Visualizzando l'angiogenesi da microscopia multifotonica In Vivo in geneticamente 3D-PLGA/nHAp impalcatura per Calvarial riparazione di difetti ossei critici

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Qui, presentiamo un protocollo per visualizzare formazione del vaso sanguigno in vivo e in tempo reale in 3D impalcature da microscopia multifotonica. Angiogenesi in impalcature geneticamente è stato studiato in un modello di difetto critico calvarial murino dell'osso. Più nuovi vasi sanguigni sono stati rilevati nel gruppo di trattamento rispetto ai controlli.

Cite this Article

Copy Citation | Download Citations

Li, J., Jahr, H., Zheng, W., Ren, P. G. Visualizing Angiogenesis by Multiphoton Microscopy In Vivo in Genetically Modified 3D-PLGA/nHAp Scaffold for Calvarial Critical Bone Defect Repair. J. Vis. Exp. (127), e55381, doi:10.3791/55381 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

La ricostruzione di difetti ossei criticamente dimensioni rimane un grave problema clinico a causa della scarsa angiogenesi all'interno di impalcature tessutale durante la riparazione, che dà luogo a una mancanza di sufficiente apporto di sangue e causa la necrosi dei tessuti nuovi. Rapida vascolarizzazione è un prerequisito indispensabile per la sopravvivenza del tessuto nuovo e integrazione con esistente tessuto ospite. La generazione del de novo del sistema vascolare in impalcature è uno dei passi più importanti nel rendere più efficiente, permettendo la riparazione del tessuto di crescere in un'impalcatura rigenerazione ossea. Per affrontare questo problema, la modificazione genetica di un ponteggio di biomateriale viene utilizzata per accelerare l'angiogenesi e l'osteogenesi. Tuttavia, visualizzazione e monitoraggio in vivo la formazione del vaso sanguigno in tempo reale e in impalcature tridimensionali (3D) in o nuovo tessuto osseo è ancora un ostacolo per l'ingegneria tissutale ossea. La microscopia multifotonica (MPM) è una modalità novella di bio-imaging che può acquisire dati volumetrici da strutture biologiche in modo minimamente invasivo e ad alta risoluzione. L'obiettivo di questo studio era di visualizzare l'angiogenesi con microscopia multifotonica in vivo in un'impalcatura di 3D-PLGA/nHAp geneticamente modificata per la riparazione del difetto di osso calvarial critico. PLGA/nHAp ponteggi sono stati funzionalizzati per la consegna continua di un gene di pdgf-b di fattore di crescita che trasportano vettori lentivirali (LV -pdgfb) al fine di facilitare l'angiogenesi e migliorare la rigenerazione ossea. In un osso di critico calvarial impalcatura-impiantati difetto modello murino, le aree di vaso sanguigno (BVAs) in PHp impalcature erano significativamente superiori a PH impalcature. Inoltre, l'espressione di geni in relazione con l'angiogenesi, sindrome di Raynaud e VEGFR2e pdgf-b aumentato corrispondentemente. MicroCT analisi ha indicato che la nuova formazione dell'osso nel gruppo PHp notevolmente migliorato rispetto agli altri gruppi. A nostra conoscenza, questa è la prima volta microscopia multifotonica era usata in ingegneria dei tessuti dell'osso per studiare l'angiogenesi in un 3D impalcatura bio-degradabile, in vivo e in tempo reale.

Introduction

L'osso è un tessuto altamente vascularized che continua a rimodellare durante la vita di un singolo1. La rigenerazione ossea rapida ed efficace di difetti ossei grande derivanti dal trauma, non sindacale, resezioni del tumore o malformazioni craniofacciali è un processo fisiologico complesso. Tradizionali approcci terapeutici utilizzati per la riparazione di difetti dell'osso includono l'impianto autologo e allogenico, ma il loro uso comporta diversi problemi e limitazioni, quali disponibilità limitata, morbilità del sito donatore significativo, un alto rischio di infezione, e ospitare il rigetto immunitario2,3. Tuttavia, gli innesti di osso artificiale offrono un'alternativa efficiente per ovviare a queste limitazioni. Può essere realizzate in materiali biodegradabili, sono facili a essere fabbricare con un diametro dei pori adatto e può essere geneticamente4,5.

Attualmente, vari ponteggi ingegneria del tessuto sono stati impiegati nello sviluppo di ingegneria tissutale ossea6,7. Per indurre la rigenerazione e riparazione ossea in modo più efficace, biomateriali ingegnerizzati combinati con fattori di crescita sono emerse e raggiunto buoni risultati8,9. Purtroppo, il tempo di dimezzamento breve, facile perdere attività e supraphysiological dosaggio di fattori di crescita per l'efficacia terapeutica limitare loro applicazione clinica10. Per superare questi problemi, la consegna dei geni del fattore di crescita invece di fattori di crescita è stata dimostrata come un approccio efficace per sostenere la bioattività per il trattamento dei difetti ossei e malattie11,12. Vettori virali sono promettente consegna strumenti per la rigenerazione dei tessuti a causa della loro alta efficienza13di esprimere.

Tra i fattori di crescita, fattore di crescita derivato dalle piastrine (PDGF-BB) è stato selezionato in questo studio perché è non solo un mitogeno e fattore chemiotattico per le cellule mesenchimali e osteogeniche, ma anche uno stimolante per l'angiogenesi14,15 . Precedenti studi preclinici e clinici hanno mostrato che PDGF-BB potrebbe promuovere in modo sicuro ed efficace riparazione ossea in difetti osseous peridentali16,17. Studi recenti hanno rivelato che PDGF-BB stimola l'angiogenesi di motivante delle cellule endoteliali migrazione e proliferazione in vivo18,19. Inoltre, PDGF-BB può anche rendere cellule staminali mesenchimali (MSCs) in grado di differenziarsi in cellule endoteliali20e questo ulteriore mette in evidenza il ruolo potenziale delle MSC in neovascolarizzazione. Di conseguenza, inducendo la formazione del de novo del sistema vascolare in impalcature con PDGF-BB è un passo importante per la riparazione del tessuto coltivato in impalcature in ingegneria del tessuto osseo.

La guarigione del difetto osseo è un processo morfogenetico tessuto dinamico che richiede osteogenesi coordinata e l'angiogenesi del riparazione posizioni21. La neoangiogenesi in impalcature tessutale impiantate è un prerequisito essenziale per la fornitura di cellule con sostanze nutritive e ossigeno per la crescita e la sopravvivenza e per la rimozione delle scorie metaboliche. Comunemente utilizzati metodi di imaging, tra cui x-ray micro-computato tomografia (microCT), la formazione immagine a risonanza magnetica (MRI), microscopia elettronica a scansione (SEM), tomografia a coerenza ottica (OCT) e laser confocale microscopia, sono applicati invece esame istologico per ottenere l'angiogenesi informazioni22,23. Tuttavia, questi metodi devono affrontare vari ostacoli nella visualizzazione e nella misurazione neovasculature in 3D impalcature in ingegneria del tessuto osseo. La microscopia multifotonica (MPM) è una tecnica di bio-imaging comparativamente Novella che ha il vantaggio di contemporaneamente visualizzare cellule, matrice extracellulare e che circondano reti vascolari in vivo. Possiede un'intrinseca capacità di imaging tridimensionale per la penetrazione dei tessuti profondi e causa basso photodamage. Quindi, nell'ultimo decennio, MPM ha guadagnato molta attenzione in studi biomedici24, compresi in neuroscienze, immunologia e dinamiche della cellula formativa. Tuttavia, è a malapena usato nella ricerca ortopedica.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

la cura degli animali era in conformità con la guida per la cura e l'uso di laboratorio animali della provincia di Guangdong. Tutte le procedure sono state eseguite sotto la supervisione e l'approvazione del comitato etico per Animal Research, Shenzhen Institutes of Advanced Technology, Accademia cinese delle scienze.

1. produzione di vettori lentivirali (LV)

  1. Clone cDNA in un vettore di espressione lentivirali (pLenti6/5-eGFP o LV-eGFP) un multiplo-clonazione personalizzata pdgf-b sito a valle del promotore del citomegalovirus usando Spe io e Sal I siti di restrizione per costruire il plasmide pLenti6/5-PDGFB-eGFP (LV - pdgfb) 25.
  2. Produrre particelle lentivirali (LV - pdgfb) dalle cellule HEK - 293 FT di co-trasfezione con plasmidi di imballaggio virus (pLP1, pLP2 e pVSV-G) utilizzando il metodo standard del fosfato di calcio con la clorochina (concentrazione finale: 25 µM) 25.
  3. dopo 48 h di transfezione, raccogliere e filtrare 500 mL contenenti virus surnatante con un filtro (0,45 µm). Successivamente, concentrare le particelle virali mediante ultracentrifugazione a 89.000 x g per 2 h. Risospendere in 200 µ l di tampone fosfato salino (PBS), aliquota e conservare a -80 ° C.
  4. Per determinare il titolo di lentivirus, incubare le cellule HEK293T con vettori lentivirali in serie diluito per 24 h e calcolare il titolo lentivirale, come descritto in precedenza 25.

2. Realizzazione di ponteggi PLGA/nHAp 3D-stampato e l'immobilizzazione di LV

materiale
  1. sciogliere 20 g di PLGA (poli D, L-lattide-co-glicolide) in 20 mL di 1,4-diossano per formare una soluzione omogenea. Aggiungere 2 g di saccaridica polvere HAp (nano-hydroxyapatide) (PNHA) alla soluzione; il PLGA: nHAp rapporto dovrebbe essere 10:1 (w/w).
  2. Agitare energicamente la soluzione mista (velocità di agitazione: 1.500 giri/min) a temperatura ambiente per 16 h con un agitatore magnetico per formare una pasta uniforme. Fabbricare in poroso PLGA/nHAp impalcature, utilizzando una stampante 3D di bassa temperatura con un ugello computerizzato che deposita il basso strato dopo strato, incolla verso l'alto, secondo un modello predefinito 26; le dimensioni dei pori di impalcature vanno da 200 a 400 µm.
  3. Vuoto liofilizzare i ponteggi per 48 h rimuovere il solvente completamente come possibile. Immergere i ponteggi in soluzione di etanolo di 75% per 1 h per la sterilizzazione e lyophilize per ottenere scaffold neutro, asettico.
    Nota: I parametri principali per liofilizzazione sottovuoto includono la temperatura di condensazione (° C) e il grado di vuoto (Pa). Sotto un grado di vuoto di 45 Pa, l'impalcature PLGA/nHAp erano vuoto liofilizzato a-78 ° C per 48 h rimuovere completamente il solvente.
  4. Aggiungere 10 µ l di particelle di LV (4,5 x 10 5) per ogni PLGA/nHAp impalcatura (4 x 4 x 2 mm) e incubare le impalcature per 2 h a 37 ° C in un incubatore per consentire adsorbimento.
  5. Dopo immobilizzazione, sciacquare i ponteggi due volte con PBS per rimuovere le particelle di LV non associate. Snap-congelare le impalcature rivestite con particelle di LV in azoto liquido, lyophilize nuovamente e conservare a-80 ° C per un uso futuro.

3. In Vitro Cinetica del rilascio di particelle di LV da impalcature e analisi di attività di trasduzione LV

  1. Incubare scaffold 3D (4 x 4 x 2 mm) che trasportano LV-della proteina fluorescente verde (LV-eGFP, 4.5 x 10 particelle di 5 LV) in 1 mL di DMEM completo in 2,0 mL criogenico fiale a 37 ° C con agitazione per 5 giorni.
  2. Prendere un campione di 1 mL ogni 12 h da 12 h di post-incubazione 120 h e sostituire il mezzo. In ogni momento, aggiungere 1 mL di terreno nuovo invece di 1 mL di medium di incubazione.
  3. Utilizzare i supporti raccolti per trasdurre HEK293T cellule mediante co-incubazione per 48 h. misura il numero di particelle di LV bioattivi determinando il numero di GFP-positive HEK293T cellule tramite flusso cytometry 27.
    1. Prima di trasduzione delle cellule di HEK293T, rimuovere il terreno di coltura e sciacquare le cellule HEK293T due volte con PBS. Aggiungere i supporti raccolti contenenti lentivirus rilasciato dalle impalcature per il pozzo (1 mL/pozzetto) e della coltura con le cellule HEK293T per 48 h a 37 ° C in un incubatore.

4. In Vitro Valutazione della migrazione di MSC (BMSC) derivate da midollo osseo

  1. prima del saggio di migrazione, preparare BMSCs che esprimono la proteina fluorescente di pomodoro (BMSC-T) e PDGF-BB proteina (BMSC-P) 28.
  2. Eseguire l'analisi di migrazione BMSC con una camera di Boyden utilizzando una piastra a 24 pozzetti e filtri in policarbonato con un diametro dei pori di 8 µm.
    1. Place 0,5 mL di BMSCs (5 x 10 4) transfected con LV che esprimono la proteina fluorescente di pomodoro (BMSC-T) nelle camere superiori. Posizionare 0,5 mL di BMSCs (2 x 10 5) transfected con LV che esprimono la proteina di PDGF-BB (BMSC-P) nelle camere inferiori.
  3. Includono sei gruppi in questo esperimento e aggiungere 500 µ l per il vano inferiore di ciascun pozzetto.
    R. blank controllo, privo di siero medio solo
    controllo di B. FBS, medium supplementato con 10% FBS
    controllo C. PDGF-BB, 4 ng/mL PDGF-BB in medium senza siero
    D. PDGF-BB grippare gruppo, PDGF-BB (4 ng/mL) e l'anticorpo policlonale anti-PDGF-BB (4 ng/mL) in medium senza siero
    gruppo BMSC E., 2 x 10 5 BMSCs in medium senza siero
    gruppo F. BMSCs-P, 2 x 10 5 BMSCs-P in mezzo libero del siero.
  4. Incubare per 48 h a 5% CO 2 e 37 ° C in un incubatore. In seguito, rimuovere le cellule migrate sul lato inferiore della camera e raccoglierli per la quantificazione del numero di BMSC-T tramite flusso cytometry.
    1. Rimuovere cellule migrate sulla parte inferiore della camera laterale con un raschietto in cella e risospendere le cellule migrate con 2 mL di PBS. Quantificare il numero di migrazione BMSCs-T di flusso cytometry 29.

5. Istituzione di un modello di critica Calvarial murino di difetto osseo e trapianto di Scaffold

Nota: topi BALB/c maschio (7 settimane) sono stati acquistati da Guangdong Medical Laboratory Animal Center (Guangdong, Cina).

  1. Registra un totale di 42 topi maschi per il difetto dell'osso calvarial esperimento. Dividere in modo casuale i topi in tre gruppi, con quattordici in ogni gruppo che ricevono i seguenti trattamenti: gruppo A, senza protesi; Del gruppo B, PH ponteggi impiantato (PLGA/nHAp); e del gruppo C, PHp ponteggi impiantati (PLGA/nHAp/LV-pdgfb).
  2. Anestetizzare gli animali con la somministrazione intraperitoneale di sodio pentobarbital (50 mg/kg). Pelliccia con pasta depilatoria di rimuovere e pulire la pelle di testa con soluzione di alcool di 75% prima di effettuare la prima incisione. Fissare la testa di ogni mouse con uno strumento stereotactic per tenerlo ancora durante la chirurgia.
  3. Fare un'incisione iniziale con un bisturi e poi ingrandirla witore forbici per creare un'incisione cutanea lineare 1-cm. Raschiare il periostio dall'osso del cranio per rivelare la superficie dell'osso del cranio usando un tampone di cotone sterile.
  4. Utilizzare una bava di trapanazione per creare un difetto di dimensione critica di 4 mm di diametro sul lato sinistro del calvaria 30. L'impalcatura del trapianto nel sito del difetto osseo.
    Nota: Difetti di dimensione critica (CSDs) originalmente sono stati definiti come " la più piccola dimensione intraossea della ferita in un particolare dell'osso e la specie di animale che non guariranno spontaneamente durante la vita dell'animale. " In questo esperimento, il difetto di 4 mm di diametro è un difetto dell'osso di dimensione critica, secondo la precedenza studiare 31 , 32.
  5. Utilizzare forcipe oftalmico per riportare il periostio delicatamente per coprire il sito chirurgico. Suturare la pelle incisa con tre punti per cm.
  6. Eseguire cure postoperatorie. Amministrare la buprenorfina analgesica (0,1 mg/kg) per alleviare il dolore. Mantenere la temperatura corporea con un rilievo di riscaldamento fino a quando l'animale si risveglia. Successivamente, nutrire gli animali con cibo e acqua e registrare le loro attività ogni giorno fino alla fine del test. Nota: L'Analgesia può essere somministrato prima della procedura a seconda della vostra orientamenti di comitato locale cura degli animali.

6. In Vivo Imaging dell'angiogenesi nel difetto osseo con MPM

Nota: coniugato FITC 250 kD destrano (10 mg/mL) in soluzione salina per via endovenosa è stato iniettato in topi per ottenere alta-SNR (signal-to-noise ratio) immagini di nuovi vasi sanguigni secondo un precedente studio 33. Siete pregati di notare che si tratta di una procedura di sopravvivenza.

  1. assemblare il sistema di microscopia multifotonica (MPM) per due-fotone eccitato fluorescenza (TPEF) e di seconda generazione armonica segnale (SHG) imaging.
  2. Anestetizzare gli animali con un'iniezione intraperitoneale di sodio pentobarbital (50 mg/kg) e immobilizzare gli animali su una piastra riscaldante per mantenere la loro temperatura corporea a 37 ° C in tutto gli esperimenti. Utilizzare gas isoflurano 3,0% a 100% di ossigeno per mantenere soddisfacente anestesia e analgesia durante il processo di imaging. Intraperitonealmente iniettare soluzione fisiologica (200 µ l/animale) per prevenire la disidratazione prima imaging.
  3. Tune il laser a femtosecondi Ti-Sapphire a 860 nm. Creare un'area di 512 x 512 µm campionamento da una coppia di specchi galvo di scansione e utilizzare NA1.0 obiettivo di immersione in acqua a fascio di eccitazione focusthe nel campione e di raccogliere il segnale TPEF/SHG retrodiffuso.
    Nota: L'imaging è stata eseguita su un casa-costruire multifotonica microscopico sistema di imaging (MPM). Durante la formazione immagine, un laser a femtosecondi Ti-Sapphire era sintonizzato a 860 nm come lunghezza d'onda di eccitazione ottimale. Il raggio laser è stato raster analizzati attraverso un piano di esempio utilizzando una coppia di specchi galvanometro. Dopo il passaggio attraverso uno specchio dicroico di 685 nm, il fascio è stata focalizzata sull'esemplare da un obiettivo di NA1.0 X 20. I segnali TPEF e SHG indotti sono stati raccolti dall'obiettivo stesso. I segnali sono stati spaccati del laser di eccitazione dallo specchio dicroico di cui sopra e depurata da un filtro passa-breve di 680 nm. I segnali TPEF e SHG sono stati raccolti da un fascio di fibre ottiche e condotto ad uno spettrografo. Il rilevatore sullo spettrografo era un array lineare di tubi di fotomoltiplicatore (PMT). La combinazione di spettrografo e allineamento lineare PMTs offerto la possibilità di registrare il segnale in 16 bande spettrali consecutivi, da 400 nm a 600 nm, a intervalli di 12,5 nm. Pertanto, i segnali TPEF e SHG erano rilevati allo stesso tempo e separati in domini spettrale. Inoltre, per l'imaging 3D, un motore assiale è stato utilizzato per controllare la profondità di imaging. L'area di ogni immagine è stato impostato a 512 x 512 µm, e l'intervallo di profondità è stato impostato a 2 µm (gruppo di controllo, 5 µm). In particolare, 5 siti su ogni difetto erano imaged per raccogliere dati statisticamente significativi, e i siti di formazione immagini selezionati sono stati distribuiti uniformemente e in modo casuale lungo il difetto.
  4. Scan 5 siti su ogni difetto per raccogliere dati statisticamente significativi per misurare la formazione del vaso.
    1. Uso siti di scansione in modo uniforme e casualmente distribuiti lungo il difetto. Per il gruppo di controllo, hanno il campo di vista (FOV) copertina sia la zona dell'osso originale e il bordo del difetto, ma per i gruppi di PH e PHp, hanno il FOV sul patibolo impiantato.
    2. Fare un'incisione cutanea lineare 1 cm usando un bisturi e suturare la pelle aperta alla fissazione per rivelare il sito di trapianto. Utilizzare una siringa per mettere una goccia di acqua tra l'obiettivo ad immersione e trapianti per formare un bicchiere d'acqua.
  5. Acquisisci immagine impila ogni 12 s oltre un ora 2 periodo di imaging. Visualizzare e analizzare dati volumetrici utilizzando un programma personalizzato di MATLAB e quantificare le aree di vaso sanguigno con software ImageJ 34 , 35.

7. Analisi dell'espressione genica di geni correlati all'angiogenesi di RT-qPCR e pdgf-b

Nota: PCR è stata effettuata seguendo la procedura usuale: 95 ° C per 30 s, 40 cicli di 95 ° C per 5 s e 60 ° C per 30 s. Post-PCR fusione le curve ha confermato la specificità dell'amplificazione del singolo-obiettivo, e il cambiamento di piega del gene di interesse rispetto al β-actina è stato determinato. La reazione per ogni campione è stata testata tre volte.

  1. Harvest impiantato scaffolds e tessuti da topi sperimentali a 2, 4 e 8 settimane post-operazione 36; gruppo campioni di controllo (n = 4), presi allo stesso tempo punti, dovrebbe essere da tessuto osseo adiacente.
    Nota: In ogni punto del tempo (2, 4 e 8 settimane), eutanasia i topi con inalazione di CO 2. Sezionare il calvaria e, successivamente, rimuovere e raccogliere le impalcature impiantate da calvaria.
  2. Utilizzare un reagente commerciale per estrarre il RNA totale da ogni campione secondo il produttore ' protocollo s. Utilizzare il Kit di trascrizione d'inversione per invertire-trascrivere il RNA in cDNA seguendo il produttore ' protocollo s.
  3. Eseguire quantitative PCR in tempo reale utilizzando il sistema di rilevamento di SYBR Green; i primers sono elencati nella tabella 1.
Primer(5'–3')
Gene Avanti Reverse
pdgfb CATCCGCTCCTTTGATGATCTT GTGCTCGGGTCATGTTCAAGT
sindrome di Raynaud CTCTTTGGGGACGACTTCATC TCCCGAGAATGGAGAAGGAAC
VEGFR2 GAAATGACACTGGAGCCTACA AG TCCATGCTGGTCACTAACAGAA G
β-actina GTATCCATGAAATAAGTGGTTAC AGG GCAGTACATAATTTACACAGAAG CAAT

tabella 1: insiemi Pimer.

8. MicroCT analisi della rigenerazione ossea

  1. Euthanize topi con l'inalazione di CO 2 al post-funzionamento 8 settimane. In un ambiente ben ventilato, delicatamente luogo ogni mouse in una gabbia pulita del mouse e pompa gas CO 2 nella gabbia per anestetizzare i topi prima il euthanasia.
  2. Sezionare il cranio per formazione immagine microCT della regione di difetto dell'osso. Utente i seguenti parametri negli esperimenti di scansione: 9 µm risoluzione, Al filtro di 0,5 mm, 50 kV tensione e corrente 142 µA.
  3. Reconstruct tutti i dati di imaging utilizzando software commerciali forniti dalla società. Calibrare le scansioni utilizzando la funzione di calibrazione di un software CTAn.
    Nota: Inserire un'unità di Hounsfield (HU) sotto i topi in ogni scansione.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Cilindrica porosa PLGA/nHAp ponteggi 0,6 mm di altezza e 4 mm di diametro sono stati fabbricati con una stampante 3D. Le morfologie di impalcature sono state analizzate tramite microscopia elettronica e microCT. Figura 1A Mostra la fotografia dell'impalcatura impiantato. MicroCT di esame ha rivelato che più dell'85% dei pori aveva dimensioni che vanno da 200 a 400 µm (Figura 1B). Formazione immagine SEM ha dimostrato che la superficie dello scaffold aveva una topografia ruvido, con micropori (diametri circa 5-10 µm) collegate tra loro all'interno di impalcature (Figura 1 D-F). Circa il 40% dell'importo totale delle particelle rivestite di LV-eGFP (4,5 x 105) rilasciato dalle impalcature PLGA/nHAp iniziate con un effetto di scoppio iniziale entro 24 h. La bioattività di rilasciato virus di LV ha raggiunto il vertice a 24 h e quindi continuamente diminuita, si avvicina a 0 a 120 h (Figura 2). Questi dati indicano che la bioattività di particelle di LV più impalcatura-immobilizzata potrebbe essere mantenuta per fino a 96 h. La capacità di migrazione delle MSCs-T è stata osservata con il metodo FACS per studiare se LV che trasportano cDNA di pdgf-b potrebbe esprimere e portare alla chemiotassi BMSC, come mostrato Figura 3. Sia il controllo positivo (C) che il gruppo di PDGF-BB-esprimendo (F) hanno esibito un livello significativamente più alto di migrazione BMSC rispetto altri 4 gruppi. Inoltre, la migrazione delle BMSCs nel gruppo F era significativamente superiore a quella nel gruppo C. Non c'erano differenze significative nella migrazione di BMSC tra altri 4 gruppi.

L'angiogenesi all'interno del difetto dell'osso è stato valutato dal 2 per l'8 ° settimana post-impianto da MPM scansione. Figura 4A Mostra un'illustrazione schematica di un mouse sotto scansione MPM. L'angiogenesi evidente è stata rilevata nei gruppi di PH e PHp, ma vasi sanguigni erano a malapena osservabile nel gruppo di controllo, dove solo uno strato di membrane fibrose in tutta la regione di difetto formato (Figura 4B). I grafici GIF mostrano i vaso sanguigno tomografi di ogni gruppo (Dati supplementari). La zona di nuovi vasi sanguigni aumentata gradualmente nel tempo in gruppi PH e PHp, con modelli sempre più simili. Alla settimana 8, i vasi sono comparso nella morfologia simili a quelle osservate nella fase iniziale; l'unico cambiamento era che un numero crescente di navi più piccole stava crescendo in impalcature (Figura 4B). La BVA del gruppo PHp era significativamente superiore che degli altri due gruppi in qualsiasi momento punti (Figura 4). Inoltre, c'erano molti siti di deposizione di collagene, come indicato dai segnali SHG (il colore verde in grafici e grafici GIF) nei gruppi di PH e PHp, ma non nel gruppo di controllo (Figura 4B).

Per chiarire il legame dell'angiogenesi e dell'espressione di PDGF-BB, abbiamo confrontato i livelli di espressione di trascrizione genica di pdgf-b, sindrome di Raynaude VEGFR2 con il metodo di RT-qPCR a 2, 4 e 8 settimane dopo l'impianto ( Figura 5). Come previsto, espressione di pdgf-b è stata aumentata significativamente nel gruppo di PHp a tutti i punti di tempo, con un aumento di 5 - 13 volte rispetto al controllo e nei gruppi PH (Figura 5A). Non c'era differenza significativa fra il controllo ed il gruppo di PH e il livello di espressione di PDGF-BB è rimasto quasi costante dalla settimana 2 alla settimana 8, come mostrato in Figura 5A. I livelli di espressione di mRNA del vWF e del VEGFR2 in tutti e tre i gruppi hanno aumentato gradualmente e tre erano i più alti nel gruppo di PHp a tutti tempo punti (figura 5B e 5C). Per il gruppo di PH, non c'era nessuna significatività statistica rispetto al gruppo di controllo, nonostante evidente angiogenesi (Figura 4B).

Per confermare ulteriormente che pdgf-b-ponteggi contenenti promuovono osso rigenerazione in vivo utilizzando criticamente dimensioni calvarial difetti nei topi BALB/c maschili, microCT scansione fornito informazioni per valutare la rigenerazione dell'osso a 8 settimane post-impianto. Come illustrato nella Figura 6, difetti nel gruppo di PHp sono stati riempiti con una massa di nuova crescita di tessuto osseo in impalcature, considerando che c'era molto meno nuovo osso nel controllo e nei gruppi PH.

Figure 1
Figura 1: caratterizzazione strutturale di un'impalcatura PLGA/nHAp 3D. (A) fotografia di uno scaffold 3D stampata. (B) un immagine microCT della porosità complessiva dell'impalcatura. (C) la topografia della superficie del ponteggio osservato da SEM a 60 X, 2.000 X (D), 5.000 X (E) e 10.000 X ingrandimento (F). Clicca qui per visualizzare una versione più grande di questa figura.

Figure 2
Figura 2: preparazione dei Lentivirus e valutazione della bioattività delle particelle LV-GFP. (A) rappresentazione schematica del costrutto vettore lentivirale. Dopo 48 h di trasfezione, le cellule HEK - 293FT sono state osservate in condizioni di campo (C) di fluorescenza e luce (B). (D) valutazione In vitro della bioattività delle particelle LV-GFP cumulativamente rilasciato da PLGA/nHAp impalcature. Tutti i dati sono presentati come la media ± SEM (n = 4). Clicca qui per visualizzare una versione più grande di questa figura.

Figure 3
Figura 3. Bioattività di PDGF-BB come una risposta potente fattore chemiotattico di BMSC migrazione. BMSCs-T (5 x 104) sono state seminate in cima transwell chambers, con vari media condizione posizionato nella parte inferiore degli alloggiamenti. (A) controllo vuoto, privo di siero medio solo; FBS (B) controllare, supplementato con 10% FBS; Controllo (C) PDGF-BB, 4 ng/mL PDGF-BB in medium senza siero; (D) PDGF-BB grippare gruppo, PDGF-BB (4 ng/mL) e l'anticorpo policlonale anti-PDGF-BB (4 ng/mL) in medium senza siero; Gruppo di BMSCs (E), 2 x 105 BMSCs in medium senza siero; e gruppo di BMSC-P (F), 2 x 105 BMSCs-P in medium senza siero. Tutti i dati vengono visualizzati come la media ± SEM (n = 4). n.: confronto tra gruppo C e tutti gli altri gruppi, ad eccezione del gruppo F, n. p < 0,0001. *: confronto tra gruppo F e tutti gli altri gruppi, * p < 0.05, * * * p < 0,0001. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 4
Figura 4: Formazione immagine ad alta risoluzione microscopia multifotonica (SHG/TPEF) e la quantificazione dell'angiogenesi nella regione di difetto dell'osso di Calvaria del Mouse.trong > (A), A illustrazione schematica di un mouse sotto scansione MPM. Il cerchio arancione rappresenta il sito di difetto, i tubuli rossi rappresentano i vasi sanguigni e il verde rappresenta il collagene. (B) sano e gestito gli animali sono stati scansionati con MPM presso post-l'impianto di 8 settimane. SHG SHG, TPEF, / TPEF fuse e immagini 3D vengono visualizzati. La linea tratteggiata rappresenta il confine lungo il difetto dell'osso nel gruppo di controllo basato su segnali SHG. (C) vaso sanguigno zona quantificazione all'interno dell'area di difetto di controllo PH e PHp da 2 settimana per settimana 8 post-impianto. Tutti i dati vengono visualizzati come la media ± SEM (n = 5). : Analisi statistica tra gruppi PH e PHp, p < 0,0001. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 5
Figura 5: Analisi di RT-qPCR di pdgf-b (A) ed VEGRF2 (C) espressione in tre gruppi di geni correlati all'angiogenesi vWF (B). Sono stati analizzati campioni da 4 animali per ciascun punto di tempo. n.: confronto tra i gruppi di PHp e PH, # p < 0,05, # p < 0,01 e p #< 0,0001. *: confronto tra i gruppi di controllo e PHp, * p < 0.05, * * p < 0.01, e * * * p < 0,0001. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 6
Figura 6: Valutazione In Vivo la formazione dell'osso con MicroCT scansione. Gruppo di controllo senza impalcature impiantate. Gruppo di PH all'interno impiantato PLGA/nHAp impalcatura solo. Gruppo di PHp all'interno di impalcatura PLGA/nHAp impiantato per volta dalle particelle dipdgfb - LV. Clicca qui per visualizzare una versione più grande di questa figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

L'osso è un tessuto altamente vascularized con una singolare capacità di guarire e rimodellare tutta la durata di un singolo1continuamente. Il livello di vascolarizzazione è importante per la riparazione di osteogenesi e difetto. Bassa vascolarizzazione limita l'applicazione clinica larga dell'osso tessutale. Costruire un osso altamente vascularized tessutale secondo la teoria di biomimetica è diventato uno strumento per la riparazione di difetti ossei grande segmento. Vari tipi di ponteggi sono stati applicati con successo per riparare difetti ossei comparativamente piccoli. Tuttavia, per difetti ossei critici, l'applicazione di impalcature per riparare ancora ostacoli facce, principalmente a causa di insufficiente di sangue rifornimento per la riparazione del difetto. Di conseguenza, migliorando l'afflusso di sangue durante il processo di riparazione di difetti ossei grande è uno dei principali problemi nell'ingegneria tissutale.

Persone usano strutture bioattive rivestite con materiale per aiutare a stabilire i necessari campi morfogenetici che possono stimolare, reclutare e promuovere la chemiotassi, la differenziazione e la proliferazione delle cellule necessarie per la formazione dell'osso e neovasculature 37. Neovasculature in impalcature tessutale è essenziale per le cellule di ricevere ossigeno e sostanze nutritive, per la rimozione dei prodotti di scarto e, infine, per l'adempimento della funzione di ponteggi. Gli obiettivi di questo studio erano di indagare l'angiogenesi con in vivo microscopia multifotonica in un'impalcatura PLGA/nHAp geneticamente, 3D-stampato per la riparazione del difetto di osso calvarial critico e di valutare gli effetti dell'utilizzo di rigenerazione ossea microCT.

Malgrado i successi drammatici nella ingegneria del tessuto osseo, visualizzazione in vivo e la quantificazione della neovascolarizzazione in impalcature durante dell'osso rigenerazione è ancora una sfida. Sistemi di imaging più microscopici in grado di fornire informazioni volumetriche sull'angiogenesi. Tradizionali metodi di formazione immagine, quali microCT, MRI e le analisi istologiche, sono distruttivi, complicato e faticoso e hanno basse risoluzioni spaziali e acquisizione immagine lunga volte38. Tuttavia, la formazione immagine MPM è una modalità novella di bio-imaging che può catturare il vaso sanguigno segnali in vivo in un modo ad alta risoluzione e minimamente invasivo. È in grado di rilevare nuove navi più sottile di 10 µm (Figura 4B). Oltre alle immagini del vaso sanguigno, inoltre abbiamo osservato una massa di nuova deposizione di collagene (il colore verde in figura 4B) e i grafici GIF in materiale supplementare, come indicato dai segnali SHG, che indicano la formazione del tessuto osseo da un'altra angolazione. Teoricamente, il vaso sanguigno immagini potrebbero essere ottenute senza l'utilizzo di agenti di contrasto. Tuttavia, nel presente studio, abbiamo utilizzato un agente di contrasto per ottenere immagini migliori e rimosso cutanee locali per garantire la corretta profondità di scansione. Questo sarebbe inutile quando più potenti sistemi di imaging sono disponibili in futuro per imaging veramente non-invasivo.

HAp è un materiale per la rigenerazione del tessuto osseo che è ampiamente usato per la sua buona osteoconduzione e tratti di osteoinduzione biomedica. HAp ha buona capacità di associazione vettori di DNA e di trattenere e di vettori, tra cui vettori virali39di stabilizzazione. Rispetto al micronizzato HAp, nanoparticelle HAp possiedono alte aree superficiali specifiche e quindi mostrano meglio il comportamento cellulare e proprietà meccaniche40. Per questi motivi, nHAp particelle sono uno dei componenti di impalcature. Le immagini di SEM superficiale e della sezione trasversale dell'impalcatura PLGA/nHAp illustrato nella figura 1 indica che i ponteggi fabbricati esibiscono una struttura di poro ben interconnesse e dimensioni dei pori uniformemente distribuito. L'immobilizzazione del virus su supporti di biomateriale può influenzare l'attività del virus. Di conseguenza, abbiamo testato la bioattività delle particelle di LV liberato dalle impalcature indagando sulle loro attività di transfezione. I profili di rilascio di particelle di LV da impalcature e loro bioattività sono stati valutati in vitro, dimostrando la consegna controllata di particelle bioattive di LV per cinque giorni (Figura 2). Inoltre, il nostro Studio in vitro incentrato sulle potenzialità del PDGF-BB per stimolare la migrazione delle MSCs primario. Questi risultati indicano che le particelle di LV espresso bioattivi PDGF-BB ed efficacemente stimolata BMSC migrazione.

Per confermare la capacità per l'angiogenesi e l'osso rigenerazione in vivo, PHp ponteggi sono stati impiantati nei difetti dell'osso critico calvarial murino. Formazione del vaso è stata confermata con marcatori angiogenici, analisi di RT-qPCR e vaso sanguigno densità osservata con formazione immagine SHG/TPEF. Entrambe le due serie di esperimenti ha dimostrato che l'angiogenesi e la formazione del vaso sanguigno sono stati migliorati significativamente con il trattamento di ponteggi geneticamente modificati. Questi risultati indicano che il PDGF-BB non solo direttamente stimola l'angiogenesi, ma induce anche altri geni correlati all'angiogenesi. Nel frattempo, microCT misurazioni dimostrano che pdgf-b-contenenti ponteggi significativamente promosso la formazione dell'osso rispetto ai ponteggi non modificati, che correla bene con il neovasculature nell'impalcatura. Questi risultati indicano che scaffold bioattivi, geneticamente migliorano significativamente l'angiogenesi e rigenerazione tissutale.

I risultati presentati qui dimostrano che la modificazione genetica dei lentivirus-mediata delle impalcature facilita la riparazione di grande difetto osseo in un modello di difetto critico calvarial murino dell'osso, probabilmente attraverso l'angiogenesi migliorata. Inoltre, in vivo imaging MPM fornisce uno strumento unico per capire l'angiogenesi e osteogenesi nell'osso ponteggi e consente ulteriore delucidazione se una certa impalcatura è benefico alla neovascolarizzazione. Formazione immagine di microscopia multifotonica videomicroscopia fornisce una modalità per capire la fisiologia e patofisiologia dell'angiogenesi nei tessuti e impalcature. Tuttavia, ci sono diverse limitazioni quando si utilizza questa tecnica. In primo luogo, la preparazione chirurgica richiede particolare esperienza. L'infiammazione causata da operazioni non adeguate diminuirà significativamente il qualità dell'immagine di MPM. In secondo luogo, a causa del MPM imaging di limitazione della velocità, un supporto per mouse personalizzati è necessaria per ridurre gli artefatti causati da battito cardiaco e la respirazione. In terzo luogo, per l'imaging a lungo termine, gli animali devono essere intraperitonealmente o per via endovenosa iniettati con soluzione fisiologica per prevenire la disidratazione.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori dichiarano di non avere nessun concorrenti interessi finanziari.

Acknowledgements

Questo studio è stato sostenuto dal programma di pavone di Shenzhen, Cina (No. 110811003586331), il programma di ricerca base di Shenzhen (No. JCYJ20150401150223631, no. JCYJ20150401145529020 e no. JCYJ20160331190714896), il Guangdong ricerca e sviluppo di capacità speciale programma pubblico (n. 2015A020212030), la Fondazione nazionale di scienze naturali della Cina (No. 81501893), il programma di ricerca di base maggiore nazionale della Cina (2013CB945503) e la Programma di innovazione SIAT per eccellenti giovani ricercatori (Y5G010).

Materials

Name Company Catalog Number Comments
Poly(D,L-lactide-co-glycolide) (PLGA) Sigma P1941 L/G ratio 75:25, MW 66000-107000
Hydroxyapatite nanoparticles Sigma 702153 Average diameter < 200 nm
Chloroquine diphosphate salt Sigma C6628
FITC-conjugated 250-kD dextran Sigma FD250S
1,4-dioxane lingfeng,Shanghai 0.45 micron
Stericup filters Merck Millipore Corporation SLHV033RB
PDGF-BB Cdna Sino Biological, Inc MZ50801-G
Anti-PDGF-BB mouse polyclonal antibody  BioVision, Inc 5489-30T
PDGF-BB recombinant protein 4489-50
Calcium-phosphate transfection solution Promega Corporation E1200
L-DMEM Hyclone SH30021.01
DPBS Hyclone SH30028.01
Penicillin-Streptomycin, Liquid Thermo Fisher Scientific 15140122
FBS Thermo Fisher Scientific 10099-141
Transwell  Corning 3422
Male BALB/c mice Guangdong Medical Laboratory Animal Center 
sodium pentobarbital  Merck 1063180500
multiphoton microscopy A homemade in Shenzhen Institutes of Advanced Technology to detect two-photon excited fluorescence (TPEF) and second harmonic generation signal (SHG).
isoflurane Keyuan, Shandong 401750169
TRIzol reagent Invitrogen 15596018
PrimeScript RT Master Mix (Perfect Real Time) Takara RR420B
SYBR Premix Ex Taq (Tli RNaseH Plus) Takara RR036B
Hematoxylin and eosin Beyotime C0105
Paraffin Leica  RM2235
Ultracentrifuge OPtima L-100XP Beckman Coulter L-100XP
Low-temperature printer  Tsinghua university A homemade in Tsinghua university
LightCycler 480 instrument  Roche 5815916001
microCT Bruker 1176
commercial software Bruker
Buprenorphine

DOWNLOAD MATERIALS LIST

References

  1. Hu, X., et al. GPNMB enhances bone regeneration by promoting angiogenesis and osteogenesis: potential role for tissue engineering bone. J Cell Biochem. 114, (12), 2729-2737 (2013).
  2. Schroeder, J. E., Mosheiff, R. Tissue engineering approaches for bone repair: concepts and evidence. Injury. 42, (6), 609-613 (2011).
  3. Chiarello, E., et al. allograft and bone substitutes in reconstructive orthopedic surgery. Aging Clin Exp Res. 25, S101-S103 (2013).
  4. Elangovan, S., et al. The enhancement of bone regeneration by gene activated matrix encoding for platelet derived growth factor. Biomaterials. 35, (2), 737-747 (2014).
  5. Bouyer, M., et al. Surface delivery of tunable doses of BMP-2 from an adaptable polymeric scaffold induces volumetric bone regeneration. Biomaterials. 104, 168-181 (2016).
  6. Rezwan, K., et al. Biodegradable and bioactive porous polymer/inorganic composite scaffolds for bone tissue engineering. Biomaterials. 27, (18), 3413-3431 (2006).
  7. Burg, K. J., Porter, S., Kellam, J. F. Biomaterial developments for bone tissue engineering. Biomaterials. 21, (23), 2347-2359 (2000).
  8. Xiao, Y., et al. Modifications of collagen-based biomaterials with immobilized growth factors or peptides. Methods. 84, 44-52 (2015).
  9. Chen, G., Lv, Y. Immobilization and Application of Electrospun Nanofiber Scaffold-based Growth Factor in Bone Tissue Engineering. Curr Pharm Des. 21, (15), 1967-1978 (2015).
  10. Kofron, M. D., Li, X., Laurencin, C. T. Protein- and gene-based tissue engineering in bone repair. Curr Opin Biotechnol. 15, (5), 399-405 (2004).
  11. Chen, F. M., et al. New insights into and novel applications of release technology for periodontal reconstructive therapies. J Control Release. 149, (2), 92-110 (2011).
  12. Winn, S. R., et al. Gene therapy approaches for modulating bone regeneration. Adv Drug Deliv Rev. 42, (1-2), 121-138 (2000).
  13. Chang, P. C., et al. Adenovirus Encoding Human Platelet-Derived Growth Factor-B Delivered to Alveolar Bone Defects Exhibits Safety and Biodistribution Profiles Favorable for Clinical Use. Hum Gene Ther. 20, (5), 486-496 (2009).
  14. Phipps, M. C., Xu, Y. Y., Bellis, S. L. Delivery of Platelet-Derived Growth Factor as a Chemotactic Factor for Mesenchymal Stem Cells by Bone-Mimetic Electrospun Scaffolds. Plos One. 7, (7), (2012).
  15. Gehmert, S., et al. Angiogenesis: The role of PDGF-BB on Adiopse-tissue derived Stem Cells (ASCs). Clin Hemorheol and Microcirc. 48, (1-3), 5-13 (2011).
  16. Chang, P. C., et al. PDGF-B gene therapy accelerates bone engineering and oral implant osseointegration. Gene Ther. 17, (1), 95-104 (2010).
  17. Javed, F., et al. Significance of the platelet-derived growth factor in periodontal tissue regeneration. Arch Oral Biol. 56, (12), 1476-1484 (2011).
  18. Murali, R., et al. Biomimetic hybrid porous scaffolds immobilized with platelet derived growth factor-BB promote cellularization and vascularization in tissue engineering. J Biomed Mater Res A. 104, (2), 388-396 (2016).
  19. Andrae, J., Gallini, R., Betsholtz, C. Role of platelet-derived growth factors in physiology and medicine. Genes Dev. 22, (10), 1276-1312 (2008).
  20. Wosnitza, M., et al. Plasticity of human adipose stem cells to perform adipogenic and endothelial differentiation. Differentiation. 75, (1), 12-23 (2007).
  21. Hankenson, K. D., et al. Angiogenesis in bone regeneration. Injury. 42, (6), 556-561 (2011).
  22. Schmidt, C., et al. Rapid three-dimensional quantification of VEGF-induced scaffold neovascularisation by microcomputed tomography. Biomaterials. 30, (30), 5959-5968 (2009).
  23. Perng, C. K., et al. In Vivo Angiogenesis Effect of Porous Collagen Scaffold with Hyaluronic Acid Oligosaccharides. J Surg Res. 168, (1), 9-15 (2011).
  24. Sun, Y., et al. Imaging tissue engineering scaffolds using multiphoton microscopy. Microsc Res Tech. 71, (2), 140-145 (2008).
  25. Fan, X., et al. Noninvasive monitoring of placenta-specific transgene expression by bioluminescence imaging. PLoS One. 6, (1), e16348 (2011).
  26. Yeo, M. G., Kim, G. H. Preparation and Characterization of 3D Composite Scaffolds Based on Rapid-Prototyped PCL/β-TCP Struts and Electrospun PCL Coated with Collagen and HA for Bone Regeneration. Chem Mater. 24, (5), 903-913 (2012).
  27. Mao, Y., et al. Lentiviral Vectors Mediate Long-Term and High Efficiency Transgene Expression in HEK 293T cells. Int J Med Sci. 12, (5), 407-415 (2015).
  28. Li, J., et al. Investigation of angiogenesis in bioactive 3-dimensional poly (D,L-lactide-co-glycolide)/nano-hydroxyapatite scaffolds by in vivo multiphoton microscopy in murine calvarial critical bone defect. Acta Biomater. 42, 389-399 (2016).
  29. Abbasi, H., et al. Lentiviral vector-mediated transduction of goat undifferentiated spermatogonia. Anim Reprod Sci. 163, 10-17 (2015).
  30. Pigossi, S. C., et al. Bacterial cellulose-hydroxyapatite composites with osteogenic growth peptide (OGP) or pentapeptide OGP on bone regeneration in critical-size calvarial defect model. J Biomed Mater Res A. (2015).
  31. Bos, G. D., et al. The effect of histocompatibility matching on canine frozen bone allografts. J Bone Joint Surg Am. 65, (1), 89-96 (1983).
  32. Hollinger, J. O., Kleinschmidt, J. C. The critical size defect as an experimental model to test bone repair materials. J Craniofac Surg. 1, (1), 60-68 (1990).
  33. Hollanders, K., et al. Bevacizumab Revisited: Its Use in Different Mouse Models of Ocular Pathologies. Curr Eye Res. 40, (6), 611-621 (2015).
  34. Gao, L. QSIM: quantitative structured illumination microscopy image processing in ImageJ. Biomed Eng Online. 14, 4 (2015).
  35. Kobat, D., et al. Deep tissue multiphoton microscopy using longer wavelength excitation. Opt Express. 17, (16), 13354-13364 (2009).
  36. Lohmann, P., et al. Bone regeneration induced by a 3D architectured hydrogel in a rat critical-size calvarial defect. Biomaterials. 113, 158-169 (2016).
  37. Lv, J., et al. Enhanced angiogenesis and osteogenesis in critical bone defects by the controlled release of BMP-2 and VEGF: implantation of electron beam melting-fabricated porous Ti6Al4V scaffolds incorporating growth factor-doped fibrin glue. Biomed Mater. 10, (3), (2015).
  38. Guldberg, R. E., et al. 3D imaging of tissue integration with porous biomaterials. Biomaterials. 29, (28), 3757-3761 (2008).
  39. Boehler, R. M., et al. A PLG/HAp composite scaffold for lentivirus delivery. Biomaterials. 34, (21), 5431-5438 (2013).
  40. Heo, S. J., et al. Fabrication and characterization of novel nano- and micro-HA/PCL composite scaffolds using a modified rapid prototyping process. J Biomed Mater Res A. 89, (1), 108-116 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics