Bedömning av DNA kontaminering i RNA-prover baserat på Ribosomal DNA

Genetics
 

Summary

Här presenterar vi ett protokoll för att spåra genomisk DNA (gDNA) kontaminering i RNA-prover. Den presenterade metoden använder tredjeparts primers som är specifika för regionen inre transkriberas spacer (ITS) ribosomal DNA (rDNA) gener. Metoden passar för tillförlitlig och känslig detektion av DNA kontaminering i de flesta Eukaryoter och prokaryoter.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Hashemipetroudi, S. H., Nematzadeh, G., Ahmadian, G., Yamchi, A., Kuhlmann, M. Assessment of DNA Contamination in RNA Samples Based on Ribosomal DNA. J. Vis. Exp. (131), e55451, doi:10.3791/55451 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

En metod som i stor utsträckning används för kvantifiering av genförändringar uttryck och avskrift sammansättning är omvänd-Transkription kvantitativ realtids-PCR (RT-qPCR). Det ger korrekt, känslig, tillförlitliga och reproducerbara resultat. Flera faktorer kan påverka känsligheten och specificiteten för RT-qPCR. Kvarstående genomiskt DNA (gDNA) kontaminerande RNA prover är en av dem. I gen uttryck analys, icke-specifik amplifiering på grund av gDNA kontaminering kommer överskatta överflödet av avskrift nivåer och kan påverka RTqPCR resultatet. I allmänhet gDNA detekteras av qRT-PCR använder primer par glödgning till intergenic regioner eller en intron av genen av intresse. Tyvärr, intron/exon anteckningar är ännu inte kända för alla gener från ryggradsdjur, bakterier, protister, svampar, växter och ryggradslösa metazoan arter.

Här presenterar vi ett protokoll för detektion av gDNA kontaminering i RNA prover med hjälp av ribosomal DNA (rDNA)-baserade primers. Metoden är baserad på de unika funktionerna i rDNA: sin multigene natur, mycket sekvenser och hög frekvens i genomet. Också som en fallstudie, en unik uppsättning primers utvecklats baserat på ribosomal DNA (rDNA) i familjen Poaceae bevarade regionen. Dessa primer par universalitet testades av smälta kurva analys och agaros gelelektrofores. Även om vår metod förklarar hur rDNA-baserade primers kan tillämpas för gDNA kontaminering analysen i familjen Poaceae, det enkelt skulle kunna användas till andra prokaryoter och Eukaryoter arter

Introduction

Det är viktigt att förstå de komplexa molekylära mekanismerna som är involverade i biologiska händelser1att utforska Transkriptionsreglering av intressant gen uppsättningar eller signalering nätverk. QPCR analys är för närvarande mest använda metoden för gen uttryck-studier som kan rikta antingen DNA (arvsmassan) eller RNA (transkriptom) som tillåter methylome och transkriptom analys, respektive. Omvänd Transkription (RT) följt av qPCR används ofta för transkriptom analys som mäter gen uttryck nivåer i olika områden av biologisk forskning2. Jämfört med andra metoder såsom traditionella norra hybridisering, vävnad specifika upptäckt via in situ hybridisering ribonunkleas skydd analyser (RPA) och semi-RT-PCR, riktighet, bekvämlighet, hastighet och brett dynamiskt omfång av qPCR-baserade analyser finns mycket anmärkningsvärd3,4. I området i närheten finns det flera viktiga faktorer som måste beaktas för en tillförlitlig kvantifiering av budbärar-RNA (mRNA), inklusive kvalitet och kvantitet av RNA som utgångsmaterial. Dessutom måste icke-specifik amplifiering, effektiviteten i RT-qPCR och PCR effektivitet anses5,6.

Förekomsten av gDNA var ett inneboende problem under RNA-extraktion berodde delvis liknande fysikaliska och kemiska egenskaper av DNA och RNA7. På grund av sekvens identitet gDNA och kompletterande DNA (cDNA) härrör från proverna som mRNA, kan icke-specifik amplifiering förekomma, som kommer att påverka riktigheten i RT-qPCR resultat. Den återstående gDNA kommer att leda till överskattning av överflödet av rikta mRNA i gen uttryck analys8.

I princip uppstår det icke-specifika kopian mestadels primer-dimer bildandet eller ospecifik bakgrund förstärkning på grund av gDNA, vilka båda kan bedömas med hjälp av lämpliga kontrollprover. Sådana prover är ingen mall kontroll (NTC) och ingen omvänt transkriptas kontroll (NRT), respektive. Eftersom nivåerna av gDNA kontaminering i de prover som undersöks är olika och känslighet mot gDNA skiljer sig mycket mellan de gener analyseras, krävs NRT kontrollerna för varje prov/test par. Även om detta ökar avsevärt kostnad och arbete i RT-qPCR profilering studier, är dessa kontroller nödvändiga7,9.

Alternativa metoder behandlar gDNA kontaminering inkluderar användning av primer par glödgning till intergenic regioner eller en intron genen av intresse10, och användningen av grundfärger som antingen flankerar en stor intron eller span ett exon-exon junction, dvs. glödgning platserna är frånvarande i den mogna mRNA-sekvens1,4. Dock är intron/exon anteckningar för alla gener från många ryggradsdjur, bakterier, protister, svampar, växter och ryggradslösa metazoan arter kända ännu. Dessutom har många eukaryota organismer pseudogener härrör från dubbelarbete händelser. Dessutom garanterar inte primer design över introner icke-amplifiering av gDNA. Som kromatinet tillgänglighet av genomisk regioner till DNAS jag varierar, det rekommenderas att utforma olika primer par inriktning olika kromosomer10.

Genomen hos eukaryota organismer kan omfatta upp till tusen kopior av rDNA gener som kodar ribosomal subenheter behövs för bildningen av ribosomer. Dessa rDNA gener är ofta organiserade i enkel- eller tandem upprepa matriser11. Polycistronic rRNAs (figur 1) inklusive stora subenheten (LSU) och liten subunit (SSU) transkriberas av RNA-polymeras jag (RNA pol jag). De resulterande pre-rRNAs bearbetas vidare genom att eliminera två inre transkriberas spacer regionerna ITS1 och ITS2. Som färdiga produkter, tre mogna rRNAs, 17-18S rRNA (SSU), 5.8S och 25-28S rRNA (LSU) är genererade12. rDNA gener är typiska tekniker av en multigene familj med mycket sekvenser. De uppträder med en hög frekvens i genomet och är potentiellt närvarande vid mer än en kromosomala läge13. Behandling av rRNA och nedbrytningen av transkriberas distanserna är en snabb process i nucleolus. På grund av den höga graden av upprepning, är förhållandet mellan genomisk kopienummer och påvisbara obearbetade RNA premolecules lägre jämfört med de låg-kopia intron sekvenser och Osplitsat prekursorer. Dessa funktioner gör rDNA gener väl lämpad för tillförlitlig och mycket känslig detektion av gDNA kontaminering i de flesta Eukaryoter och prokaryoter3.

Här beskrivs en roman för att upptäcka gDNA kontaminering i RNA prover. För gDNA analyser i flera Poaceae arter presenteras en uppsättning universella primers baserat på sekvensen rDNA bevarad. Den specificitet och universalitet föreslagna primers testades av smälta kurva analys med DNA som mall. Våra protokoll gäller inte bara för gräs, men kan också enkelt anpassas till andra eukaryota och prokaryota arter.

Protocol

Obs: Alla vävnader kan användas.

1. nukleinsyra utvinning

  1. Sätta 100 mg av vävnadsprover i en 2,0 mL-rör, tillsätt två 5 mm rostfritt stål pärlor och homogenisera vävnaden på 25-30 Hz för 30 s (homogenisering varaktighet och frekvens beroende på vävnadstyp) för både RNA och DNA.
  2. Isolera total-RNA enligt tillverkarens anvisningar.
  3. Isolera totala DNA enligt tillverkarens anvisningar.
  4. Kontrollera renhet och kvantiteten av de RNA-proverna genom att mäta absorbansen vid 260 och 280 nm.
  5. Kontrollera renhet och kvantiteten av de DNA-proverna genom att mäta absorbansen vid 260 och 280 nm.
    Obs: Medan nukleinsyror absorbera ljus med en våglängd av 260 nm (A260), absorbans ljus av våglängden 280 (A280) kan användas för att kvantifiera mängden proteiner och fenoler finns i provet. Förhållandet mellan A260/A280 nm kan därför användas för att utvärdera renheten av DNA och RNA extraherade från ett urval. A260/280 värden i spänna av ≥1.8 och > 2,0 anses generellt vara ”rena” för DNA och RNA, respektive. Lägre A260/280-värden kan tyda på förorening av protein eller organiska kemikalier.
  6. Testa kvaliteten på DNA genom att köra en 0,7% agaros gelelektrofores. Gelen och kör i 1 x TRIS-boric EDTA-buffert (TBE: 89 mM Tris, 89 mM borsyra och 2 mM EDTA) vid 100 V för 30 min. hög kvalitet gDNA visas som en skarp, hög molekylvikt (HMW) band med ingen cellprov i spänna av låg molekylvikt (LMW) molekyler.
  7. Kontrollera isolerade RNA för kvantitet, renhet och integritet under denatureringen villkor genom en guanidin kaliumtiocyanat (GTC) agaros gel-elektrofores eller kapillärelektrofores chip, enligt tillverkarens instruktioner.
    1. Förbereda GTC gelen genom att lägga till en standard 1 x TBE 1% agarosgel 5 mM GTC efter kylning ägarn till 60 ° C.
      Obs: GTC är giftiga, så avstå från det i ett dragskåp och bära lämplig personlig skyddsutrustning.
    2. Förbereda RNA denatureringen lastning buffert: 95% formamid, 10 mM EDTA pH 8,0, 0,1% bromophenol blå, 0,1% xylen cyanole och 10 µL etidiumbromid.
      Obs: Formamid och etidiumbromid metylbromid är giftiga och bör avskaffas i dragskåp.
    3. Laddar 1-5 µg totalt RNA i RNA denatureringen lastning buffert, värme blandningen för 5 min vid 70 ° C, placera den på isen innan du laddar det på en gel, och sedan separera RNA på GTC gel vid 100 V för 45 min. belastning DNA eller RNA molekylvikt markör som standard tillsammans med det RNA-provet.
    4. Fläcken gelerna med etidiumbromid och visualisera de band som använder image capture system under ultraviolett ljus. I Eukaryoter visar intakt total-RNA kör vid denatureringen villkor minst två skarpa och tydliga rRNA band (28S och 18S) med förhållandet 2:1 intensitet.
  8. Ta bort spår av gDNA genom behandling med DNAS (DNAS jag RNase-fri). Lägga till ett RNase-fri rör i 10 µL totala volym: 0,1 - 1 µg totalt RNA, en enhet av DNAS jag och 1 µL 10 x reaktion buffert med MgCl2. Inkubera blandningen i 30 minuter vid 37 ° C. Avsluta reaktionen genom att lägga till 1 µL 50 mM EDTA och inkubation vid 65 ° C i 10 min.
  9. Ta bort spår av RNA från gDNA extrakt med DNAS gratis RNase A, enligt tillverkarens protokollet. Tillsätt 5 µL RNase 10 mg/mL till totala DNA och inkubera vid 37 ° C under 1 h. Store RNA och DNA-extrakt vid-80 ° C.

2. primer Design från rDNA Region för gDNA Assay

Obs: RDNA fullängds sekvensen innehåller två regioner (ITS1 och ITS2), som tas bort i den mogna rRNA-molekylen av en rad endonucleolytic Klyvningar och sedan försämras (figur 1).

  1. Hämta av rDNA nukleotidsekvensen från NCBI (http://www.ncbi.nlm.nih.gov) för arterna av intresse. Det bästa sökordet för att söka i databasen är ”inre transkriberas spacer”.
  2. Inmatning av mål nukleotidsekvensen i en BLASTn-sökning för att hitta inre transkriberas spacer regioner (intelligenta transportsystem), SSU och LSU bevarad regioner.
  3. Välj grundfärg att antingen flankerar en ITSs sekvens eller att förstärka ITSs sekvenser som inte finns i den mogna rRNA.
    1. Utforma primers flankerande ITS1 eller ITS2 sekvenser: justera de konserverade regionerna från olika arter av ClustalW. Design primers som är specifika för dess kompletterande region efter taxa specifika/cross-arter analys med AlleleID programvara. De två primern par ljudförstärkande SSU-5.8S och 5.8S-LSU amplikoner kan utformas baserat på kompletterande regionerna ITS1 och ITS2, respektive. Eftersom dessa amplikoner spänner över regionen ITS, amplikon längden ökas för minst 300 bp i amplikoner från gDNA. Denna ökning minskar känsligheten.
      1. Flankerande ITS1: Välj SSU och 5.8S rRNA sekvens. Valda grundfärger för gräs är: SSU, SF: CGTAACAAGGTTTCCGTAGGTG, R: GGTTCACGGGATTCTGCAAT. Denna primer par (SF: framåt och R: bakåt) förstärker SSU delvis regionen, den fullängds av ITS1 och 5.8S delvis regionen rDNA.
      2. Flankerande ITS2: Välj 5.8S och LSU sekvens. Valda grundfärger för gräs är: F: ATTGCAGAATCCCGTGAACC LSU samförstånd sekvens, LR: TGCTTAAAYTCAGCGGGTAGYC. Denna primer par förstärker 5.8S delvis regionen, den fullängds av ITS2, och delvis regionen av LSU (figur 1).
        Obs: När det gäller primer design baserad på ITSs flankerande regionen, SSU mycket områdena, 5.8S och LSU identifierades. Framåt och bakåt primers av 5.8S rRNA utformades utifrån bevarade motiv i blommande växter14. Framåt och bakåt primers var designat baserat på SSU och LSU bevaras regioner i Poaceae, respektive. Divergens i SSU och LSU primers för varje art anges i tabell 1.
    2. Primers förstärka en ITSs sekvens: I detta protokoll, design ITS1 grundfärg baserad på Aeluropus dess sekvens (NCBI taxid nummer: 110873). För primers, använda: fram: GGTATGGCGTCAAGGAACACT, omvänd: ATAGCATCGCTGCAAGAGGT. Enligt den amplikoner som genereras av den primer par i silico, storlek bör variera från 60 till 200 bp. Detta är också den rekommenderade storleken för qPCR-analys.
  4. Plocka primers och betrakta dessa rekommendationer: GC innehåll: 40-60%, primer längd: 18-23 bas, PCR-produkt längd: 60-160 bp (speciellt för dess primer), smälttemperatur (Tm): 60 ° C, den slutliga Tm för både grundfärger skiljer sig inte mer än 5 ° C och prim Ers är inte komplement till själva eller partner primers.
  5. Kontrollera primer specificitet och antalet exemplar. Utföra i-silico analys av vald grundfärg sekvensen av primer-blast program (https://www.ncbi.nlm.nih.gov/tools/primer-blast/).
    1. Öppna Primer-BLAST inlämning sidan. Ange både primer sekvenser i avsnittet primer parametrar i formuläret. I primer par specificitet kontrollera parametrar avsnitt, ange en organism (eller organismen gruppnamn) och välj genomet databas. Dessa inställningar ger specificitet information om målet sekvens och primer parametrar inklusive produkt längd, position på kromosom, och antal kopior.

3. utföra qPCR steg för validering av rDNA-baserade Primers med DNA-mallar

Obs: Funktionen av designade primers ska valideras genom att utföra qPCR med gDNA som en mall. För att utföra flera parallella reaktioner och minska antalet pipettering fel, rekommenderas utarbetandet av en master mix. För en master mix, förbereda en volym som motsvarar det totala antalet reaktionsblandning plus ~ 10%.

  1. Förbered en huvudmixen genom att blanda alla reaktion komponenter utom mallen DNA i en PCR-reaktion tub. Upscale som behövs från en reaktion för att förbereda Master mix: 5 µL SYBR green (SYBR) master mix (2 x), 0,3 µL primer (0,3 µM varje framåt och bakåt primer) och justera den slutliga volymen till 10 µL med RNase-gratis vatten. Använda cirka ≤200 ng i 1 µL mall gDNA för analys.
    Obs: Tina, montera och hålla alla reagenser, komponenter och reaktionsmixar på is.
  2. Alikvot Master mix till en optisk plattan med 96 brunnar. Pipettera 1 µL av gDNA till varje brunn och sedan täcka den med optisk plattan tätning film. Snurra och placera i apparat.
  3. Kör den qPCR-analysen på en realtid termocykel under följande förhållanden: 10 min vid 95 ° C följt av 40 cykler av 95 ° C för 15 s och 60 ° C i 1 min. utför datainsamling på tillägget för 60 ° C glödgning/steg.
  4. Efter förstärkning ingreppet, omfattas alla PCR reaktioner på en smältande kurva analys med kontinuerlig fluorescens mätning från 55 ° C till 95 ° C. Typiskt, samla en datapunkt varje cykel genom en stegvis ökning av temperaturen av 0,5 ° C per cykel.
    Obs: Inkludera minst 2 icke-mall kontroller (NTC) för varje primer par huvudmixen. Utföra alla analyser i minst tre replikeringar.
  5. Bekräfta primer specificitet via smälta kurva analys. Analysera kurvor med den enda tröskelvärde cykeln och subtraheras kurvanpassning metod.
    Obs: Uppkomsten av en skarp individuella topp indikerar en enhetlig enskilda amplikon. Primer dimer produkter kan visas som enskilda toppar vid lägre temperaturer.
  6. Validera storleken på varje Restriktionsenzymanalys av agaros gelelektrofores.
    1. Förbered en 3% agarosgel genom att blanda 3 g agaros med 100 mL TBE buffert (TBE: 89 mM Tris, 89 mM borsyra och 2 mM EDTA).
    2. Blanda 5-10 µL av PCR-produkten med DNA och 1-2 µL av 6 x lastning buffert. Ladda PCR-produkten tillsammans med en DNA-stege på 3% agarosgel. Utföra en elektroforetisk separation i 1 x TRIS-boric EDTA-buffert vid 100 V för 45 min.
    3. Fläcken gelerna med etidiumbromid eller någon annan intercalating agent och visualisera de band som använder image capture system under ultraviolett ljus.
      Obs: DNA infoga agenter (t.ex., etidiumbromid) är cancerogenic och bör hanteras varsamt och separat expedieras. Uppkomsten av ett unikt skarpa band (med avseende på storlek och utan primer-dimer eller konstgjorda bakgrund amplifiering) bekräftar ospädd specificitet.

4. gDNA kontaminering analysförfarande med RNA-mallar

Obs: Efter behandling med DNAS, renat RNA provet testas av rDNA-specifika primrar. På grund av bearbetning av funktionen intron-liknande i ITSs när dessa regioner används för förstärkning, bör ingen amplifiering signal upptäckas i DNA-fria RNA-prover. Baserat på detta, om en förstärkning signal i qPCR upptäcks eller ett band i agarosgel observerats med den förväntade storleken (uppskattningsvis i silico analys), detta bör bero på gDNA kontaminering. Stegen utförs i det här avsnittet är liknande till avsnitt 3, förutom att cDNA av alla prover används som mall i stället för gDNA.

  1. Förbered en huvudmixen genom att blanda alla reaktion komponenter utom RNA mall i en PCR-reaktion tub. Master mix kombination för en reaktion: 5 µL SYBR master mix (2 x), 0,3 µL primer (0,3 µM varje framåt och bakåt primer Mix) och justera den slutliga volymen till 10 µL med RNase-gratis vatten. Använda cirka 500 ng mall RNA i 1 µL volym för analys.
  2. Alikvot huvudmixen till en optisk plattan med 96 brunnar. Pipettera 1 µL RNA till varje brunn, och sedan täcka den av optiska plate tätning film. Centrifugera och plats i apparat.
    Obs: Inkludera minst två NTC-kontroller och två positiva gDNA kontroller för varje analys. Utföra alla analyser i tre tekniska replikeringar.
  3. Kör den qPCR-analysen på en realtid termocykel under följande förhållanden: 10 min vid 95 ° C följt av 40 cykler av 95 ° C för 15 s och 60 ° C i 1 min. utför datainsamling på tillägget för 60 ° C glödgning/steg.
  4. Efter förstärkning ingreppet, omfattas alla PCR reaktioner på en smältande kurva analys med kontinuerlig fluorescens mätning från 55 ° C till 95 ° C. Vanligtvis, samla en datapunkt varje cykel genom en stegvis ökning av temperaturen av 0,5 ° C per cykel.
  5. Kontrollera alla PCR-produkter genom att köra på 3% agaros gel elektrofores.
    Obs: Utseendet på något band eller topp i NTC reaktionen är förmodligen relaterad till primer-dimer formation som ses vanligen vid låga temperaturer i smältande kurvan, medan förekomsten av något band eller topp i RNA-prover är resultatet av gDNA kontaminering. Det rekommenderas att först testa alla RNA-prover av rDNA-baserade primers och sedan icke-DNA kontaminerade prover används för nedströms tillämpningar såsom cDNA syntes, gen uttryck analys, etc.

5. RT-PCR steg för cDNA syntes och qPCR analys

  1. Tina DNAS-behandlade RNA och cDNA syntes reagenserna i rumstemperatur. Efter upptining, snurra ner reagenserna. Tillsätt 1 µg av RNA och 1 µL Oligo (dT) 18 primer i ett nuclease-fri rör. Justera den totala volymen av 12 µL med RNase-gratis vatten, blanda försiktigt och sedan lagra på is.
  2. Smälta sekundära strukturer av RNA mall genom ruvning reaktionen vid 65 ° C i 5 min. snurra ner och cool injektionsflaskan på is.
  3. Förbereda reaktion huvudmixen (slutlig volym 20 µL för varje reaktion) enligt följande: 1 µL av omvänt transkriptas (200 U/µL), 4 µL av reaktion buffert (5 x), 1 µL RNase inhibitor (20 U/µL) och 2 µL av dNTP Mix (10 mM). Blanda försiktigt och cool injektionsflaskan på is. Tillsätt 19 µL i beredda röret som innehåller RNA.
  4. Inkubera reaktionen för 60 min vid 42 ° C och sedan Inkubera vid 70 ° C i 5 min till avsluta omvänt transkriptas verksamhet. Placera RT reaktionerna på is och fortsätta till gen uttryck analys av rutinmässiga qPCR förfarande (som förklaras i avsnitt 3 och 4).

Representative Results

Vi föreslår användning av rDNA-baserade primers att validera frånvaro av gDNA kontaminering i RNA prover av bladvävnad. Flödesschemat av qPCR-analys och gDNA kontaminering analysen visas i figur 2. I protokollet presenteras två kompletterande strategier användes för rDNA-baserad primer design: 1) artspecifik primers valdes från ITSs sekvenser och 2) universella primers valdes från ITSs flankerande regioner. Proof-of-concept utformat vi specifikt för Aeluropus littoralis, primers och universella primers baserat på Poaceae arter, som anges i protokollet. 5.8S framåt och bakåt primers valdes utifrån bevarade 14 baspar (bp) motiv som visar likheten mellan blommande växter, bryofyter och flera beställningar av alger och svampar14. Funktioner i designade primers ges i tabell 2. Allmängiltighet av SSU, 5.8S, och LSU primer kontrollerades av BLASTn och primer homologi resultaten presenteras i figur 3 motiv logo. Förteckningen över arter som ingår i homologi analysen samt olika primers för varje art anges i tabell 1. Primer specificitet var kontrollera av Primer-BLAST. För arter där det finns hela genomet sekvensen, uppskattades den kromosomala läge rDNA gener. Exempelvis är Oryza sativa och Arabidopsis thaliana, rDNA gener belägna på två olika kromosomer och i Zea mays på tre olika kromosomer.

qPCR validering av rDNA-baserade primers utfördes med smältande kurva analys av ITS1 och ITS2-flank amplikoner med DNA som mall. Som presenteras i figur 4 och figur 5, primer specificitet bekräftades experimentellt av observationen av en enda skarp topp med ingen primer-dimer bildning i olika Poaceae arter, inklusive Triticum aestivum, Hordeum vulgare, Oryza sativa, och i dicots Medicago sativa, Cucumis sativus, Nicotiana tabacum, Trifolium alexandrinum, Vicia fabaoch Arabidopsis thaliana. Det ytterligare testet av förstärkning produkter genom elektroforesisk storlek separation visade ett unikt band. Som förväntat, banden härrör från prover av olika arter som varierade i storlek (figur 6A och 6B). Intressant, användningen av de universella primers som utformats speciellt för de tre Poaceae-arterna är inte bara användbar för andra Poaceae arter, men också andra växtarter såsom A. thaliana, och en endophytic svampar viz. Piriformospora indica.

Giltigheten av utformade specifika primer (ITS1) bekräftades också av qPCR i A. littoralis med gDNA som mall. En enkel topp med ingen primer-dimer bildning observerades. Överraskande, A. littoralis ITS1 primer (som den specifika primern) genereras en enda vassa band inte bara i A. littoralis, utan också för alla andra arter som testades utom Nicotiana tabacum och Trifolium alexandrinum, som producerade två band (figur 6 c). GDNA kontaminering analysen utfördes av antingen ITS eller ITS-flankerande grundfärger i alla RNA-prover. En schematisk representation av förstärkning plattan i gDNA kontaminering analys och tolkning av resultat presenteras i figur 7.

Figure 1
Figur 1: Det allmänna mönstret av eukaryota rDNA sekvens organisation.
Eukaryota rDNA segmentet innehåller 17-18S (röd), 5.8S (blå) och 25-28S rRNA (rosa). De interna transkriberas distanserna (ITS) indikeras som svarta linjer. 5´and 3´ ange orienteringen av DNA-molekylen. Klicka här för att se en större version av denna siffra.

Figure 2
Figur 2: arbetsflöde för en RT-qPCR och gDNA kontaminering analys. Klicka här för att se en större version av denna siffra.

Figure 3
Figur 3: motiv logotypen för A. SSU, B. 5.8S och C. LSU primer homologi. För SSU, 5.8S, och LSU primers, motiv logotypen byggdes av BLASTn baserat på 2.000 grön växt records (NCBI taxid nummer: 33090) med en cut-off e-värde ≤ 10-10. A-adenin, T-tymin, G-guanin, C-cytosin. Klicka här för att se en större version av denna siffra.

Figure 4
Figur 4: Smälta kurva analys av ITS1-flankerande amplikon i olika arter.
Detta amplikon, förstärks av SSU och 5.8S-R primers, innehåller en del av sekvensen från regionen 17-18S kodning, hela sekvensen av ITS1 och delsekvens av 5.8S. Visas är smältande kurvorna amplikoner genereras (rosa) och NTC (röd) från Triticum aestivum, Hordeum vulgare, Oryza sativa, Medicago truncatula, Cucumis sativus, Nicotiana tabacum, Trifolium alexandrinum, Vicia faba, Arabidopsis thaliana, och Piriformospora indica. Den platta fet linjen anger tröskelvärdet baslinjen. Klicka här för att se en större version av denna siffra.

Figure 5
Figur 5: Smälta kurva analys av ITS2-flankerande amplikon i olika arter.
Detta amplikon genereras genom användning av 5.8S-F och LSU primers. Den beskrivna Amplikonen innehåller sekvenser av del av 5,8 S, hela sekvensen av ITS2 och delsekvens av 25-28S. Visas är smältande kurvorna amplikoner (grön) och NTC (röd) genereras från Triticum aestivum, Hordeum vulgare, Oryza sativa, Medicago truncatula, Cucumis sativus, Nicotiana tabacum, Trifolium alexandrinum, Vicia faba, Arabidopsis thaliana och Piriformospora indica. Klicka här för att se en större version av denna siffra.

Figure 6
Figur 6: Agaros gel analys av rDNA-baserade PCR-produkten.
Kopian av ITS1-flanker (A), ITS2-flanker (B), och ITS1 (C) kördes på 3% agarosgel. Klicka här för att se en större version av denna siffra.

Figure 7
Figur 7: Intron-liknande funktioner av ITSs kan anses att utforma primers som kan upptäcka gDNA kontaminering.
Alla topp eller band med den förväntade storleken i qPCR-analys indikerar gDNA kontaminering i RNA provet. Unk: okänt prov, pos: positiv kontroll, NTC: icke-mall kontroll. Klicka här för att se en större version av denna siffra.

Primer Släkte Taxid ID Arter Divergerande primer
SSU Arabidopsis 3701 kamchatica, thaliana och lyrata -
Vicia 3904 villosa, americana, unijuga, amoenane, amurensis, craccamal, pseudo-orobus, multicaulis, japonica, ramuliflora och faba
Trifolium 3898 alexandrinum, montanum, resupinatum och repens -
Nicotiana 4085 tabacum, benthamiana, otophora, picilla, bigelovii, palmeri, tomentosiformis, tomentosa, digluta, kawakamii, clevelandii, nesophila, solanifolia, cordifolia, debneyi, arentsii, thyrsiflora, wigandioides, undulata, glutinosa, noctiflora, petunioides, obtusifolia, miersii, pauciflora, dämpa, acuminata, linearis, alata, sylvestris rustica och suaveolens -
Cucumis 3655 anguria, melo och sativus CGTAACAAGGTTTCCGTAGGKG
Aeluropus 110873 - Ingen primer som hittade
Medicago 3877 sativa, lupulina, pamphylica, lunata, rostrate, plicata och truncatula -
Oryza 4597 sativa, glumipatula, rufipogon barthii glaberrima punktuell, longistaminata, meridionalis, nivara, meridionalis och longistaminata -
Triticum 4564 aestivum, urartu och monococcum -
Hordeum 4512 vulgare, bulbosum, marinum, brevisubulatum och bogdanii -
LSU Arabidopsis 3701 petraea, thaliana och lyrata TGCTTAAACTCAGCGGGTAATC
Vicia 3904 sylvatica, tetrasperma, sativa, lurvig, sepium, parviflora, cracca, lathyroides, orobus, orobus, bithynica och faba TGCTTAAATTCAGCGGGTAGCC
Trifolium 3898 låtsas, nigrescens, resupinatum occidentale, subterraneum, strictum, ochroleucon, glomeratum, Squamosum, ornithopodioides och repens TGCTTAAATTCAGCGGGTAGCC
Nicotiana 4085 tabacum, benthamiana, otophora, picilla, bigelovii, palmeri, tomentosiformis, tomentosa, digluta, kawakamii, clevelandii, nesophila, solanifolia, cordifolia, debneyi, arentsii, thyrsiflora, wigandioides, undulata, glutinosa, noctiflora, petunioides, obtusifolia, miersii, pauciflora, dämpa, acuminata, linearis, alata, sylvestris och suaveolens TGCTTAAACTCAGCGGGTAGTC
Cucumis 3655 Melo, ritchiei och javanica TGCTTAAACTCAGCGGGTAGTC
Aeluropus 110873 lagopoide, pungens och littoralis TGCTTAAATTCAGCGGGTAATC
Medicago 3877 sativa, arabica, lupulina, ruthenica, polymorpha och minima TGCTTAAATTCAGCGGGTAGCC
pamphylica, lunata, rostrate och plicata TGCTTAAACTCAGCGGGTAGTC
Oryza 4597 sativa, glumipatula, rufipogon, barthiial, glaberrima, australiensis, officinalis, australiensis, ridleyi, malampuzhaensis, alta, nivara, rufipogon, meridionalis och longistaminata TGCTTAAACTCAGCGGGTAGTC
Triticum 4564 aestivum, spelta, turgidum, dicoccoides, petropavlovskyi, urartu och monococcum TGCTTAAACTCAGCGGGTAGTC
Hordeum 4512 vulgare, bulbosum, murinum, secalinum, brevisubulatum och bogdanii TGCTTAAACTCAGCGGGTAGTC
En degenererad primer definieras som IUPAC-system för nukleotid nomenklaturen

Tabell 1: Lista över arter som anses för plockning rDNA-baserade primers.
SSU bindningsställe i jämförelse med LSU bindningsställe visade högre sekvenshomologi över gett släkte.

Amplikon längd Förstärkning-området Sekvens Primer namn Amplikon
332 - 405 bp Delsekvens av SSU, hela sekvensen av ITS1 och delsekvens av 5.8S CGTAACAAGGTTTCCGTAGGTG SSU ITS1-flanker
GGTTCACGGGATTCTGCAAT 5.8S-R
318 - 361 bp Delsekvens av 5.8S, hela sekvensen av ITS2 och delsekvens av LSU ATTGCAGAATCCCGTGAACC 5.8S-F ITS2-flanker
TGCTTAAAYTCAGCGGGTAGYC LSU
100 - 200 bp ITS1 GGTATGGCGTCAAGGAACACT ITS1-F ITS1
ATAGCATCGCTGCAAGAGGT ITS1-R

Tabell 2: Primer sekvenser.

Discussion

Gen uttryck analys av kvantitativ PCR har tillämpats allmänt under de senaste åren. Den största fördelen med denna snabba, kostnadseffektiva och automatiserad metod är dess precisa och korrekta resultat. Att få optimala fördelar från dessa fördelar kräver dock en tydlig förståelse för inställningen av de parametrar som används för qPCR experimentet. För att få ett tillförlitligt resultat i qPCR gen uttryck analys, är det nödvändigt att undvika ospecifik förstärkning som uppstår från primer-dimer eller gDNA kontaminering i RNA-prov3,15. Det förväntas att RNA avskrift nivåerna kommer överskattas enligt gDNA kontaminering8. Här, de unika funktionerna hos en rDNA gen ansågs för en gDNA kontaminering analys i RNA-prover.

Grundläggande egenskaper hos den rDNA som används i detta protokoll: Ribosomala generna består av de två ITSs, nämligen ITS1 och ITS2, och de tre rRNA kodning generna, 17-18 år, 5.8S, och 25-28S subenhet12. De två ITS regionerna ingår inte i den kodande sekvensen av de ribosomal subenheter. De tas bort av minst tre enzymatiska aktiviteter att bearbeta föregångaren att mogna rRNA: Amiiiiin, helicase och exonuclease verksamhet. Som ribosomalt RNA transkriberas som en polycistronic avskrift, är en primär produkt innehåller ITSs verkligen närvarande. Behandlingen är mycket snabb och tar plats i nucleolus och påvisbara föregångare molekyler som innehåller ITS uppgår under detektionsgränsen för metoden qPCR. Därför, när ITS1 eller ITS2 förstärks av ITS flankerande primers, ingen amplifiering kan upptäckas i RNA prover såvida gDNA kontaminering är närvarande. Antalet rDNA gener i genomet hos eukaryota organismer uppskattades för att inkludera upp till tusen exemplar, som är ordnade i enkel- eller tandem matriser på kromosomerna11. I detta protokoll föreslår vi ett alternativt sätt, i stället för NRT, att upptäcka gDNA kontaminering, som används i varje reaktion/analys.

Fördelar och begränsningar med avseende på befintliga metoder: NRT används vanligtvis för att testa om det beredda provet RNA är ren eller förorenade av gDNA. Eftersom gDNA kontaminering inte är jämnt fördelat mellan olika RNA-prover, och reaktion känsligheten för gDNA påverkas betydligt av de gener som analyseras, krävs NRT kontroller för varje prov/test par7,15. Detta kommer att väsentligt lägga kostnaden och arbetskraft vid hantering av många prover samtidigt3,9. Andra alternativa metoder som dokumenterats i litteraturen omfattar användning av intron specifika primers för detektion av gDNA eller designa primers som antingen flankerar en intron eller span ett exon-exon föreningspunkten. Begränsningar i dessa metoder härrör från av bristande information om intron aktivitetssekvens, ofullständig annotering av intron/exon struktur och avsaknad av introner i gener eller pseudogener intresse1,4,10 . På grund av evolution finns rDNA gener som multigene och mycket gene familjer. De är mycket rikligt i genomet och närvarande på olika kromosomer13. Jämfört med andra kodning eller nonconding gener, visar rDNA gener den bästa passformen för detektion av gDNA kontaminering. I jämförande transcriptomic analyser, normalisering av qPCR data av rRNA kalibrator rekommenderas inte för vissa frågor, såsom skillnader i cDNA förberedelse (polyA priming vs. random hexamer priming), stora skillnader i överflöd mellan rRNA och mRNA , och olika biogenes som kan generera missvisande resultat10,16. De problem som vi har nämnt är dock en fördel för gDNA kontaminering analysen. Till exempel när det gäller högre inriktning plats överflöd i genomet och lokalisering på olika kromosomer förbättra rDNA-baserade primers avsevärt upptäckt känslighet gDNA jämfört med befintliga metoder.

Versality av rDNA-baserade till andra organism: rDNA gener är en väl studerat gen familj som identifierats i de flesta organismer. Den föreslagna rDNA-baserade metoden representerar en enkel, mycket känsliga och ekonomiska system för gDNA kontaminering analyser som lätt kan anpassas till andra eukaryota och prokaryota organismer (protokoll 2 - 5). Som en fallstudie, har vi visat här nyttan av denna metod i vissa Poceae arter (figur 4 och figur 5). Använt primers visar en hög grad av överförbarhet till andra Poceae arter på grund av rDNA subenheter bland arter mycket struktur. Problemet blir ännu viktigare när tillräcklig genomiska sekvensinformation inte är tillgänglig för primer design. ITS-flankerande primers som utformats för en art kan således användas i en besläktade arter. Också, 5.8S-F/R primers plockades utifrån bevarade motiv som visar hög likheten i de flesta blommande växter14. Även om hög genomströmning sekvensering teknik öka permanent antalet kända genomen, exon-intron annotering av de flesta organismer är inte klar, och så är det ofta inte möjligt att utforma grundfärger att spänna en exon-exon gräns. Vår metod förklarar hur rDNA-baserade primers kan tillämpas för gDNA kontaminering analysen i qPCR-analys av prokaryoter och Eukaryoter med målet att eliminera dyra NRT kontroller i varje analys/primer kombination.

Disclosures

Författarna har ingen konkurrerande finansiella intressen.

Acknowledgments

Denna forskning stöddes av genetiska och jordbruket bioteknik institutet av Tabarestan (GABIT), Sari SLU och naturresurser universitet (SANRU). Junior forskargruppen abiotisk Stress genomik finansierades av IZN (tvärvetenskapliga centrum för växtforskning gröda, Halle (Saale), Tyskland. Vi tackar Rhonda Meyer för kritisk läsning av manuskriptet.

Materials

Name Company Catalog Number Comments
Maxima SYBR Green / ROX qPCR Master Mix (2X) Thermo Scientific K0221
TissueLyser II QIAGEN 85300
RevertAid H Minus First Strand cDNA Synthesis Kit Thermo Scientific K1631
GeneRuler 100 bp Plus DNA Ladder Thermo Scientific SM0321
96 well WHT/CLR Bio-Rad HSP9601
Microseal B film Bio-Rad MJ-0558
Low tube strip CLR Bio-Rad TLS0801
Flat cap strips Bio-Rad TCS0803
NanoDrop 2000 Peqlab ND-2000
RNaseZAP Ambion 9780
Centrifuge Eppendorf 5810 R
Agilent RNA 6000 Nano Kit Agilent Technologies 5067-1511
2100 Electrophoresis Bioanalyzer Agilent Technologies G2939AA
RNase A, DNase and Protease-free Thermo Scientific EN0531
DNase I, RNase-free Thermo Scientific EN0523
TRIZOL Reagent Ambion 15596026
CFX96 Touch Real-Time PCR Detection System BIO RAD 1855195
PCR tube, 0.2 mL, RNase-free Stratagene Z376426
Guanidine thiocyanate for molecular biology Sigma-Aldrich G9277
Agarose - Nucleic Acid Electrophoresis Sigma-Aldrich A9414
Boric Acid for molecular biology AppliChem A2940
bromophenol blue AppliChem A2331
ethidium bromide AppliChem A1151
Gel documentation system BIO RAD Gel Doc 2000

DOWNLOAD MATERIALS LIST

References

  1. Bustin, S. A., Nolan, T. Pitfalls of quantitative real-time reverse-transcription polymerase chain reaction. J Biomol Tech. 15, (3), 155-166 (2004).
  2. Gutierrez, L., Mauriat, M., Pelloux, J., Bellini, C., Van Wuytswinkel, O. Towards a systematic validation of references in real-time RT-PCR. Plant Cell. 20, (7), 1734-1735 (2008).
  3. Hashemi, S. H., Nematzadeh, G., Ahmadian, G., Yamchi, A., Kuhlmann, M. Identification and validation of Aeluropus littoralis reference genes for Quantitative Real-Time PCR Normalization. J Biol Res (Thessalon). 23, (1), 18 (2016).
  4. Bustin, S. A. Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J. Mol. Endocrinol. 25, (2), 169-193 (2000).
  5. Andersen, C. L., Jensen, J. L., Orntoft, T. F. Normalization of real-time quantitative reverse transcription-PCR data: a model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 64, (15), 5245-5250 (2004).
  6. Bustin, S. A., et al. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem. 55, (4), 611-622 (2009).
  7. Laurell, H., et al. Correction of RT-qPCR data for genomic DNA-derived signals with ValidPrime. Nucleic Acids Res. 40, (7), e51 (2012).
  8. Galiveti, C. R., Rozhdestvensky, T. S., Brosius, J., Lehrach, H., Konthur, Z. Application of housekeeping npcRNAs for quantitative expression analysis of human transcriptome by real-time PCR. RNA. 16, (2), 450-461 (2010).
  9. Laurell, H., et al. Correction of RT-qPCR data for genomic DNA-derived signals with ValidPrime. Nucleic Acids Res. 40, e51 (2012).
  10. Caldana, C., Scheible, W. R., Mueller-Roeber, B., Ruzicic, S. A quantitative RT-PCR platform for high-throughput expression profiling of 2500 rice transcription factors. Plant Methods. 3, (1), 7 (2007).
  11. Lawrence, R. J., Pikaard, C. S. Perspectives Chromatin Turn Ons and Turn Offs of Ribosomal RNA Genes. Cell Cycle. 3, (7), 880 (2004).
  12. Boisvert, F. M., van Koningsbruggen, S., Navascues, J., Lamond, A. I. The multifunctional nucleolus. Nat Rev Mol Cell Biol. 8, (7), 574-585 (2007).
  13. Alvarez, I., Wendel, J. F. Ribosomal ITS sequences and plant phylogenetic inference. Mol Phylogenet Evol. 29, (3), 417-434 (2003).
  14. Jobes, D. V., Thien, L. B. A conserved motif in the 5.8 S ribosomal RNA (rRNA) gene is a useful diagnostic marker for plant internal transcribed spacer (ITS) sequences. Plant Mol Biol Report. 15, (4), 326-334 (1997).
  15. Padhi, B. K., Singh, M., Huang, N., Pelletier, G. A PCR-based approach to assess genomic DNA contamination in RNA: Application to rat RNA samples. Anal Biochem. 494, 49-51 (2016).
  16. Dheda, K., et al. Validation of housekeeping genes for normalizing RNA expression in real-time PCR. Biotechniques. 37, (1), 112-114 (2004).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics