הערכה של ה-DNA זיהום בדגימות ה-RNA בהתבסס על Ribosomal DNA

Genetics
 

Summary

כאן, אנו מציגים פרוטוקול עבור מעקב גנומית דנ א (gDNA) זיהום בדגימות ה-RNA. השיטה הציג מנצל תחל ספציפיות עבור אזור פנימי מרווח משועתקים (ITS) של גנים ribosomal DNA (rDNA). השיטה מתאים זיהוי אמין, רגיש לזיהום DNA ברוב פרוקריוטים, אאוקריוטים.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Hashemipetroudi, S. H., Nematzadeh, G., Ahmadian, G., Yamchi, A., Kuhlmann, M. Assessment of DNA Contamination in RNA Samples Based on Ribosomal DNA. J. Vis. Exp. (131), e55451, doi:10.3791/55451 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

שיטה אחת נעשה שימוש נרחב על כימות של שינויים בביטוי הגנים, תעתיק abundances היא הפוכה-תמלול כמותיים PCR בזמן אמת (RT-qPCR). הוא מספק תוצאות מדויקות, רגיש, אמינים ובעלי לשחזור. מספר גורמים יכולים להשפיע על רגישות וסגוליות של RT-qPCR. שיורית DNA גנומי (gDNA) זיהום דגימות ה-RNA הוא אחד מהם. ניתוח ביטוי גנטי, שאינם ספציפיים הגברה עקב זיהום gDNA מגזים השפע של התעתיק רמות, יכולים להשפיע על התוצאות RT-qPCR. באופן כללי, gDNA הוא זוהה על ידי לרביעיית-PCR באמצעות פריימר זוגות חישול אזורים intergenic או אינטרון של הגן עניין. למרבה הצער, ביאורים אינטרון/אקסון אינן ידועות עד היום עבור כל הגנים בעלי חוליות, חיידקים, פרוטיסטים, פטריות, צמחים, הגעה מינים metazoan.

כאן אנו מציגים פרוטוקול עבור זיהוי של gDNA זיהום ב- RNA דגימות באמצעות ribosomal DNA (rDNA)-המבוסס על צבעי יסוד. השיטה מבוססת על האלמנטים הייחודיים של rDNA: multigene הגדול יצורים עילאיים, רצפים מאוד שנשמרת, ואופיים בתדירות גבוהה הגנום. גם כמקרה, ערכה ייחודית של תחל תוכננו בהתבסס על אזור שנשמרת ribosomal DNA (rDNA) בממשפחת הדגניים. האוניברסליות של הזוגות פריימר נבחנה ע י להמיס עקומת ניתוח ו- agarose בג'ל. למרות השיטה שלנו מסביר איך תחל מבוססי rDNA יכול להיות מיושם עבור וזמינותו זיהום gDNA ב ממשפחת הדגניים, זה יכול היה בקלות לשמש מינים אחרים פרוקריוטים איקריוטים

Introduction

חקר תעתיק ויסות מעניין ערכות הגן או רשתות איתות חיוני להבין את המנגנונים המולקולריים מורכבים מעורב אירועים ביולוגי1. כיום, ניתוח qPCR הוא הנפוצים ביותר בגישה ללימודי ג'ין ביטוי שיכולות היעד או דנ א (הגנום) או RNA (transcriptome) אשר מאפשרות methylome וניתוח transcriptome, בהתאמה. שעתוק במהופך (RT) ואחריו qPCR נעשה שימוש נרחב לניתוח transcriptome למדוד רמות ביטוי גנים במגוון תחומי המחקר הביולוגי2. לעומת אחרים שיטות כמו הכלאה הצפונית המסורתית, רקמות זיהוי ספציפי באמצעות באתרו בתוך הכלאה ribonuclease מבחני הגנה (RPA), דו-RT-PCR, הדיוק, נוחות, מהירות ואת טווח דינמי רחב מבחני מבוססי qPCR הם מאוד יוצא דופן3,4. ישנם מספר גורמים חשובים שיש מועמדים כימות אמין של RNA שליח (mRNA), כולל את האיכות והכמות של RNA החל חומר. יתר על כן, הגברה שאינם ספציפיים, היעילות של RT-qPCR ויעילות PCR צריך להיחשב5,6.

הנוכחות של gDNA היא בעיה פנימית במהלך החילוץ-RNA נובע, בין השאר, דומה הפיסיקליות והכימיות של DNA ו- RNA7. בגלל זהותו רצף של gDNA ו- DNA משלימים (cDNA) נגזר מן הדגימות mRNA, הגברה שאינם ספציפיים יכול להתרחש, אשר ישפיעו על הדיוק של התוצאות RT-qPCR. GDNA הנותרים יוביל מופרזת של השפע של היעד mRNA בג'ין-ביטוי-ניתוח-8.

בעיקרון, אמפליקון שאינם ספציפיים בעיקר נובע היווצרות פריימר דיימר או רקע לא ספציפי הגברה בשל gDNA, אשר שניהם יכול להיות מוערך על ידי באמצעות דגימות הפקד המתאים. דוגמאות כאלה הן שליטה תבנית (NTC) ושליטה אין-רוורס טרנסקריפטאז (NRT), בהתאמה. מאז הרמות של זיהום gDNA הדגימות הנלמדים הם שונים, הרגישות כלפי gDNA שונה מאוד בין הגנים ניתח הפקדים NRT נדרשים עבור כל זוג מדגם/assay. למרות זה מגדיל באופן משמעותי את עלות ועבודה במחקרים פרופיל RT-qPCR, פקדים אלה הם נדרשים7,9.

שיטות אלטרנטיביות להתמודד עם זיהום gDNA כוללים את השימוש זוגות פריימר חישול אזורים intergenic או אינטרון של הגן של ריבית10, ואת השימוש תחל לאגף אינטרון גדולים או span של צומת אקסון-אקסון, קרי האתרים מחזק נעדרים ב- mRNA בוגר רצף1,4. עם זאת, הביאורים אינטרון/אקסון של כל הגנים רבים בעלי חוליות, חיידקים, פרוטיסטים, פטריות, צמחים, הגעה מינים metazoan ידועים עדיין. בנוסף, היצורים האיקריוטים רבים יש pseudogenes נגזר שכפול אירועים. עוד יותר, עיצוב פריימר על פני אינטרונים אינה מבטיחה אי-הגברה של gDNA. כמו כרומטין הנגישות של אזורים גנומית כדי DNase אני משתנה, מומלץ לתכנן פריימר שונים זוגות כרומוזומים שונים10מיקוד.

הגנום של היצורים האיקריוטים יכול להקיף עד אלף עותקים של גנים rDNA קידוד הדרושות הריבוזומים היווצרות ribosomal subunits. גנים אלה rDNA מאורגנים לעיתים קרובות מערכים יחיד או tandem חוזר11. Polycistronic rRNAs (איור 1) כולל יחידת משנה גדולה (LSU), יחידת משנה קטנים (SSU) משוקלטים על ידי RNA פולימראז אני (RNA pol אני). טרום-rRNAs וכתוצאה מכך מעובדים עוד יותר על ידי ביטול פנימי מרווח משועתקים שני האיזורים ITS1 ו- ITS2. כמו המוצרים הסופיים, שלושה מבוגרים rRNAs, 17-18S rRNA (SSU), 5.8S, 25-28S rRNA (LSU) הם שנוצר12. rDNA גנים הם טיפוסי נציגים של משפחת multigene הגדול יצורים עילאיים עם רצפי שנשמרת מאוד. הן מתרחשות עם תדירות גבוהה הגנום והן שעשויות להיות נוכח המיקום כרומוזומלית יותר מפעם אחת13. העיבוד של rRNA ההשפלה של קפיציות משועתקים הוא תהליך מהיר גרעינון. בשל רמה גבוהה של repetitiveness, היחס של עותק גנומית ומספר לזיהוי premolecules RNA לא מעובד הוא נמוך בהשוואה לאינטרון נמוך-העתק רצפים של סימנים מקדימים unspliced. תכונות אלה להפוך rDNA גנים גם מתאים לגילוי רגישות גבוהה ואמינות של זיהום gDNA פרוקריוטים, אאוקריוטים רוב3.

כאן מתואר הליך הרומן לגילוי זיהום gDNA בדגימות ה-RNA. ערכה של צבעי בסיס אוניברסלי המבוסס על הרצף rDNA והתפאורה מוצג עבור מבחני gDNA במין דגניים מספר. ירידה לפרטים, אוניברסאליות תחל המוצע נבדקו על ידי ניתוח עקומת להמיס באמצעות DNA כתבנית. פרוטוקול שלנו אינה ישימה עבור דגניים, אך יכול להתאים בקלות גם מינים אחרים האיקריוטים ו prokaryotic.

Protocol

הערה: כל רקמות ניתן להשתמש.

1. חומצות גרעין החילוץ

  1. מכניסים צינור 2.0 מ ל 100 מ ג של דגימות רקמה, להוסיף שני חרוזים נירוסטה 5 מ מ ו- homogenize הרקמה ב- 25-30 הרץ ל 30 s (המגון משך ותדירות בהתאם לסוג הרקמה) עבור ה-DNA ו- RNA.
  2. בודד הכולל RNA לפי הוראות היצרן.
  3. לבודד דנ א הכולל לפי הוראות היצרן.
  4. לשלוט טוהר כמות דגימות ה-RNA על ידי מדידת ספיגת-260 ו 280 ננומטר.
  5. לשלוט טוהר כמות דגימות ה-DNA על ידי מדידת ספיגת-260 ו 280 ננומטר.
    הערה: בזמן חומצות גרעין סופגים אור עם אורך גל של 260 ננומטר (A260), ספיגת של אור באורך הגל 280 (A280) יכול לשמש כדי לכמת את כמות החלבונים ולהציג פנולים במדגם. לכן, היחס של nm A260/A280 יכול לשמש כדי להעריך את הטוהר של DNA ו- RNA מופק מדגם. A260/280 ערכים בטווח של ≥1.8 ו- > 2.0 נחשבים בדרך כלל להיות "טהור" בשביל DNA ו- RNA, בהתאמה. ערכים נמוכים יותר A260/280 עשוי להצביע על זיהום על ידי חלבון או כימיקלים אורגניים.
  6. לבדוק את האיכות של ה-DNA על-ידי הפעלת agarose כ- 0.7% אלקטרופורזה בג'ל. להכין את הג'ל ויפעלו ב- 1 x EDTA טריס-boric-buffer (TBE: 89 מ מ טריס חומצה בורית 89 מ"מ, 2 מ מ EDTA) ב- 100 וולט 30 מינימלית גבוהה באיכות gDNA מופיע בתור פנייה חדה גבוהה משקל מולקולרי (HMW) להקה עם אין מריחות בטווח של מולקולות משקל מולקולרי נמוך (LMW).
  7. בדוק RNA מבודדים עבור הכמות, טוהר ויושר תחת denaturing תנאים של guanidine thiocyanate (GTC) agarose בג'ל או על ידי אלקטרופורזה נימי שבב, על פי הוראות היצרן.
    1. להכין את הג'ל GTC על-ידי הוספת 5 מ מ GTC רגיל 1 x TBE 1% agarose ג'ל לאחר קירור של אגר עד 60 מעלות צלזיוס.
      הערה: GTC רעילים, אז לוותר על זה בשכונה fume, ללבוש ציוד מגן אישי המתאים.
    2. להכין RNA denaturing טעינת מאגר: 95% formamide, 10 מ מ EDTA pH 8.0, 0.1% bromophenol כחול, 0.1% קסילן cyanole ו 10 µL אתידיום ברומיד.
      הערה: Formamide של אתידיום ברומיד רעילים, כדאי ובשמפו בשכונה fume.
    3. עומס 1-5 µg של RNA סה ב- RNA denaturing טעינת מאגר, חום התערובת במשך 5 דקות ב- 70 מעלות צלזיוס, להניחה על הקרח לפני טעינתו על גבי ג'ל, ואז נפרדות RNA-GTC ג'ל ב- 100 וולט עבור 45 דקות עומס DNA או RNA משקל מולקולרי סמן כסטנדרט לצד דגימת ה-RNA.
    4. כתם של ג'לים עם אתידיום ברומיד והמחש הלהקות שימוש במערכות לכידת התמונה מתחת לאור אולטרה סגול. ב פרוקריוטים, יראה שלם RNA הכולל לרוץ במהירות denaturing תנאים לפחות שני חד וברור rRNA להקות (28S ו- 18S) עם יחס של 2:1 בעוצמה.
  8. להסיר את עקבות של gDNA על ידי טיפול עם DNase (DNase אני נטולת RNase). להוסיף צינור ללא RNase 10 µL הנפח הכולל: 0.1 - 1 µg של RNA הכולל, יחידה אחת של DNase ואני µL 1 של 10 x תגובת מאגר עם MgCl2. דגירה את התערובת למשך 30 דקות ב- 37 מעלות צלזיוס. לסיים את התגובה על-ידי הוספת 1 µL של 50 מ מ EDTA המקננת ב 65 מעלות צלזיוס למשך 10 דקות.
  9. הסר עקבות של RNA תמציות gDNA שימוש חינם DNase RNase A, על-פי הפרוטוקול של היצרן. להוסיף 5 µL של RNase 10 מ"ג/מ"ל ל- DNA הכולל דגירה ב 37 ° C עבור ה 1 חנות RNA ו- DNA תמציות ב-80 מעלות צלזיוס.

2. פריימר והעיצוב rDNA אזור עבור gDNA Assay

הערה: רצף באורך מלא rDNA מכיל שני אזורים (ITS1 ו- ITS2), אשר יוסרו בתוך המולקולה rRNA בוגרת על ידי סדרה של אדמירל endonucleolytic והשפילו ואז (איור 1).

  1. לאחזר את רצף נוקלאוטיד rDNA NCBI (http://www.ncbi.nlm.nih.gov) עבור המינים של ריבית. מילת המפתח הטוב ביותר לחיפוש מסד הנתונים היא "פנימי מרווח משועתקים."
  2. קלט את רצף נוקלאוטיד היעד לתוך חיפוש BLASTn עבור חיפוש פנימי מרווח משועתקים אזורים (ITSs), SSU, ו LSU והתפאורה אזורים.
  3. בחר תחל גם לאגף מרצף ITSs או זה להגביר את רצפי ITSs שלא נמצאים ב- rRNA בוגר.
    1. עיצוב תחל איגוף הרצפים ITS1 או ITS2: ליישר את האזורים שנשמרת ממינים שונים על-ידי ClustalW. עיצוב תחל ספציפיות עבור אזור איגוף שלה לאחר ניתוח ספציפי/קרוס-מינים taxa עם AlleleID תוכנה. פריימר שני זוגות SSU הגברה-5.8S ו- 5.8S-LSU amplicons יכול להיות מעוצב בהתבסס על האזורים איגוף של ITS1 ו- ITS2, בהתאמה. מכיוון amplicons אלה הם פורש על פני האזור ITS, האורך אמפליקון יוגדל לפחות 300 bp ב amplicons מ gDNA. עלייה זו מפחיתה את הרגישות.
      1. איגוף ITS1: בחר SSU ואת 5.8S רצף rRNA. צבעי יסוד שנבחר דגניים הינם: SSU, SF: CGTAACAAGGTTTCCGTAGGTG, r: GGTTCACGGGATTCTGCAAT. הזוג הזה פריימר (SF: קדימה, r: הפוך) מגביר את האזור חלקית של SSU באורך מלא של ITS1, האזור חלקית של 5.8S rDNA.
      2. איגוף ITS2: בחר 5.8S ואת רצף LSU. צבעי יסוד שנבחר דגניים הינם: רצף הסכמה f: ATTGCAGAATCCCGTGAACC LSU, LR: TGCTTAAAYTCAGCGGGTAGYC. הזוג הזה פריימר מגביר את האזור חלקית של 5.8S, באורך מלא של ITS2, ואת האזור חלקית של LSU (איור 1).
        הערה: במקרה של עיצוב פריימר המבוסס על פירמת איגוף באזור, האזורים שנשמרת מאוד של SSU, 5.8S, ו LSU זוהו. תחל ואחורה של 5.8S rRNA תוכננו בהתבסס על מוטיב שנשמרת צמחים פורחים14. תחל ואחורה תוכננו בהתבסס על SSU ו LSU והתפאורה אזורים בדגניים, בהתאמה. הסטה של SSU ו LSU צבעי יסוד לכל מין ניתנת טבלה1.
    2. תחל הגברה מרצף ITSs: ב פרוטוקול זה, עיצוב ITS1 תחל בהתבסס על כף-חתול רצף שלו (NCBI taxid המספר: 110873). לשימוש תחל: קדימה: GGTATGGCGTCAAGGAACACT, הפוך: ATAGCATCGCTGCAAGAGGT. על פי amplicons שנוצר על ידי ה תחל זוגות סיליקו, הגודל צריך לנוע בין 60 ל-200 bp. . זה גם הגודל המומלץ לניתוח qPCR...
  4. לבחור את תחל תוך כדי התמודדות עם המלצות אלה: GC תוכן: 40-60%, פריימר אורך: אורך המוצר של ה-PCR בסיס, 18-23: 60-160 bp (במיוחד עבור פריימר שלה), נמס בטמפרטורה (Tm): 60 ° C, ה-Tm הסופי עבור שני צבעי יסוד לא שונות יותר מ 5 ° C, המטרה העיקרית היא ers הם לא משלימים לעצמם או שותף תחל.
  5. בדוק מספר תחל ירידה לפרטים, ולהעתיק. לבצע ניתוח ב- silico של הרצף פריימר שנבחר על-ידי תוכנית פריימר-הפיצוץ (https://www.ncbi.nlm.nih.gov/tools/primer-blast/).
    1. פתח את דף הגשת פריימר-הפיצוץ. הזן שני רצפים פריימר במקטע פרמטרים פריימר של הטופס. יחודיות זוג תחל בדיקת פרמטרים במקטע, הזן של אורגניזם (או אורגניזם שם קבוצה) ובחר את הגנום של מסד הנתונים. הגדרות אלה נותנות מידע ירידה לפרטים לגבי היעד רצף, פריימר פרמטרים כולל אורך המוצר, עמדה על כרומוזום, והעתק את המספר.

3. לבצע את qPCR צעד לצורך אימות מבוסס rDNA תחל עם תבניות DNA

הערה: הפונקציונליות של צבעי בסיס מעוצב לאמת על ידי ביצוע qPCR באמצעות gDNA כתבנית. כדי לבצע מספר תגובות מקבילים ולצמצם שגיאות pipetting, הכנת תערובת בסיס מומלץ. עבור שילוב אב, להכין אמצעי מקביל המספר הכולל של התגובה מיקס פלוס ~ 10%.

  1. הכן תערובת בסיס על ידי ערבוב כל הרכיבים התגובה מלבד תבנית ה-DNA בשפופרת PCR-תגובה. יוקרתית כנדרש מתגובה אחת כדי להכין את תערובת בסיס: µL 5 SYBR green (SYBR) מאסטר מיקס (2x), µL 0.3 פריימר (0.3 מיקרומטר כל של פריימר ואחורה), ולכוונן את העוצמה הסופי כדי µL 10 במים נטולי RNase. השתמש בערך ≤200 ng ב- µL 1 של תבנית gDNA לניתוח.
    הערה: להפשיר, להרכיב ולשמור כל ריאגנטים, רכיבים, ואת התגובה mixes על קרח.
  2. Aliquot המיקס מאסטר לתוך צלחת 96-ובכן אופטי. פיפטה µL 1 של gDNA כדי מכל קידוח ולאחר מכן לכסות את זה עם לוחית אופטי איטום הסרט. ספין ולמקם הצנטרפוגה.
  3. להפעיל את הבדיקה qPCR הצנטרפוגה תרמי בזמן אמת בתנאים הבאים: 10 דקות ב 95 ° C ואחריו 40 מחזורי 95 ° C עבור 15 s ו- 60 ° C עבור 1 מינימלית בצע חדרי קירור והקפאה-60 ° C חישול/ההרחבה צעד.
  4. לאחר הניתוח הגברה, נושא כל תגובות PCR ניתוח עקומת נמס עם מדידת קרינה פלואורסצנטית רציפה מ 55 ° C עד 95 מעלות צלזיוס. בדרך כלל, לאסוף נתונים נקודה אחת בכל מחזור על ידי עלייה stepwise של הטמפרטורה על ידי 0.5 ° C לכל מחזור.
    הערה: כוללים פקדים שאינם מתבנית לפחות 2 (NTC) עבור מיקס מאסטר כל זוג פריימר. ביצוע מבחני כל שכפולי לפחות שלושה.
  5. לאשר יחודיות פריימר דרך הניתוח עקומת להמיס. לנתח עקומות מחזור הסף יחיד, שיטה התאמת עקומה החיבור.
    הערה: הופעת לשיא בודדים חדה מציינת של אמפליקון בודדים אחיד. פריימר דיימר מוצרים יכולים להופיע כמו פסגות בודדים בטמפרטורות נמוכות.
  6. אמת את הגודל של כל אמפליקון על-ידי agarose בג'ל.
    1. להכין 3% agarose ג'ל על ידי ערבוב agarose דור 3 עם 100 מ של מאגר TBE (TBE: 89 מ מ טריס חומצה בורית 89 מ"מ, 2 מ מ EDTA).
    2. מערבבים 5-10 µL של מוצר ה-PCR עם DNA ו 1-2 µL של 6 x טעינת מאגר. לטעון את מוצר ה-PCR לצד סולם הדנ א על 3% agarose ג'ל. לבצע את ההפרדה electrophoretic 1 x טריס-boric EDTA-buffer-100 וולט למשך 45 דקות.
    3. כתם של ג'לים אתידיום ברומיד או כל סוכן אחר intercalating והמחש הלהקות שימוש במערכות לכידת התמונה מתחת לאור אולטרה סגול.
      הערה: ה-DNA intercalating סוכנים (למשל, אתידיום ברומיד) cancerogenic, צריך להיות שטופלו עם טיפול, בנפרד בגליל. הופעת להקת חדה ייחודי (לגבי גודל, ללא פריימר דיימר או רקע מלאכותי הגברה) מאשר יחודיות של אמפליקון...

4. gDNA הליך Assay זיהום עם תבניות ה-RNA

הערה: לאחר הטיפול עם DNase, הרנ א מטוהרים המדגם נבדק על ידי תחל rDNA ספציפיים. בשל העיבוד של התכונה אינטרון דמוי של פירמת כאשר אזורים אלה משמשים עבור הגברה, אין קליטה הגברה שיזוהו בדגימות RNA DNA-חופשית. מבוסס על זה, אם אות הגברה של qPCR מאותר או להקה הג'ל agarose ציין את הגודל הצפוי (מוערך על ידי ניתוח סיליקו ), שזה צריך להיות עקב זיהום gDNA. הפעולות שבוצעו במקטע זה, דומים בסעיף 3, פרט לכך cDNA של כל הדגימות משמש כתבנית במקום gDNA.

  1. הכן תערובת בסיס על ידי ערבוב כל הרכיבים התגובה מלבד תבנית הרנ א בצינור PCR-תגובה. מאסטר mix שילוב עבור תגובה אחת: 5 µL SYBR מאסטר מיקס (2x), µL 0.3 פריימר (0.3 מיקרומטר כל של פריימר ואחורה mix), ולכוונן את העוצמה הסופי כדי µL 10 במים נטולי RNase. השתמש בערך 500 ng תבנית הרנ א 1 בנפח µL לניתוח.
  2. Aliquot תערובת הבסיס לתוך צלחת 96-ובכן אופטי. פיפטה RNA µL 1 כדי מכל קידוח ולאחר מכן לכסות את זה על ידי צלחת אופטי איטום הסרט. צנטריפוגה, במקום הצנטרפוגה.
    הערה: כוללים לפחות שני פקדים NTC, שני פקדים gDNA חיובי עבור כל וזמינותו. ביצוע מבחני כל שלוש שכפולי טכני.
  3. להפעיל את הבדיקה qPCR הצנטרפוגה תרמי בזמן אמת בתנאים הבאים: 10 דקות ב 95 ° C ואחריו 40 מחזורי 95 ° C עבור 15 s ו- 60 ° C עבור 1 מינימלית בצע חדרי קירור והקפאה-60 ° C חישול/ההרחבה צעד.
  4. לאחר הניתוח הגברה, נושא כל תגובות PCR ניתוח עקומת נמס עם מדידת קרינה פלואורסצנטית רציפה מ 55 ° C עד 95 מעלות צלזיוס. בדרך כלל, לאסוף נתונים נקודה אחת בכל מחזור על ידי עלייה stepwise של הטמפרטורה על ידי 0.5 ° C לכל מחזור.
  5. בדוק כל מוצרי ה-PCR על ידי פועל על 3% agarose ג'ל אלקטרופורזה.
    הערה: המראה של כל להקה או שיא ב התגובה NTC קשורה כנראה היווצרות פריימר דיימר זה נראה בדרך כלל בטמפרטורות נמוכות בעקומת ההיתוך, בעוד הנוכחות של כל להקה או שיא בדגימות ה-RNA היא התוצאה של זיהום gDNA. מומלץ לבדוק קודם כל דוגמאות RNA על ידי תחל מבוססי rDNA ולאחר מכן דגימות מזוהמים-DNA משמשים ליישומים במורד הזרם כגון cDNA סינתזה, ניתוח ביטוי גנטי, וכו '.

5. RT-PCR צעד cDNA סינתזה, qPCR ניתוח

  1. הפשרת DNase-מטופלים RNA, ריאגנטים סינתזה של cDNA בטמפרטורת החדר. לאחר מפשיר, ספין למטה נוגדנים. להוסיף 1 µg של RNA ו- µL 1 של Oligo (dT) 18 פריימר לתוך צינור נוקלאז-חופשית. להתאים את הנפח הכולל של 12 µL במים נטולי RNase, לערבב בעדינות ולאחר מכן לאחסן בקירור.
  2. להמיס משני מבנים של RNA תבנית על-ידי המקננת התגובה ב 65 מעלות צלזיוס במשך 5 דק ספין למטה. ומגניב המבחנה בקרח
  3. הכנת המיקס מאסטר התגובה (נפח סופי 20 µL עבור כל תגובה) כדלקמן: 1 µL של רוורס טרנסקריפטאז (200 U µL), µL 4 התגובה מאגר (5 x), µL 1 של RNase מעכב (20 U µL) ו- 2 µL של dNTP מיקס (10 מ מ). לערבב בעדינות, מגניב את המבחנה בקרח. הוסף 19 µL אל תוך הצינור מוכן המכיל את הרנ א.
  4. דגירה התגובה עבור 60 דקות ב 42 ° C ולאחר מכן דגירה-70 מעלות צלזיוס למשך 5 דקות לסיים פעילות רוורס טרנסקריפטאז. מקום לתגובות RT על הקרח והמשך ניתוח ביטוי גנטי על ידי הליך שגרתי qPCR (כפי שהוסבר בסעיף 3 ו- 4).

Representative Results

אנו מציעים את השימוש מבוססי rDNA תחל כדי לאמת את העדר של זיהום gDNA בדגימות ה-RNA של רקמת העלה. תרשים הזרימה של ניתוח qPCR זיהום gDNA assay מוצג באיור2. בפרוטוקול שהוצגו, שימשו שתי אסטרטגיות משלימים לעיצוב מבוסס rDNA פריימר: 1) תלויי מין תחל נבחרו מתוך ITSs רצפים, תחל 2) אוניברסלי נבחרו מתוך ITSs איגוף אזורים. עבור הוכחה הרעיון, אנחנו נועד תחל ספציפיות עבור כף-חתול שרועה, תחל אוניברסלי המבוסס על מיני דגניים, שניתנו בפרוטוקול. 5.8S תחל ואחורה נבחרו מבוסס על מוטיב זוג בסיסים 14 (bp) שנשמרת המציגה דמיון בין צמחים בעלי פרחים, bryophytes, מספר הזמנות של אצות ופטריות14. התכונות של תחל מעוצב מקבלים בטבלה מס ' 2. האוניברסליות של SSU, 5.8S, ו LSU פריימר שנבדקו על ידי BLASTn, פריימר הומולוגיה התוצאות מוצגים באיור 3 כלוגו מוטיב. רשימת המינים הכלולים הניתוח הומולוגיה, כמו גם את צבעי יסוד מתפצלת לכל מין מקבלים טבלה 1- תחל ירידה לפרטים היה סימון על-ידי פריימר-הפיצוץ. עבור מינים שבו רצף הגנום כולו זמין, המיקום כרומוזומליות של גנים rDNA הוערך. למשל, rDNA אורז סאטיבה ו תודרנית לבנה, הגנים ממוקמים על שני כרומוזומים שונים, ובשנת זיה מייז על שלושה כרומוזומים שונים.

qPCR אימות של תחל מבוססי rDNA בוצעה עם התכה עקומת ניתוח של amplicons ITS1, ITS2-האגף באמצעות DNA כתבנית. כפי שהוצג ב- איור 4 , איור 5, תחל ירידה לפרטים אושר השפעול ע י ההתבוננות לשיא חדה יחיד עם אין היווצרות פריימר דיימר מינים דגניים שונים כולל חיטת הלחם, מצויה שעורה, אורז sativa, ובשנת dicots של אספסת sativa, Cucumis sativus, טבק tabacum, תלתן alexandrinum, בקיה fabaו תודרנית לבנה. המבחן נוספת של המוצרים הגברה ע י גודל electrophoretic ההפרדה הראה להקה ייחודית. כצפוי, הלהקות נגזר דגימות ממינים שונים, מגוונים בגודלם (איור 6A , 6B). מעניין, השימוש תחל אוניברסלי שתוכננה במיוחד עבור שלושה מינים דגניים שימושיים לא רק עבור מינים אחרים דגניים, אבל גם עבור מינים אחרים כגון לבנה א, ועבור של פטריה endophytic viz. Piriformospora indica.

תוקפה של פריימר ספציפי מעוצב (ITS1) אושר גם ע י qPCR ב שרועה א באמצעות gDNA כתבנית. לשיא יחיד עם היווצרות פריימר דיימר לא נצפתה. באופן מפתיע, ומהצמיגים שרועה א ITS1 (כמו ומהצמיגים ספציפי) שנוצר להקה חדה יחיד לא רק בא שרועה, אלא גם עבור כל שאר המינים שנבדקו חוץ טבק tabacum , תלתן alexandrinum, אשר הפיק שתי להקות (איור 6C). וזמינותו זיהום gDNA בוצע על ידי ITS או ITS-איגוף תחל RNA כל הדגימות. ייצוג סכמטי של צלחת הגברה ב וזמינותו זיהום gDNA, הפרשנות של תוצאות מוצג איור7.

Figure 1
איור 1: התבנית הכללית של הארגון רצף rDNA האיקריוטים.
קטע rDNA האיקריוטים מכיל 17-18S (אדום), 5.8S (כחול), ו- 25-28S rRNA (ורוד). קפיציות משועתקים פנימי (ITS) מסומנים כמו קווים שחורים. 5´and 3´ לציין את כיוון ההדפסה של ה-dna. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 2
איור 2: זרימת עבודה עבור assay זיהום RT-qPCR ו- gDNA. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 3
איור 3: מוטיב הלוגו של SSU א, ב' 5.8S והומולוגיה פריימר LSU ג. עבור SSU, 5.8S, ו LSU תחל הלוגו מוטיב נבנה על ידי BLASTn מבוסס על 2,000 רשומות צמח ירוק (NCBI taxid המספר: 33090) עם ≤10 הערך האלקטרוני ניתוק-10. A-אדנין, T-תימין, G-גואנין, ציטוזין-C. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 4
איור 4: להמיס עקומת ניתוח של איגוף ITS1 אמפליקון מינים שונים.
אמפליקון הזה, מוגבר על ידי SSU ו- 5.8S-R תחל מכיל חלק של הרצף מאזור קידוד 17-18S, את רצף שלם של ITS1 ושל החלקי רצף 5.8S. מוצגות העקומות ההיתוך של amplicons שנוצר (ורוד), NTC (אדום) של חיטת הלחם, מצויה שעורה, אורז sativa, אספסת truncatula, Cucumis sativus, טבק tabacum, תלתן alexandrinum, בקיה faba, תודרנית לבנה, ו אינדיקה Piriformospora. הקו השטוח מודגש מציין את סף בסיסית. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 5
איור 5: להמיס עקומת ניתוח של איגוף ITS2 אמפליקון מינים שונים.
אמפליקון הזה נוצר על ידי שימוש 5.8S-F ו LSU תחל. אמפליקון תיאר מכיל רצפים של חלק 5.8 S על כל רצף ITS2, רצף חלקית של 25-28S. מוצגות העקומות ההיתוך של amplicons (ירוק), NTC (אדום) המופקים חיטת הלחם, מצויה שעורה, אורז sativa, אספסת truncatula, Cucumis sativus, טבק tabacum, תלתן alexandrinum, בקיה faba, תודרנית לבנה , Piriformospora indica. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 6
איור 6: Agarose ג'ל ניתוח של מוצר מבוסס מיני-rDNA PCR.
אמפליקון של ITS1-האגפים (), ITS2-האגפים (B), ו- ITS1 (ג) היו לרוץ על 3% agarose ג'ל. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 7
איור 7: דמוי-אינטרון תכונות של פירמת יכול להיחשב לעצב תחל אשר יכול לזהות זיהום gDNA.
כל שיא או להקה עם הגודל הצפוי בניתוח qPCR מצביעים על זיהום gDNA במדגם RNA. Unk: דוגמה לא ידועה, pos: בקרה חיובית, NTC: שליטה שאינם מתבנית. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

פריימר סוג מזהה Taxid מינים פריימר מתבדרת
SSU תודרנית 3701 kamchatica, לבנה , lyrata -
בקיה 3904 שעירה, אמריקנה, unijuga, amoenane, amurensis, craccamal, פסאודו-orobus, רחבת-גביע, חבוש יפני, ramuliflora ו faba
תלתן 3898 alexandrinum, montanum, resupinatum ו repens -
טבק 4085 tabacum, benthamiana, otophora, picilla, bigelovii, palmeri, tomentosiformis, tomentosa, digluta, kawakamii, clevelandii, nesophila, solanifolia, cordifolia, debneyi, arentsii, thyrsiflora, wigandioides, undulata, דביקה, noctiflora, petunioides, obtusifolia, miersii, pauciflora, לרכך, acuminata, linearis, מכונף, הבתה, חודש , suaveolens -
Cucumis 3655 anguria, מלו , sativus CGTAACAAGGTTTCCGTAGGKG
כף-חתול 110873 - פריימר לא נמצאו
אספסת 3877 sativa, lupulina, pamphylica, lunata, rostrate, plicata , truncatula -
אורז 4597 sativa, glumipatula, אפריקאי barthii rufipogon punctate, longistaminata, meridionalis, nivara, meridionalis , longistaminata -
חיטת 4564 הלחם, אורארטו , monococcum -
שעורה 4512 מצויה, bulbosum, התחממות עולמית, brevisubulatum , bogdanii -
LSU תודרנית 3701 petraea, לבנה , lyrata TGCTTAAACTCAGCGGGTAATC
בקיה 3904 sylvatica, tetrasperma, sativa, שעיר, sepium, זעיר-פרח, cracca, lathyroides, orobus, orobus, bithynica ו faba TGCTTAAATTCAGCGGGTAGCC
תלתן 3898 העמדת פנים, nigrescens, resupinatum, occidentale, subterraneum, strictum, ochroleucon, glomeratum, squamosum, משונץ , repens TGCTTAAATTCAGCGGGTAGCC
טבק 4085 tabacum, benthamiana, otophora, picilla, bigelovii, palmeri, tomentosiformis, tomentosa, digluta, kawakamii, clevelandii, nesophila, solanifolia, cordifolia, debneyi, arentsii, thyrsiflora, wigandioides, undulata, דביקה, noctiflora, petunioides, obtusifolia, miersii, pauciflora, לרכך, acuminata linearis, מכונף, הבתה ו- suaveolens TGCTTAAACTCAGCGGGTAGTC
Cucumis 3655 מלו, ritchiei , javanica TGCTTAAACTCAGCGGGTAGTC
כף-חתול 110873 lagopoide, pungens , שרועה TGCTTAAATTCAGCGGGTAATC
אספסת 3877 ruthenica, sativa, lupulina, ערביקה, מצויה ו קיצון TGCTTAAATTCAGCGGGTAGCC
pamphylica, lunata, rostrate , plicata TGCTTAAACTCAGCGGGTAGTC
אורז 4597 sativa, glumipatula, rufipogon, barthiial, אפריקאי, australiensis, המליסה, australiensis, ridleyi, malampuzhaensis, alta, nivara, rufipogon, meridionalis , longistaminata TGCTTAAACTCAGCGGGTAGTC
חיטת 4564 הלחם, spelta, דוחן אשון, הבר, petropavlovskyi, אורארטו , monococcum TGCTTAAACTCAGCGGGTAGTC
שעורה 4512 מצויה, bulbosum, murinum, secalinum, brevisubulatum , bogdanii TGCTTAAACTCAGCGGGTAGTC
פריימר מנוונת מוגדרת כמערכת סיסטמטי של נוקלאוטיד נומנקלטורה

טבלה 1: רשימת המינים נחשב עבור איסוף מבוסס rDNA תחל.
אתר קישור SSU לעומת אתר קישור LSU הראה הומולוגיה רצף גבוה מעל בהתחשב סוג.

אורך אמפליקון אזור הגברה רצף פריימר שם אמפליקון
332 - 405 bp רצף חלקית של SSU, רצף שלם של ITS1 ושל החלקי רצף 5.8S CGTAACAAGGTTTCCGTAGGTG SSU ITS1-האגפים
GGTTCACGGGATTCTGCAAT 5.8S-R
318 - 361 bp רצף חלקית של 5.8S, כל רצף של ITS2 ושל החלקי רצף LSU ATTGCAGAATCCCGTGAACC 5.8S-F ITS2-האגפים
TGCTTAAAYTCAGCGGGTAGYC LSU
100 - 200 bp ITS1 GGTATGGCGTCAAGGAACACT ITS1-F ITS1
ATAGCATCGCTGCAAGAGGT ITS1-R

טבלה 2: פריימר רצף.

Discussion

ניתוח ביטוי גנטי על ידי ה-PCR כמותי הוחל נרחב בשנים האחרונות. היתרון העיקרי של שיטה זו מהירה, חסכונית, אוטומטית הוא שלה תוצאה מדויקת. עם זאת, צובר יתרונות מיטבית מן היתרונות הללו דורש הבנה ברורה של ההתקנה של הפרמטרים המשמשים את הניסוי qPCR. כדי לקבל תוצאה אמינה בניתוח ביטוי גנים qPCR, זה הכרחי למנוע הגברה ספציפי שעולה מפני זיהום פריימר דיימר או gDNA RNA מדגם3,15. הוא צפוי כי טיפשה או רמות תעתיק רנ א תחת זיהום gDNA8. . כאן, המאפיינים הייחודיים של ג'ין rDNA נחשב עבור assay זיהום gDNA בדגימות ה-RNA.

מאפיינים בסיסיים של rDNA בשימוש פרוטוקול זה: גנים ribosomal מורכב פירמת שני, כלומר ITS1 ITS2, ואת הגנים קידוד שלושה rRNA, 17-18S, 5.8S, ו- 25-28S יחידת משנה12. האזורים ITS שני הם לא חלק רצף subunits ribosomal קידוד. הם מוסרים לפחות שלוש פעילויות אנזימטיות לעבד למבשר להבשיל rRNA: פעילות endonuclease הליקאז, אקסונוקלאז. כמו ribosomal RNA הוא עיבד בתור תעתיק polycistronic, מוצר ראשי המכיל את פירמת קיים בהחלט. העיבוד הוא מהר מאוד וזה מתרחש גרעינון, הסכום של קודמן לזיהוי מולקולות המכילות את ITS מתחת לגבול זיהוי של השיטה qPCR. לכן, כאשר ITS1 או ITS2 הם מוגבר על-ידי ITS איגוף תחל, הגברה לא ניתן להבחין בדגימות ה-RNA אלא אם קיים זיהום gDNA. מספר גנים rDNA הגנום של היצורים האיקריוטים הוערך לכלול עד אלף עותקים, אשר מסודרים מערכים יחיד או טנדם על כרומוזום11. ב פרוטוקול זה, אנו מציעים דרך חלופית, במקום NRT, כדי לזהות זיהום gDNA, אשר נמצא בשימוש בכל תגובה/assay.

יתרונות ומגבלות לגבי שיטות קיימות: NRT משמש בדרך כלל כדי לבדוק אם המדגם RNA מוכן הוא נקי או מזוהמים על-ידי gDNA. כיוון gDNA זיהום לא מופץ בצורה אחידה בין מדגמים שונים של RNA, תגובת רגישות gDNA מושפע באופן משמעותי הגנים מנותח, פקדים NRT נדרשים עבור כל זוג מדגם/assay7,15. זה יוסיף באופן משמעותי את עלות, העבודה בעת טיפול רבים דוגמאות בו זמנית3,9. שיטות אלטרנטיביות אחרות מתועדים בספרות כוללים שימוש אינטרון תחל ספציפי עבור הגילוי של gDNA, או תחל בעיצוב לאגף אינטרון או span של צומת אקסון-אקסון. המגבלות של שיטות אלה נובעות אי זמינות של שמידע רצף אינטרון ביאור לא שלם של אקסון אינטרון/מבנה, העדר אינטרונים בגנים או pseudogenes של עניין1,4,10 . בגלל האבולוציה, קיימים גנים rDNA משפחות גנים multigene הגדול יצורים עילאיים, שנשמרת מאוד. הם מאוד שופע הגנום, נוכח על כרומוזומים שונים13. לעומת גנים אחרים קידוד או nonconding, הגנים rDNA להראות מיטבית עבור זיהוי של זיהום gDNA. בניתוח השוואתי transcriptomic, נירמול הנתונים qPCR על ידי כיל rRNA אינה מומלצת עבור כמה בעיות, כגון הבדלים cDNA הכנה (תיקים עשויים לקרקע לעומת לקרקע hexamer אקראיים), הבדלים גדולים בשפע בין rRNA mRNA , ותוצאות להן שונים אשר עשויה ליצור מטעה10,16. עם זאת, הבעיות שהזכרנו רק הן יתרון עבור וזמינותו זיהום gDNA. לדוגמה, ביחס גבוה יותר שפע באתר מיקוד הגנום ולאחר לוקליזציה על כרומוזומים שונים, תחל מבוססי rDNA לשפר באופן משמעותי את הרגישות זיהוי של gDNA לעומת שיטות קיימות.

Versality של rDNA-מבוסס על אורגניזם אחר: rDNA גנים הם משפחה גן למד היטב שזוהתה רוב האורגניזמים. השיטה המוצעת מבוססת rDNA מייצג מערכת פשוטה, רגישה מאוד וכלכלי עבור מבחני זיהום gDNA אשר ניתן להתאים בקלות אורגניזמים אחרים האיקריוטים ו- prokaryotic (פרוטוקול 2 - 5). כמקרה, הראו כאן השירות של שיטה זו של מינים מסוימים Poceae (איור 4 , איור 5). צבעי יסוד בשימוש מראים שיעור גבוה של transferability למינים אחרים Poceae ' בזכות מבנה מאוד שנשמרת rDNA subunits בין המינים. בעיה זו הופך חשובה אף יותר כאשר מידע רצף גנומית מספיק אינה זמינה עבור עיצוב פריימר. לפיכך, ITS-איגוף תחל מיועד מין אחד יכול לשמש במינים קרובים. כמו כן, 5.8S-F/R תחל היו בחרה מבוסס על מוטיב שנשמרת המציגה דמיון גבוה צמחים פורחים רוב14. למרות תפוקה גבוהה רצף טכניקות לצמיתות להגדיל את המספר של הגנום הידועים, הביאור אקסון-אינטרון של רוב האורגניזמים לא הושלמה, אז זה לעתים קרובות לא ניתן לעצב תחל כדי להתפרס גבול אקסון-אקסון. השיטה שלנו מסביר איך מבוסס על rDNA תחל יכול להיות מיושם עבור וזמינותו זיהום gDNA בניתוח qPCR ושל אאוקריוטים פרוקריוטים עם המטרה של חיסול פקדים NRT יקר בכל שילוב assay/פריימר.

Disclosures

המחברים יש אין אינטרסים כלכליים מתחרים.

Acknowledgments

מחקר זה נתמך על ידי הגנטי, חקלאות ביוטכנולוגיה המכון של יזד (GABIT), מדעי החקלאות סארי משאבים טבעיים האוניברסיטה (SANRU). קבוצת המחקר ג'וניור גנומיקה מתח והאביוטיים מומן על ידי IZN (המרכז למחקר הצמח יבול, האלי (Saale), גרמניה. אנו מודים רונדה מאייר על קריאה ביקורתית של כתב היד.

Materials

Name Company Catalog Number Comments
Maxima SYBR Green / ROX qPCR Master Mix (2X) Thermo Scientific K0221
TissueLyser II QIAGEN 85300
RevertAid H Minus First Strand cDNA Synthesis Kit Thermo Scientific K1631
GeneRuler 100 bp Plus DNA Ladder Thermo Scientific SM0321
96 well WHT/CLR Bio-Rad HSP9601
Microseal B film Bio-Rad MJ-0558
Low tube strip CLR Bio-Rad TLS0801
Flat cap strips Bio-Rad TCS0803
NanoDrop 2000 Peqlab ND-2000
RNaseZAP Ambion 9780
Centrifuge Eppendorf 5810 R
Agilent RNA 6000 Nano Kit Agilent Technologies 5067-1511
2100 Electrophoresis Bioanalyzer Agilent Technologies G2939AA
RNase A, DNase and Protease-free Thermo Scientific EN0531
DNase I, RNase-free Thermo Scientific EN0523
TRIZOL Reagent Ambion 15596026
CFX96 Touch Real-Time PCR Detection System BIO RAD 1855195
PCR tube, 0.2 mL, RNase-free Stratagene Z376426
Guanidine thiocyanate for molecular biology Sigma-Aldrich G9277
Agarose - Nucleic Acid Electrophoresis Sigma-Aldrich A9414
Boric Acid for molecular biology AppliChem A2940
bromophenol blue AppliChem A2331
ethidium bromide AppliChem A1151
Gel documentation system BIO RAD Gel Doc 2000

DOWNLOAD MATERIALS LIST

References

  1. Bustin, S. A., Nolan, T. Pitfalls of quantitative real-time reverse-transcription polymerase chain reaction. J Biomol Tech. 15, (3), 155-166 (2004).
  2. Gutierrez, L., Mauriat, M., Pelloux, J., Bellini, C., Van Wuytswinkel, O. Towards a systematic validation of references in real-time RT-PCR. Plant Cell. 20, (7), 1734-1735 (2008).
  3. Hashemi, S. H., Nematzadeh, G., Ahmadian, G., Yamchi, A., Kuhlmann, M. Identification and validation of Aeluropus littoralis reference genes for Quantitative Real-Time PCR Normalization. J Biol Res (Thessalon). 23, (1), 18 (2016).
  4. Bustin, S. A. Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J. Mol. Endocrinol. 25, (2), 169-193 (2000).
  5. Andersen, C. L., Jensen, J. L., Orntoft, T. F. Normalization of real-time quantitative reverse transcription-PCR data: a model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 64, (15), 5245-5250 (2004).
  6. Bustin, S. A., et al. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem. 55, (4), 611-622 (2009).
  7. Laurell, H., et al. Correction of RT-qPCR data for genomic DNA-derived signals with ValidPrime. Nucleic Acids Res. 40, (7), e51 (2012).
  8. Galiveti, C. R., Rozhdestvensky, T. S., Brosius, J., Lehrach, H., Konthur, Z. Application of housekeeping npcRNAs for quantitative expression analysis of human transcriptome by real-time PCR. RNA. 16, (2), 450-461 (2010).
  9. Laurell, H., et al. Correction of RT-qPCR data for genomic DNA-derived signals with ValidPrime. Nucleic Acids Res. 40, e51 (2012).
  10. Caldana, C., Scheible, W. R., Mueller-Roeber, B., Ruzicic, S. A quantitative RT-PCR platform for high-throughput expression profiling of 2500 rice transcription factors. Plant Methods. 3, (1), 7 (2007).
  11. Lawrence, R. J., Pikaard, C. S. Perspectives Chromatin Turn Ons and Turn Offs of Ribosomal RNA Genes. Cell Cycle. 3, (7), 880 (2004).
  12. Boisvert, F. M., van Koningsbruggen, S., Navascues, J., Lamond, A. I. The multifunctional nucleolus. Nat Rev Mol Cell Biol. 8, (7), 574-585 (2007).
  13. Alvarez, I., Wendel, J. F. Ribosomal ITS sequences and plant phylogenetic inference. Mol Phylogenet Evol. 29, (3), 417-434 (2003).
  14. Jobes, D. V., Thien, L. B. A conserved motif in the 5.8 S ribosomal RNA (rRNA) gene is a useful diagnostic marker for plant internal transcribed spacer (ITS) sequences. Plant Mol Biol Report. 15, (4), 326-334 (1997).
  15. Padhi, B. K., Singh, M., Huang, N., Pelletier, G. A PCR-based approach to assess genomic DNA contamination in RNA: Application to rat RNA samples. Anal Biochem. 494, 49-51 (2016).
  16. Dheda, K., et al. Validation of housekeeping genes for normalizing RNA expression in real-time PCR. Biotechniques. 37, (1), 112-114 (2004).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics