámaras. (A) de control en blanco, medio sin suero; (B) equipos de control, suplementado con 10% FBS; Control (C) PDGF-BB, PDGF-BB de 4 ng/mL en medio libre de suero; (D) PDGF-BB agarrar grupo, PDGF-BB (4 ng/mL) y anticuerpos policlonales anti-PDGF-BB (4 ng/mL) en medio libre de suero; Grupo de BMSCs (E), 2 x 105 BMSCs en medio libre de suero; y (F) BMSCs-P, 2 x 105 P BMSCs en medio libre de suero. Todos los datos se muestran como la media ± SEM (n = 4). #: comparación entre Grupo C y todos los demás grupos, excepto el Grupo F, # p < 0.0001. *: comparación entre Grupo F y todos los demás grupos, * p < 0.05, *** p < 0.0001. Haga clic aquí para ver una versión más grande de esta figura.

Figure 4
Figura 4: Proyección de imagen de alta resolución microscopía multifotón (SHG/TPEF) y cuantificación de la angiogénesis en la región de defecto de hueso de la Calvaria de ratón.Trong > (A) A ilustración esquemática de un ratón bajo análisis de MPM. El círculo naranja representa el sitio del defecto de los túbulos rojo representan los vasos sanguíneos y el verde representa el colágeno. (B) Unoperated y animales operados fueron analizados con MPM en implantación después de 8 semanas. SHG, TPEF, SHG/TPEF se fusionaron, y se muestran imágenes en 3D. La línea punteada representa el límite por el defecto óseo en el grupo de control basado en señales SHG. (C) vaso sanguíneo área cuantificación dentro de la zona de defecto de control PH y PHp desde la semana 2 a la implantación de la semana 8. Todos los datos se muestran como la media ± SEM (n = 5). : Análisis estadístico entre los grupos PH y PHp, p < 0.0001. Haga clic aquí para ver una versión más grande de esta figura.

Figure 5
Figura 5: Análisis de RT-qPCR de pdgf-b (A) y Genes relacionados con la angiogénesis vWF (B) y VEGRF2 (C) expresión en tres grupos. Se analizaron muestras de 4 animales por cada tiempo. #: comparación entre los grupos PHp y PH, # p < p 0,05, de # < 0,01 y p #< 0.0001. *: comparación entre los grupos control y PHp * p < 0.05, ** p < 0.01, y *** p < 0.0001. Haga clic aquí para ver una versión más grande de esta figura.

Figure 6
Figura 6: Evaluación de la formación ósea In Vivo con MicroCT exploración. Grupo control sin andamios implantados. Grupo PH implantado PLGA/nHAp andamio solamente. Grupo de PHp dentro de andamio PLGA/nHAp implantado por las partículas de LV- pdgfb . Haga clic aquí para ver una versión más grande de esta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

El hueso es un tejido altamente vascularizado con una capacidad única para curar continuamente y remodelación a lo largo de la vida de un individuo1. El nivel de vascularización es importante para la reparación de osteogénesis y defecto. Baja vascularización limita la aplicación clínica amplio de ingeniería de tejido óseo. Construyendo un hueso altamente vascularizado tejido diseñado según la teoría de la biomimética, se ha convertido en una herramienta para la reparación de defectos óseos de gran segmento. Diversos tipos de andamios se han aplicado con éxito para reparar defectos oseos comparativamente pequeños. Sin embargo, para de defectos óseos críticos, la aplicación de andamios para reparar todavía enfrenta obstáculos, principalmente debido a la insuficiente sangre fuente para reparación del defecto. Por lo tanto, mejorar el suministro de sangre durante el proceso de reparación de defectos de hueso grande es uno de los principales problemas de la ingeniería de tejidos.

Personas utilizan andamios bioactivos recubierto de material para ayudar a establecer los campos morfogenéticos es necesarios estimular, reclutar, y promueven la quimiotaxis, diferenciación y proliferación de las células necesarias para la formación de la occidentalización y el hueso 37. occidentalización en andamios de ingeniería de tejidos es esencial para las células recibir oxígeno y nutrientes, para la eliminación de los residuos y en última instancia para el cumplimiento de la función de andamios. Los objetivos de este estudio fueron investigar angiogénesis con en vivo microscopía multifotón en un andamio PLGA/nHAp genéticamente modificado, impresa en 3D para la reparación del defecto hueso calvarial críticos y evaluar los efectos del uso de la regeneración de hueso microCT.

A pesar de dramáticos logros en ingeniería del tejido fino del hueso, la visualización en vivo y la cuantificación de neovascularización en andamios durante hueso regeneración sigue siendo un desafío. Sistemas de imagen más microscópicos son incapaces de proporcionar información volumétrica en la angiogénesis. Métodos tradicionales de la proyección de imagen, como microCT, MRI y los análisis histológicos, destructivo, complicado y laborioso y tienen baja resolución espacial y adquisición de la imagen largo tiempo38. Sin embargo, la proyección de imagen de MPM es una modalidad de proyección de imagen de bio novela que puede capturar los vasos sanguíneos las señales en vivo de una manera mínimamente invasiva y alta resolución. Es capaz de detectar los buques nuevos más delgados que 10 μm (Figura 4B). Además de imágenes de los vasos sanguíneos, también observamos una masa de nueva deposición de colágeno (el color verde en la Figura 4B) y los gráficos GIF en el material suplementario, según lo indicado por señales de SHG, que indican la formación de tejido de hueso desde otro ángulo. Teóricamente, se podían obtener imágenes de vasos sanguíneos sin el uso de agentes de contraste. Sin embargo, en el presente estudio, se usa a un agente de contraste para obtener imágenes de mejor y quita la piel para asegurar la profundidad apropiada de análisis. Esto sería innecesario cuando sistemas de imagen más potentes están disponibles en el futuro para la proyección de imagen realmente no invasivo.

HAp es un material biomédico para la regeneración de tejido óseo que es ampliamente utilizado debido a su buena osteoconducción y rasgos osteoinduction. HAp tiene buena capacidad de enlace a vectores de ADN y de retención y estabilización de vectores, incluyendo vectores virales39. Comparado con microsized HAp, combinar partículas de HAp poseen altas superficies específicas y por lo tanto muestran mejor comportamiento celular y propiedades mecánicas40. Por estas razones, las partículas nHAp son uno de los componentes de los andamios. Las imágenes de SEM superficiales y transversales del EGLP/nHAp andamio se muestra en la figura 1 indica que los andamios fabricados exhiben una estructura de poro bien interconectado y tamaños de poro uniformemente distribuidas. La inmovilización del virus en portadores de biomaterial puede influir en la actividad de virus. Por lo tanto, hemos probado la bioactividad de partículas LV liberados de los andamios por investigar su actividad de transfección. Los perfiles de liberación de partículas del LV de los andamios y sus bioactividades fueron evaluados en vitro, demostrando la entrega controlada de partículas bioactivas de LV por cinco días (figura 2). Además, nuestro estudio en vitro se centró en el potencial de estimular la migración de las MSCs primarias de PDGF-BB. Estos resultados sugieren que las partículas de LV expresaron bioactivo PDGF-BB y migración de CMMo efectivamente estimulada.

Para confirmar la capacidad de angiogénesis y hueso regeneración en vivo, andamios de PHp fueron implantados en defectos óseos críticos calvarial murino. Formación de vasos fue confirmada con marcadores angiogénicos, análisis RT-qPCR y densidades de los vasos sanguíneos observadas con proyección de imagen de SHG/TPEF. De los dos conjuntos de experimentos demostraron que angiogénesis y formación de vasos sanguíneos mejoraron significativamente con el tratamiento de andamios modificados genéticamente. Estos resultados indican que el PDGF-BB no sólo estimula directamente la angiogénesis, pero que también induce otros genes relacionados con la angiogénesis. Mientras tanto, las mediciones microCT demuestran eso pdgf-b-que contienen andamios significativamente promueve la formación ósea en comparación con los andamios sin modificar, que se correlaciona bien con la occidentalización en el andamio. Estos resultados indican que andamios bioactivos, modificados genéticamente mejoran significativamente la regeneración del tejido y la angiogénesis.

Los resultados presentados aquí demuestran que la modificación genética de lentivirus-mediada de andamios facilita la reparación de grandes defectos óseos en un modelo murino hueso calvarial de crítica defecto probablemente a través de la angiogénesis mejora. Además, en vivo MPM la proyección de imagen proporciona una herramienta única para entender la angiogénesis y osteogénesis en hueso andamios y permite la posterior aclaración de si un cierto andamiaje es beneficiosa neovascularización. Proyección de imagen de microscopía multifotón intravital proporciona una modalidad para la comprensión de la fisiología y la patofisiología de la angiogénesis en los tejidos y andamios. Sin embargo, hay varias limitaciones cuando se utiliza esta técnica. En primer lugar, la preparación quirúrgica requiere conocimientos particulares. Inflamación causada por la operación disminuirá significativamente el MPM calidad de imagen. En segundo lugar, debido al limitación de la velocidad de la proyección de imagen de MPM, se necesita un soporte para ratón diseñado para reducir los artefactos causados por latidos del corazón y la respiración. En tercer lugar, para la proyección de imagen a largo plazo, los animales deben ser por vía intraperitoneal o intravenosa inyectados con solución salina para evitar la deshidratación.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores declaran que no tienen intereses financieros que compiten.

Acknowledgements

Este estudio fue apoyado por el programa de pavo real de Shenzhen, China (Nº 110811003586331), el programa de investigación básica de Shenzhen (no. JCYJ20150401150223631, no. JCYJ20150401145529020 y no. JCYJ20160331190714896), el Guangdong pública de investigación y desarrollo de capacidades programa especial (Nº 2015A020212030), la Fundación Nacional de Ciencias naturales de China (Nº 81501893), el programa nacional mayor Basic Research de China (2013CB945503) y la Programa de innovación de SIAT para excelentes investigadores jóvenes (Y5G010).

Materials

Name Company Catalog Number Comments
Poly(D,L-lactide-co-glycolide) (PLGA) Sigma P1941 L/G ratio 75:25, MW 66000-107000
Hydroxyapatite nanoparticles Sigma 702153 Average diameter < 200 nm
Chloroquine diphosphate salt Sigma C6628
FITC-conjugated 250-kD dextran Sigma FD250S
1,4-dioxane lingfeng,Shanghai 0.45 micron
Stericup filters Merck Millipore Corporation SLHV033RB
PDGF-BB Cdna Sino Biological, Inc MZ50801-G
Anti-PDGF-BB mouse polyclonal antibody  BioVision, Inc 5489-30T
PDGF-BB recombinant protein 4489-50
Calcium-phosphate transfection solution Promega Corporation E1200
L-DMEM Hyclone SH30021.01
DPBS Hyclone SH30028.01
Penicillin-Streptomycin, Liquid Thermo Fisher Scientific 15140122
FBS Thermo Fisher Scientific 10099-141
Transwell  Corning 3422
Male BALB/c mice Guangdong Medical Laboratory Animal Center 
sodium pentobarbital  Merck 1063180500
multiphoton microscopy A homemade in Shenzhen Institutes of Advanced Technology to detect two-photon excited fluorescence (TPEF) and second harmonic generation signal (SHG).
isoflurane Keyuan, Shandong 401750169
TRIzol reagent Invitrogen 15596018
PrimeScript RT Master Mix (Perfect Real Time) Takara RR420B
SYBR Premix Ex Taq (Tli RNaseH Plus) Takara RR036B
Hematoxylin and eosin Beyotime C0105
Paraffin Leica  RM2235
Ultracentrifuge OPtima L-100XP Beckman Coulter L-100XP
Low-temperature printer  Tsinghua university A homemade in Tsinghua university
LightCycler 480 instrument  Roche 5815916001
microCT Bruker 1176
commercial software Bruker
Buprenorphine

DOWNLOAD MATERIALS LIST

References

  1. Hu, X., et al. GPNMB enhances bone regeneration by promoting angiogenesis and osteogenesis: potential role for tissue engineering bone. J Cell Biochem. 114, (12), 2729-2737 (2013).
  2. Schroeder, J. E., Mosheiff, R. Tissue engineering approaches for bone repair: concepts and evidence. Injury. 42, (6), 609-613 (2011).
  3. Chiarello, E., et al. allograft and bone substitutes in reconstructive orthopedic surgery. Aging Clin Exp Res. 25, S101-S103 (2013).
  4. Elangovan, S., et al. The enhancement of bone regeneration by gene activated matrix encoding for platelet derived growth factor. Biomaterials. 35, (2), 737-747 (2014).
  5. Bouyer, M., et al. Surface delivery of tunable doses of BMP-2 from an adaptable polymeric scaffold induces volumetric bone regeneration. Biomaterials. 104, 168-181 (2016).
  6. Rezwan, K., et al. Biodegradable and bioactive porous polymer/inorganic composite scaffolds for bone tissue engineering. Biomaterials. 27, (18), 3413-3431 (2006).
  7. Burg, K. J., Porter, S., Kellam, J. F. Biomaterial developments for bone tissue engineering. Biomaterials. 21, (23), 2347-2359 (2000).
  8. Xiao, Y., et al. Modifications of collagen-based biomaterials with immobilized growth factors or peptides. Methods. 84, 44-52 (2015).
  9. Chen, G., Lv, Y. Immobilization and Application of Electrospun Nanofiber Scaffold-based Growth Factor in Bone Tissue Engineering. Curr Pharm Des. 21, (15), 1967-1978 (2015).
  10. Kofron, M. D., Li, X., Laurencin, C. T. Protein- and gene-based tissue engineering in bone repair. Curr Opin Biotechnol. 15, (5), 399-405 (2004).
  11. Chen, F. M., et al. New insights into and novel applications of release technology for periodontal reconstructive therapies. J Control Release. 149, (2), 92-110 (2011).
  12. Winn, S. R., et al. Gene therapy approaches for modulating bone regeneration. Adv Drug Deliv Rev. 42, (1-2), 121-138 (2000).
  13. Chang, P. C., et al. Adenovirus Encoding Human Platelet-Derived Growth Factor-B Delivered to Alveolar Bone Defects Exhibits Safety and Biodistribution Profiles Favorable for Clinical Use. Hum Gene Ther. 20, (5), 486-496 (2009).
  14. Phipps, M. C., Xu, Y. Y., Bellis, S. L. Delivery of Platelet-Derived Growth Factor as a Chemotactic Factor for Mesenchymal Stem Cells by Bone-Mimetic Electrospun Scaffolds. Plos One. 7, (7), (2012).
  15. Gehmert, S., et al. Angiogenesis: The role of PDGF-BB on Adiopse-tissue derived Stem Cells (ASCs). Clin Hemorheol and Microcirc. 48, (1-3), 5-13 (2011).
  16. Chang, P. C., et al. PDGF-B gene therapy accelerates bone engineering and oral implant osseointegration. Gene Ther. 17, (1), 95-104 (2010).
  17. Javed, F., et al. Significance of the platelet-derived growth factor in periodontal tissue regeneration. Arch Oral Biol. 56, (12), 1476-1484 (2011).
  18. Murali, R., et al. Biomimetic hybrid porous scaffolds immobilized with platelet derived growth factor-BB promote cellularization and vascularization in tissue engineering. J Biomed Mater Res A. 104, (2), 388-396 (2016).
  19. Andrae, J., Gallini, R., Betsholtz, C. Role of platelet-derived growth factors in physiology and medicine. Genes Dev. 22, (10), 1276-1312 (2008).
  20. Wosnitza, M., et al. Plasticity of human adipose stem cells to perform adipogenic and endothelial differentiation. Differentiation. 75, (1), 12-23 (2007).
  21. Hankenson, K. D., et al. Angiogenesis in bone regeneration. Injury. 42, (6), 556-561 (2011).
  22. Schmidt, C., et al. Rapid three-dimensional quantification of VEGF-induced scaffold neovascularisation by microcomputed tomography. Biomaterials. 30, (30), 5959-5968 (2009).
  23. Perng, C. K., et al. In Vivo Angiogenesis Effect of Porous Collagen Scaffold with Hyaluronic Acid Oligosaccharides. J Surg Res. 168, (1), 9-15 (2011).
  24. Sun, Y., et al. Imaging tissue engineering scaffolds using multiphoton microscopy. Microsc Res Tech. 71, (2), 140-145 (2008).
  25. Fan, X., et al. Noninvasive monitoring of placenta-specific transgene expression by bioluminescence imaging. PLoS One. 6, (1), e16348 (2011).
  26. Yeo, M. G., Kim, G. H. Preparation and Characterization of 3D Composite Scaffolds Based on Rapid-Prototyped PCL/β-TCP Struts and Electrospun PCL Coated with Collagen and HA for Bone Regeneration. Chem Mater. 24, (5), 903-913 (2012).
  27. Mao, Y., et al. Lentiviral Vectors Mediate Long-Term and High Efficiency Transgene Expression in HEK 293T cells. Int J Med Sci. 12, (5), 407-415 (2015).
  28. Li, J., et al. Investigation of angiogenesis in bioactive 3-dimensional poly (D,L-lactide-co-glycolide)/nano-hydroxyapatite scaffolds by in vivo multiphoton microscopy in murine calvarial critical bone defect. Acta Biomater. 42, 389-399 (2016).
  29. Abbasi, H., et al. Lentiviral vector-mediated transduction of goat undifferentiated spermatogonia. Anim Reprod Sci. 163, 10-17 (2015).
  30. Pigossi, S. C., et al. Bacterial cellulose-hydroxyapatite composites with osteogenic growth peptide (OGP) or pentapeptide OGP on bone regeneration in critical-size calvarial defect model. J Biomed Mater Res A. (2015).
  31. Bos, G. D., et al. The effect of histocompatibility matching on canine frozen bone allografts. J Bone Joint Surg Am. 65, (1), 89-96 (1983).
  32. Hollinger, J. O., Kleinschmidt, J. C. The critical size defect as an experimental model to test bone repair materials. J Craniofac Surg. 1, (1), 60-68 (1990).
  33. Hollanders, K., et al. Bevacizumab Revisited: Its Use in Different Mouse Models of Ocular Pathologies. Curr Eye Res. 40, (6), 611-621 (2015).
  34. Gao, L. QSIM: quantitative structured illumination microscopy image processing in ImageJ. Biomed Eng Online. 14, 4 (2015).
  35. Kobat, D., et al. Deep tissue multiphoton microscopy using longer wavelength excitation. Opt Express. 17, (16), 13354-13364 (2009).
  36. Lohmann, P., et al. Bone regeneration induced by a 3D architectured hydrogel in a rat critical-size calvarial defect. Biomaterials. 113, 158-169 (2016).
  37. Lv, J., et al. Enhanced angiogenesis and osteogenesis in critical bone defects by the controlled release of BMP-2 and VEGF: implantation of electron beam melting-fabricated porous Ti6Al4V scaffolds incorporating growth factor-doped fibrin glue. Biomed Mater. 10, (3), (2015).
  38. Guldberg, R. E., et al. 3D imaging of tissue integration with porous biomaterials. Biomaterials. 29, (28), 3757-3761 (2008).
  39. Boehler, R. M., et al. A PLG/HAp composite scaffold for lentivirus delivery. Biomaterials. 34, (21), 5431-5438 (2013).
  40. Heo, S. J., et al. Fabrication and characterization of novel nano- and micro-HA/PCL composite scaffolds using a modified rapid prototyping process. J Biomed Mater Res A. 89, (1), 108-116 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics