Optimalisatie en Vergelijkende Analyse van Plant Organellaire DNA Verrijkingsmethoden Geschikt voor Volgend Sequencing

* These authors contributed equally
Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

De vergelijking en optimalisatie van twee organellaire DNA-verrijkingsmethoden worden voorgesteld: traditionele differentiële centrifugatie en fractionering van het totale gDNA op basis van methyleringsstatus. We beoordelen de resulterende DNA-hoeveelheid en kwaliteit, tonen de prestaties aan bij korte-leesvolgorde-sequencing, en bespreken het potentieel voor gebruik bij langlezen single-molecule sequencing.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Miller, M. E., Liberatore, K. L., Kianian, S. F. Optimization and Comparative Analysis of Plant Organellar DNA Enrichment Methods Suitable for Next-generation Sequencing. J. Vis. Exp. (125), e55528, doi:10.3791/55528 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Plant organellaire genen bevatten grote, herhalende elementen die paren of recombinatie kunnen ondergaan om complexe structuren en / of sub-genomische fragmenten te vormen. Organellaire genen bestaan ​​ook in mengsels binnen een gegeven cel of weefsel type (heteroplasmie), en een overvloed aan subtypen kunnen tijdens de ontwikkeling veranderen of wanneer onder stress (substochiometrische verschuiving). Next-generation sequencing (NGS) technologieën zijn nodig om diepgaand begrip van organellaire genoomstructuur en -functie te verkrijgen. Traditionele sequencing studies gebruiken verschillende methoden om organellair DNA te verkrijgen: (1) Als een grote hoeveelheid startweefsel wordt gebruikt, wordt het gehomogeniseerd en onderworpen aan differentiële centrifugatie en / of gradiëntzuivering. (2) Als een kleiner hoeveelheid weefsel wordt gebruikt ( dwz als zaden, materiaal of ruimte beperkt zijn), wordt hetzelfde proces uitgevoerd als in (1), gevolgd door gehele genoom amplificatie om voldoende DNA te verkrijgen. (3) Bioinformatica analyse kan gebruikt worden om te zoekenHet totale genomische DNA en het analyseren van organellair leest. Al deze methoden hebben inherente uitdagingen en afwijkingen. In (1) kan het moeilijk zijn om zo'n grote hoeveelheid startweefsel te verkrijgen; In (2), zou de volledige genoom amplificatie een sequencing bias kunnen introduceren; En in (3) kan homologie tussen nucleaire en organellaire genen interfereren met assemblage en analyse. Bij planten met grote nucleaire genen is het voordelig om te verrijken voor organellair DNA om sequentiekosten en sequentiekomplexiteit voor bioinformatica analyses te verminderen. Hiermee vergelijken we een traditionele differentiële centrifugatiemethode met een vierde methode, een aangepaste CpG-methyl pulldown-benadering, om het totale genomische DNA in kern- en organellaire fracties te scheiden. Beide methoden leveren voldoende DNA voor NGS, DNA dat sterk verrijkt is voor organellaire sequenties, alhoewel bij verschillende verhoudingen in mitochondriën en chloroplasten. We presenteren de optimalisatie van deze methoden voor tarwebladweefsel en bespreken belangrijke voordelen en dNadelen van elke aanpak in het kader van sample input, protocol gemak en downstream applicatie.

Introduction

Genoom sequencing is een krachtig instrument om de onderliggende genetische basis van belangrijke planteigenschappen te ontleden. De meeste genoom-sequencing studies richten zich op het nucleaire genoomgehalte, aangezien de meerderheid van de genen zich in de kern bevinden. Organellaire genen, waaronder de mitochondriën (over eukaryoten) en plastiden (in planten, de gespecialiseerde vorm, de chloroplast, werken in fotosynthese) dragen echter belangrijke genetische informatie die essentieel is voor organisme-ontwikkeling, stressrespons en algemene fitness 1 . Organellaire genen zijn typisch opgenomen in totale DNA-extracties die bestemd zijn voor nucleaire genoom sequencing, hoewel methoden om organelle getallen te verminderen voorafgaand aan DNA-extractie ook 2 gebruikt worden . Veel studies hebben sequentieresultaten gebruikt van totale gDNA-extracties om organellaire genen te combineren 3 , 4 , 5 ,Xref "> 6 , 7. Maar wanneer het doel van de studie zich richt op organellaire genen, verhoogt het gebruik van het totale gDNA de sequencing kosten, omdat veel lezingen" verloren "zijn aan de nucleaire DNA sequenties, met name in planten met grote nucleaire genen Bovendien, door de duplicatie en overdracht van organellaire sequenties in het nucleaire genoom en tussen organellen, is het oplossen van de juiste mapping positie van sequentiebepaling leest op het juiste genoom bioinformatisch uitdagend 2 , 8. De zuivering van organellaire genen uit het nucleaire genoom is bovendien een Strategie om deze problemen te verminderen. Verdere bioinformatica strategieën kunnen worden gebruikt om te scheiden, die kaart leest naar gebieden van homologie tussen de mitochondria en chloroplasten.

Terwijl de organellaire genen van veel plantensoorten zijn gesorteerd, is weinig bekend over de breedte van organellaire genoom diversiteitVerkrijgbaar in wilde populaties of in gekweekte broedplaatsen. Organellaire genen zijn ook bekend als dynamische moleculen die significante structurele herrangschikking ondergaan als gevolg van recombinatie tussen herhaalsequenties 9 . Bovendien bevinden zich meerdere kopieën van het organellaire genoom binnen elke organel, en meerdere organellen bevinden zich in elke cel. Niet alle kopieën van deze genen zijn identiek, die bekend staat als heteroplasmie. In tegenstelling tot het kanonieke beeld van 'mastercircles', is er nu bewijs voor een complexere beeld van organellaire genoomstructuren, waaronder sub-genomische cirkels, lineaire chromosomen, lineaire concatamers en vertakte structuren 10 . De montage van plantorganellaire genen wordt verder gecompliceerd door hun relatief grote maten en substantiële omgekeerde en directe herhalingen.

Traditionele protocollen voor organellaire isolatie, DNA-zuivering en daaropvolgende genen E-sequencing zijn vaak omslachtig en vereisen grote hoeveelheden weefselinvoer, met een aantal gram tot en met honderden grams jong bladweefsel dat nodig is als uitgangspunt 11 , 12 , 13 , 14 , 15 , 16 , 17 . Dit maakt het sequentieren van het organellair genoom ontoegankelijk wanneer het weefsel beperkt is. In sommige situaties zijn zaadhoeveelheden beperkt, zoals wanneer het nodig is om op generatie of mannelijke steriele lijnen te sequentie die via kruising moet worden gehandhaafd. In deze situaties kan organellair DNA worden gezuiverd en vervolgens onderworpen aan gehele genoom amplificatie. Hele genoom amplificatie kan echter significante sequencing bias introduceren, wat een bijzonder probleem is bij het beoordelen van structurele variatie, sub-genomische structuren en heteroplasmiveaus> 18. Recente vooruitgang in de voorbereiding van de bibliotheek voor korte-lezen sequencing technologieën hebben de laag-input barrières overwonnen om de volledige genoom amplificatie te vermijden. Bijvoorbeeld, de Illumina Nextera XT bibliotheekbereidingskit maakt het mogelijk om zo weinig als 1 ng DNA te gebruiken als ingang 19 . Echter, standaard bibliotheekpreparaten voor langlose sequencing toepassingen, zoals PacBio of Oxford Nanopore sequencing technologieën, vereisen nog steeds een relatief hoge hoeveelheid input DNA, die een uitdaging kan vormen voor organellair genoom sequencing. Recentelijk zijn nieuwe gebruikersgemaakte, langlezen sequentieprotocollen ontwikkeld om de invoerhoeveelheden te verminderen en om genoomsequencing in monsters te helpen vergemakkelijken, waarbij het verkrijgen van microgram-hoeveelheden DNA moeilijk is 20 , 21 . Het verkrijgen van hoogmoleculair gewicht, pure organellaire fracties om in deze bibliotheekpreparaten te voeden blijft echter een uitdaging.

We zochten tO vergelijken en optimaliseren van organellaire DNA-verrijking en isolatiemethoden die geschikt zijn voor NGS zonder de noodzaak van gehele genoom amplificatie. Specifiek, ons doel was om de beste praktijken te bepalen om te verrijken voor organellair DNA met een hoge molecuulgewicht uit beperkte uitgangsmaterialen, zoals een subsample van een blad. Dit werk presenteert een vergelijkende analyse van methoden om te verrijken voor organellair DNA: (1) een gemodificeerd, traditioneel differentiaalcentrifugatie protocol versus (2) een DNA fractioneringsprotocol gebaseerd op het gebruik van een commercieel verkrijgbare DNA-CpG-methyl-bindende domeinproteïne-uitrolmethode 22 toegepast op plantweefsel 23 . Wij adviseren beste praktijken voor het isoleren van organellair DNA uit tarwebladweefsel, dat gemakkelijk kan worden uitgebreid tot andere planten en weefselsoorten.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Generatie van plantaardige materialen voor organellaire isolatie en DNA-extractie

  1. Standaardgroei van tarwe zaailingen
    1. Plant zaden in vermiculiet in kleine vierkante potten met 4 - 6 zaden per hoek. Overbrengen naar een kas of groeikamer met een 16 uur lange cyclus, 23 ºC dag / 18 ºC nacht.
    2. Water de planten elke dag. Bemest de planten met ¼ theelepel granulaire 20-20-20 NPK meststof bij ontkieming en 7 dagen na ontkieming.
  2. Alternatieve etiolatie van tarwe zaailingen
    1. Volg stap 1.1, maar plaats de potten in een donkere groeikamer gedurende 23 uur bij 23 ° C gedurende 16 uur. Als alternatief, bedek de planten in het kas ( bijv. Met een opslagcontainer, maar de juiste ventilatie moet worden gehandhaafd).
  3. Groei en weefselverzameling
    1. Groei de planten gedurende 12 - 14 dagen. Voor de meeste tarwegenotypeS, 75-100 zaailingen leveren ongeveer 10-12 g weefsel, wat voldoende is voor twee organellaire extracties met behulp van de differentiële centrifugatie methode (sectie 2); Slechts één plant is nodig als het gebruik van de DNA-CpG-methylering-gebaseerde benadering tot fractionering organellair uit nucleair DNA (sectie 3) gebruikt wordt.
    2. Als u gebruik maakt van de differentiële centrifugatie benadering, versamel weefsel vers en ga onmiddellijk door om de monsters te verwerken, zoals beschreven in sectie 2.
    3. Als u gebruik maakt van de CpG-methyl-pulldown-aanpak, oogst u 20 mg secties van jong bladweefsel in microcentrifugebuizen (gebruik het standaardgewassen of gefiltreerde weefsel, zie de representatieve resultaten ). Snapvries op vloeibare stikstof en vries bij -80 ºC tot gebruik. Ga door naar de pulldown fractionering van DNA, zoals beschreven in sectie 3.

2. Methode # 1: DNA-extractie met behulp van differentiële centrifugatie (DC)

OPMERKING: De diffErentiale centrifugatieprotocol werd gemodificeerd uit twee publicaties die geoptimaliseerde omstandigheden om beide organellen te isoleren maar verrijken voor mitochondria 17 , 24 . Het resulterende protocol is minder tijd intensief en gebruikt minder giftige chemicaliën dan de vorige methoden. Specifiek hebben wij wijzigingen aangebracht aan de buffers en wasstappen, inclusief de toevoeging van polyvinylpyrrolidon (PVP) aan de STE-extractiebuffer en de eliminatie van de eindwas in NETF-buffer, die natriumfluoride (NaF) bevat.

Voorzichtigheid: De voorbereiding en het gebruik van STE-buffer dienen onder een chemische afzuigkap te worden uitgevoerd met adequate persoonlijke beschermingsmiddelen, aangezien deze buffer 2-mercaptoethanol (BME) bevat.

  1. Dingen om te doen voordat u begint
    1. Zorg ervoor dat alle apparatuur extreem schoon is en autoclaaf alle apparatuur die autoclaaf kan worden ( bijv. Slijpcilinders, high-speed centriVuilbuizen, enz. ).
      OPMERKING: Filtertips worden aanbevolen voor alle stappen die pipettering nodig hebben om kruisbesmetting te vermijden.
    2. Zie de lijst met benodigde apparatuur en reagentia en berei de vereiste buffers en werkvoorraden voor methode # 1 ( tabel 1 ) op. Koel de cryogene slijpblokken tot -20 ºC en de rotoren en buffers tot 4 ºC, zet de microcentrifuge op tot 4 ºC, en draai een waterbad van 37 ºC aan.
  2. Isolatie van organellen
    1. Oog 5 g vers weefsel op en spoel het in koud, steriel water in een gekoelde beker op ijs.
      OPMERKING: Bewaar de monsters altijd op ijs tijdens alle werkzaamheden en transporten van en naar de centrifuges, dampkasten, enz. Alternatief, werk in een koude kamer als er voldoende ruimte en apparatuur beschikbaar zijn om het protocol uit te voeren.
    2. Met behulp van een schaar, snijd het bladweefsel in 1 cm-stukken rechtstreeks in een 50 ml buis met twee keramische slijpencilinders.
      OPMERKING: Reinig of vervang de schaar tussen monsters om kruisbesmetting te vermijden.
    3. Als er geen weefselhomogenisator is, gebruik dan een mortel en stamper en volg dan stap 2.2.4 - 2.2.9.
      1. Knip het bladweefsel in een voorgekoeld mortel op ijs. Maal de monsters gedurende 2 - 3 minuten in 15 ml STE (in de afzuigkap).
      2. Giet de buffer uit (laat het weefsel in het mortel) door een trechter die een laag pre-natte, steriele filtratie doek bevat (~ 22 tot 25 μm poriegrootte, zie het hoofdprotocol voor details) in een andere 50 ml buis . Voeg nog eens 10 ml STE toe aan de mortel en stamper en homogeen opnieuw.
      3. Giet het gehomogeniseerde weefsel en de buffer in dezelfde trechter. Spoel de mortel en stamper met 10 ml STE en giet het in de trechter. Druk de filtratielijm in de trechter en draai deze uit om zo veel mogelijk vloeistof te herstellen.
        OPMERKING: Vervang handschoenen tussen monsters om kruisbesmetting te vermijden. Ga verder met de proTocol in stap 2.2.10.
    4. Voeg 20 ml STE (in de dampkap) toe aan elke 50 ml buis.
    5. Plaats de monsters in voorgekoelde cryogene slijpblokken in een weefselslijpapparaat en grind de monsters gedurende 2 x 30 s bij 1.750 rpm. Draai de steekproefposities en plaats de monsters op ijs voor ~ 1 min tussen de grinds.
      OPMERKING: In deze stap kan een mortel en stamper, blender of ander weefselslijp / homogeniseringsapparaat gebruikt worden. Echter, elke methode zal de resulterende DNA-kwaliteit beïnvloeden tot verschillende graden, en daarom moet de lengte en de kwaliteit van de DNA worden beoordeeld voordat ze verder gaan met downstream toepassingen.
    6. Steek een trechter in een schone buis van 50 ml in ijs. Plaats een laag filtratie doek in de trechter en pre-nat met 5 ml STE. Doe de doorstroming niet weg.
    7. Giet het gehomogeniseerde weefsel in de trechter. Spoel de slijpbuis af met 15 ml STE, herhaal en draai de buis om de muren en deksel te spoelen en giet in de funnel.
    8. Verwijder de keramische stenen voorzichtig en druk vervolgens de filterdoek in de trechter.
      OPMERKING: Vervang handschoenen tussen monsters om kruisbesmetting te vermijden.
    9. Wikkel de buisdoppen met parafilm om spleten te vermijden. Centrifugeer bij 2000 xg gedurende 10 minuten bij 4 ºC.
    10. Zuig de supernatant zorgvuldig door met behulp van een serologische pipet (vermijd de pellets te verstoren) en plaats deze in een 50 ml hoge centrifugebuis (indien de buizen niet afdichte afdichtingen hebben, draai de buisdoppen met parafilm om spleten te vermijden). Gooi de pellets weg.
    11. Bal de buizen bij binnen 0,1 g met STE en centrifugeer het resulterende supernatant gedurende 20 minuten bij 18.000 xg en 4 ºC. Om de buizen in evenwicht te brengen, plaats een kleine beker ijs op de balans, doe de schaal af en weeg de monsters op ijs om ze koud te houden. Alternatief, gebruik een evenwicht en een dampkap in een koude kamer.
    12. Gooi de supernatant weg. Voeg 1 ml ST toe aan de pellet en zet ons voorzichtig opEen zachte penseel geven. Voeg 24 ml ST (eindvolume van 25 ml) toe en meng / wervel ( dwz druk de verfborstel aan de zijkant van de buis om alle vloeistof te verwijderen).
    13. Bal de buizen in binnen 0,1 g met behulp van ST. Centrifugeer gedurende 20 minuten bij 18.000 xg en 4 ºC. Ondertussen bereiden DNaseI-oplossing (zie tabel 1 voor voorraad- en werkoplossingsrecepten). Voor elk monster maak één 200 μl aliquot in een 1,5 ml buis.
    14. Verwijder de supernatant, vlek de buis en schuif de pellet (nog steeds in een centrifugebuis met hoge snelheid) in 300 μL ST met een zachte penseel. Plaats de penseel in de eerder voorbereide 1,5 ml buis die 200 μl DNaseI oplossing bevat en draai de verfborstel om eventuele resterende pelletjes in de penseel vast te houden. Pipetteer de DNaseI-oplossing terug in de hogesnelheidssentrifuge-buis en zwenk zachtjes om te mengen.
    15. Incubeer gedurende 30 minuten bij 37 ° C in een waterbad (wikkel parafilm om de bovenkant van de buis om condensatie lekine te voorkomenG in de pet). Meng zachtjes door 2 keer wervelen tijdens incubatie.
    16. Pijp het pelletmengsel voorzichtig uit de buis met een pipettaart met een brede opening en plaats het in een 1,5 ml buis. Voeg 500 μL 400 mM EDTA, pH 8,0, aan de centrifugebuis met hoge snelheid en zachtjes pipet om alle resterende pellet uit de buis te krijgen. Breng de EDTA over op dezelfde 1,5 ml, laagbindende buis als het pelletmengsel en meng zachtjes door inversie.
    17. Centrifugeer bij 18.000 xg gedurende 20 minuten bij 4 ºC. Verwijder de supernatant, vlek de buis en gebruik tegelijkertijd voor DNA-isolatie. Indien nodig, pellets bevriezen bij -20 ºC, maar dit kan resulteren in een rendement vermindering, aangezien resterend DNaseI het monster DNA kan degraderen als het niet onmiddellijk wordt verwerkt.
  3. DNA-extractie uit geïsoleerde organellen met behulp van een commerciële kolom gebaseerde aanpak
    OPMERKING: Zie het kitshandboek voor het volledige protocol 25 , en zie hieronder voor wijzigingen. PrHet overbrengen van directe organische isolatie tot DNA-extractie heeft de voorkeur. Herhaalde bevriezing en ontdooien zullen DNA fragmentgroottes verminderen en leiden tot DNA-afbraak door residueel DNaseI. Beperk vortexing of krachtige pipettering, omdat dit het DNA kan scheren. Het gebruik van microcentrifugebuizen met een lage binding wordt aanbevolen om DNA-herstel te maximaliseren.
    1. DNA-extractie procedure
      OPMERKING: Lees het gedetailleerde handelsprotocol 25 voordat u begint ervoor te zorgen dat de buffers goed gemaakt / opgeslagen zijn en dat de spin-column procedures worden begrepen.
      1. Voeg 180 μL Buffer ATL direct in de buis toe met de pellet (ontdooid indien eerder bevroren en geëquilibreerd tot kamertemperatuur op de benchtop).
      2. Ga verder met stap 3 in het protocol voor "DNA-zuiveringen van weefsels" in het kitshandboek, met de volgende wijzigingen: een 30 minuten lysis in stap 3, inclusief de optionele RNase A-spijsvertering, en eluteren in 3 x 200 μL AE ( Elk in een seParate tube en combineer dan de elutions).
      3. Bewaar een aliquot (minstens 20 μL) voor qPCR (zie stap 4.1). Om te kwantificeren alvorens te concentreren, bespaar nog 1 μL voor kwantificatie met hoge gevoeligheid.
      4. Indien gewenst, ga verder met monsterconcentratie.
  4. Monsterconcentratie met commerciële filtereenheden
    OPMERKING: Zie het commercieel protocol 26 voor meer details. Afhankelijk van het stroomafwaartse gebruik is het wellicht niet nodig om de monsterconcentratie uit te voeren ( bijvoorbeeld voor eindpunt PCR en qPCR toepassingen). Voor NGS bibliotheekconstructie is het echter waarschijnlijk nodig om verdund organellair DNA te concentreren dat verkregen wordt na DNA-extractie.
    1. Concentratie kolom procedure
      1. Voorzichtig voorweeg (zie tabel 2 ) de lege filtereenheid (zonder buis) op een schoon stuk weegpapier op een digitaal analytisch evenwicht. Noteer het gewicht.
      2. PiPette de gecombineerde elutions in de filterunit en weeg weer goed.
        OPMERKING: De commerciele handleiding 26 zegt dat het maximale volume van de filtereenheid 500 μL is, maar maximaal 575 μL kan onmiddellijk worden toegevoegd aan het apparaat zonder overloop.
      3. Plaats de gevulde filtereenheid zorgvuldig in een buis (voorzien van de kolommen). Centrifugeer bij 500 xg voor de gewenste tijd om het vereiste concentraatvolume te bereiken. Voor een monstervolume van ~ 575 μL resulteert een 20-minuut-spin gewoonlijk in een concentratievolume van 15 - 30 μl.
      4. Verwijder de filterunit uit de buis en weeg opnieuw. Gebruik de tabel om te bepalen of het gewenste concentratievolume is bereikt. Zo niet, centrifugeer opnieuw bij 500 xg voor een kortere tijd en weeg opnieuw; Herhaal tot het gewenste concentratievolume is bereikt.
      5. Plaats een nieuwe buis (voorzien van de kolommen) boven op de filterunit en draai in omgekeerde richting. Centrifugeer gedurende 3 minuten bij 1.000 xg om de co te overbrengenNcentreer naar de buis.
      6. Bepaal het teruggevorderde volume. Dit zal meestal ~ 3 - 5 μL minder zijn dan het berekende volume, door filterretentie. Als overconcentreerd, verdund met steriel water of TE om het gewenste volume te bereiken.
      7. Kwantificeer het DNA met behulp van kwantificatie met hoge gevoeligheid (per fabrikant instructies).

3. Methode # 2: Methylefractie (MF) Aanpak om te verrijken voor organellair DNA uit totaal genomisch DNA

OPMERKING: Dit protocol is gewijzigd van een door DEI ontwikkeld DNA-extractie protocol voor planten en schimmels 27 en het commerciële Microbiome DNA Enrichment Kit Protocol 28 . In theorie kan elk DNA-isolatieprotocol dat DNA met een hoog molecuulgewicht oplevert, gebruikt worden voor de pulldown. Voor korte-lezen sequentiebepaling is elke extractie die overwegend> 15 kb fragmenten leidt voldoende geschikt voor gebruik bij de uitrol. Voor loNg-read sequencing, grotere fragmenten kunnen wenselijk zijn. Daarom hebben we dit protocol geoptimaliseerd om DNA met hoog molecuulgewicht te produceren.

  1. Isolatie van totaal DNA
    OPMERKING: zie de lijst met benodigde apparatuur en reagentia en berei de vereiste buffers en werkvoorraden voor methode # 2 op ( tabel 1 ). Voeg lysende enzymen toe aan de lysisbuffer voorraad om de lysis buffer werkoplossing te maken. Zet de thermomixer aan en zet deze op 37 ° C. Zet het waterbad aan op 50 ° C en plaats de QF-buffer in het bad. Plaats 70% EtOH in de vriezer en zet de microcentrifuge op 4 ° C.
    1. Totale DNA-extractie met behulp van commerciële DNA-extractiekolommen
      OPMERKING: Lees voordat u begint het commerciele handboek 29 voor gedetailleerde informatie over het gebruik van de zwaartekracht-anion-uitwisselingszuilen. De kolommen kunnen worden opgesteld met behulp van een gespecialiseerd rek of over de buizen geplaatst met behulp van de meegeleverde plastic ringen. Alle stappen, inclusief de gEnomische tips, mogen door de zwaartekrachtstroom doorgevoerd worden, en restvloeistof mag NIET gedwongen worden.
      1. Maal 20 mg bevroren weefsel in vloeibare stikstof in een 2 ml-laag buis met behulp van handgeslepen slijpstammen, ontworpen voor 2 ml buizen.
      2. Voeg 2 ml lysisbuffer werkoplossing toe (de buizen zijn erg vol).
      3. Incubeer in een thermomixer bij 37 ° C gedurende 1 uur met zachte roering bij 300 rpm. Als een thermomixer niet beschikbaar is, incubatie op een hitteblok en het mengen met zacht vlokken om de 15 minuten is een geschikt alternatief.
      4. Voeg 4 μL RNase A (100 mg / ml, uiteindelijke concentratie van 200 μg / ml) toe. Inverteer om gedurende 30 minuten bij 37 ° C te mengen en in een thermomixer te incuberen, met zachte roering bij 300 rpm.
      5. Voeg 80 μl eiwitase K (20 mg / ml, eindconcentratie 0,8 mg / ml) toe, omgekeerd om te mengen en incubeer 2 uur bij 50 ° C in een thermomixer met zachte roeren bij 300 rpm.
      6. Centrifugeer gedurende 20 minuten bij 4 ° C en 15.000 xg om de onoplosbare puin te pelletiseren.
      7. Terwijl de monsters centrifugeren, equilibreren de kolommen met 1 ml Buffer QBT en laat de kolom leeg worden door de zwaartekrachtstroom.
      8. Gebruik een pipette-tip met breedboring om het monster (vermijd de pellet) onmiddellijk aan de geëquilibreerde kolom toe te passen en laat het door de kolom volledig doorlopen. Als het monster bewolkt wordt, filter dan of centrifugeer opnieuw voor de toepassing naar de kolom (zie het commerciële handboek voor details 29 ).
      9. Zodra het monster volledig in de hars is gekomen, was de kolom met 4 x 1 ml buffer QC.
      10. Suspenseer de kolom over een schone, 2 ml microcentrifugebuis met een laag bindmiddel. Verwijder het genomische DNA met 0,8 ml buffer QF vooraf verwarmd bij 50 ° C.
      11. Neerslaan van het DNA door 0,56 ml (0,7 volumes elutiebuffer) van kamertemperatuur-isopropanol aan het geëlueerde DNA toe te voegen.
      12. Meng door inversie (10X) en centrifugeer onmiddellijk gedurende 20 minuten bij 15.000 xg en 4 ° C. ZorgVerwijder de supernatant volledig zonder de glazen, losgelegen pellet te storen.
      13. Was de gecentrifugeerde DNA-pellet met 1 ml koude 70% ethanol. Centrifugeer gedurende 10 minuten bij 15.000 xg en 4 ° C.
      14. Verwijder de supernatant voorzichtig (wees ook voorzichtig met deze stap) zonder de pellet te storen. Droog 5-10 minuten luchtdroog en doe het DNA opnieuw in 0,1 ml elueringsbuffer (EB). Oplos het DNA overnacht bij kamertemperatuur. Vermijd pipettering, die het DNA kan scheren.
      15. Kwantificeer de monsters met behulp van een hoge gevoeligheid DNA kwantificatietest (per fabrikant instructies).
  2. Bead-gebaseerde fractionering van gemethyleerd en niet gemmethyld DNA
    OPMERKING: Een recente publicatie heeft het gebruik van een in de handel verkrijgbare kit 28 aangetoond die voordeel trekt uit een uitrol-benadering die gebruik maakt van een CpG-specifiek methyl-bindend domein eiwit gefuseerd aan het menselijk IgG Fc fragment (MBD2-Fc eiwit) tot fractieAten organellaire genen (ongemetyleerd) uit kerngenoom (hooggemethylde) inhoud 23 . Fractionering efficiëntie in tarwe monsters werd niet eerder getest met behulp van deze commerciële MF kit 28 .
    1. Dingen om te doen voordat u begint
      1. Bereid eerst 80% ethanol op (ten minste 800 μl per reactie). Stel 5x bind / wasbuffer op ijs op ijs en berei 5 ml 1x buffer per monster (verdunde 5X buffer met steriel nucleasevrij water en houd ijs tijdens het protocol).
    2. Bereid MBD2-Fc eiwitgebonden magnetische kralen
      1. Bereid het benodigde aantal kraalsets op. Schaal de reacties om tussen 1 en 2 μg totaal input DNA te gebruiken, waarvoor 160 - 320 μl kralen nodig zijn. Merk op dat de onderstaande reacties voor 1 μg totaal input DNA zijn, zodat ze 160 μl kralen nodig hebben. Schaal de reacties volgens de behoeften.
      2. Met behulp van breekboorpunten pipetteer het eiwit A Magnetic B voorzichtigEad slurry omhoog en omlaag om een ​​homogene suspensie te creëren. Als alternatief, draai de kokerbuis voorzichtig gedurende 15 minuten bij 4 ° C.
        OPMERKING: Draai de kralen niet af.
      3. Ga verder met de instructies volgens de instructies van de fabrikant 28 .
    3. Vang gemetileerd nucleair DNA
      1. Voor elk afzonderlijk monster voeg 1 μg input DNA toe aan een buis die 160 μl MBD2-Fc gebonden magnetische kralen bevat.
      2. Voeg 5x bind- / wasbuffer toe, aangezien het volume van het DNA-invoermonster voor een eindconcentratie van 1x (volume 5x bind / wasbuffer wordt toegevoegd om toe te voegen (μL) = volume input DNA (μL) / 4). Pipet het monster een paar keer omhoog en omlaag om te mengen met een brede boorpunttip.
      3. Draai de buizen bij kamertemperatuur gedurende 15 minuten. Pepet de monsters voorzichtig met een dikke pipettip en flip de monsters 2 tot 3 maal door de incubatie om te voorkomen dat kraal wordt verstopt.
        OPMERKING: De pipettering en flickiNg is cruciaal om te zorgen voor een efficiënte uitrol van het gemetyleerde DNA.
    4. Verzamel verrijkte, niet-gemethylde organellair DNA
      1. Draai de buis die het DNA en MBD2-Fc-gebonden magnetisch kraalmengsel bevat, centraal. Plaats de buis op een magnetisch rek voor minstens 5 minuten om de kralen aan de zijkant van de buis te verzamelen. De oplossing dient duidelijk te zijn.
      2. Verwijder de geverfde supernatant zonder de kralen te storen door gebruik te maken van brede boringstips. Breng de supernatant over (bevat niet-gemethylde, organellair verrijkte DNA) in een schone, kleine binding, 2 ml microcentrifugebuis. Bewaar dit monster bij -20 of -80 ° C, of ​​ga direct door naar stap 3.2.6 voor zuivering.
    5. Verwijder nucleair DNA van de MBD2-Fc-gebonden magnetische kralen
      1. Als de nucleaire fractie ook gewenst is, volgt u de instructies 28 van de fabrikant om het nucleaire DNA uit de MBD2-Fc-gebonden magnetische kralen te elueren; Zuiveren zoals beschreven in stap 3.2.7.
      2. Kralen-gebaseerde nucleïnezuurzuivering
        1. Zorg ervoor dat de zuiveringskralen bij kamertemperatuur zijn en grondig gemengd worden. Ga verder met het protocol volgens de instructies in het MF-kit handboek 28 .
          OPMERKING: Het monster kan nu gebruikt worden voor NGS bibliotheekconstructie of een andere downstream analyse.

    4. Sample Quantification and Quality Control

    1. QPCR assay om organellaire verrijking te beoordelen
      OPMERKING: De hier beschreven qPCR-reactie- en analyseparameters zijn ontworpen voor gebruik op een Roche LightCycler 480 en kunnen aangepast worden voor verschillende apparatuur en reagentia. Als qPCR niet beschikbaar is, kan eindpunt-PCR en visualisatie op een agarosegel worden gebruikt als kwalitatieve maatregel van zuiverheid van de monsters, onder toepassing van dezelfde primers en omstandigheden die hierin worden beschreven. Amplicon maten zijn ~ 150 bp voor alle primer sets. Zie tabel 3 voor primer sequenCes en pairings.
      1. QPCR reactie setup
        1. Om een ​​individuele 20 μL qPCR-reactie op te stellen, pipetteer het volgende zorgvuldig in een enkele put van een 96-putjes qPCR-plaat: 10 μL 2x SYBR Green I Master; 2 μL van de 10 μM voorwaartse en omgekeerde primermix (voor een uiteindelijke concentratie van 0,5 μM); 2 μL sjabloon (binnen het bereik van de standaardkromme); en 6 pl steriele, nuclease-vrij H2 O. pipetteerfouten beperken, verdient het de voorkeur een master mix maken met alle reactiecomponenten behalve matrijs. Voeg de mastermix toe op de qPCR-plaat en voeg vervolgens de sjabloon van belang voor elke put toe. Drie technische replicaten voor elk monster moeten worden uitgevoerd om de effecten van de pipetteringsfout te minimaliseren.
          OPMERKING: Uiteindelijk wordt de verhouding van nucleaire tot organellaire kwantificatiescycli vergeleken tussen monsters, dus kleine concentratieverschillen zijn aanvaardbaar. DNA-concentraties zouden echter ongeveer binnen het bereik van ea moeten zijnCh andere.
        2. Verzegel de plaat met een kwalitatief hoogwaardige qPCR afdichtingsfilm. Vortex de monsters voorzichtig en zorg ervoor dat er geen bellen ontstaan. Draai de plaat kort gedurende 2 minuten bij 4 ° C om het monster te verzamelen en eventuele kleine bellen te elimineren.
        3. Plaats de plaat in de machine. Voer het qPCR-programma uit volgens de onderstaande richtlijnen.
      2. QPCR reactieparameters
        OPMERKING: dit zijn standaardparameters, behalve de gloeiingscyclus van de versterkingsfase. Pas deze instelling aan om specifieke primers op te nemen als die gebruikt worden verschillen van de primers die in dit protocol worden gepresenteerd.
        1. Pre-incubateer bij 95 ° C gedurende 5 minuten, met een hellingsgraad van 4,4 ° C / s.
        2. Voer 45 amplificatiecycli van (1) 95 ° C gedurende 10 s uit, met een rampsnelheid van 4,4 ° C / s; (2) 60 ° C gedurende 20 s, met een rampsnelheid van 2,2 ° C / s; En (3) 72 ° C gedurende 10 s, met een helling van 4,4 ° C / s (data verkregen tijdens (3)).
        3. Gebruik een optioNal smeltcurvecyclus van 95 ° C gedurende 5 s, met een rampsnelheid van 4,4 ° C / s; 65 ° C gedurende 1 minuut, met een rampsnelheid van 2,2 ° C / s; En 97 ° C, met een continue acquisitie modus.
        4. Gebruik een koelcyclus van 40 ° C gedurende 30 s, met een helling van 1,5 ° C / s.
      3. Assay parameters
        1. Selecteer het SYBR-sjabloon. Controleer de programmaparameters in de Experiment-knop. Zodra de plaat is geladen, kan de test worden gestart, en de instellingen kunnen worden aangepast terwijl de test loopt.
        2. Monsters toewijzen met behulp van de voorbeeld editor. Selecteer Abs Quant als de workflow en wijs de monsters aan als onbekend, normen of negatieve controles. Designate replicates en vul de voorbeeldnamen van de eerste van elke replicaat in. Voeg concentraties en eenheden toe aan de normen.
        3. Subsets instellen voor analyse; Deze zijn toegewezen in de subset editor.
        4. Voor analyse selecteert u Abs Quant / 2nd Derivative Max uit de lijst 'Nieuwe analyse maken'.Voer de extern opgeslagen standaardkromme in (indien van toepassing) en druk vervolgens op berekenen; Het rapport bevat de geselecteerde informatie.
        5. Om nauwkeurige absolute kwantificering uit te voeren voor de bepaling van het kopieergetal of de concentratie, gebruik een standaardkromme die representatief is voor het geteste monster ( bv. Organellair DNA geïsoleerd uit de bovenstaande methoden). Aangezien de hoeveelheid mitochondriaal DNA dat nodig is om een ​​standaardkromme te bereiden te hoog is om te bereiken met een redelijke hoeveelheid weefsel, gebruik geen kopie-aantalberekeningen die door de software worden geleverd, maar controleer in plaats daarvan de kruispunt (Cp) waarden om de relatieve verrijking te bepalen Van organellar vergeleken met nucleair DNA in de monsters. Vergelijk deze relatieve hoeveelheden met die van het totale genomische DNA (zie de representatieve resultaten ). Test primer efficiënties op vijf 1:10 verdunningen van totaal genomisch DNA uit volledig lichtgroeide, twee weken oude tarwe zaailingen (representatieve efficiëntie gemeld in thE legende van figuur 2 ).
    2. Pulsed-field gelelektroforese (PFGE)
      OPMERKING: Dit protocol is gebaseerd op fabrikant richtlijnen om PFGE uit te voeren om DNA met hoog molecuulgewicht op te lossen. Zie de materiaal tabel.
      1. Bereiding van de gel en monsters
        1. Volg de richtlijnen voor gel- en steekproefbereiding en pas ze aan op het beschikbare systeem.
      2. Voer de parameters uit
        1. Volg de richtlijnen voor het opstellen van het elektroforese systeem en gebruik de volgende parameters: startschakel tijd van 2 s, eindschakeltijd van 13 s, looptijd van 15 uur en 16 minuten, V / cm van 6 en opgenomen hoek van 120 ° .
      3. Vlek en beeld de gel
        1. Vlek de gel met een kleurstof van keuze ( bijvoorbeeld ethidiumbromide of een geschikt alternatief) en beeld met een geschikt gel documentatie systeem.
    3. Gebruik 1 ng DNA als de invoer voor de DNA Library Prep Kit, volgens de instructies van de fabrikant.
    4. Barcode en pool de monsters voor sequencing in een enkele run. Volg sequencing volgens de fabrikant richtlijnen.
      OPMERKING: De parameters voor pooling en sequencing kunnen veranderd worden, afhankelijk van de soorten, het gewenste dekkingsniveau en het platform waarmee de bibliotheken worden gesorteerd. Bijvoorbeeld, een HiSeq laan heeft veel meer output dan een MiSeq lane, zodat veel meer monsters kunnen worden gemultiplexeerd. Volg een kleinere subset van de monsters om te bepalen of de dekkingsniveaus van de organellaire genen geschikt zijn voor downstream analyse.
    5. Controleer de leeskwaliteit met behulp van FastQC 31 om de mate van trimmen en filteren die nodig zijn voor de gegevens te bepalen.
    6. Trim en filter de ruwe leest met behulp van Trimmomatic 32 of een ander vergelijkbaar programma. Gebruik de volgende instellingen: ILLUMINACLIP 2:30:10 (om adapters te verwijderen), LEIDING 3, TRAILING 3, SLIDINGWINDOW 4:10 en MINLEN 100.
    7. Breng de kwaliteit gefiltreerd en adaptor-bijgesneden gepaarde einde (PE) leest Chinese Spring mitochondriale (NCBI Reference Sequence NC_007579.1 33), chloroplast (NCBI Reference Sequence NC_002762.1 34), en kern 35 referentie genomen via Bowtie2 36, Met de volgende instellingen: -I 0 -X 800 - gevoelig.
    8. Zet de sam alignment bestanden om naar bam formaat (samtools) en sorteer de bam bestanden. Gebruik de bam-bestanden om de genoombrede dekking en de basisdekking te berekenen met bedtools. Visualiseer de resultaten met de R-plot-functie.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

De protocollen die in dit manuscript worden gepresenteerd beschrijven twee verschillende methoden om te verrijken voor organellair DNA uit plantweefsel. De hier voorgestelde condities weerspiegelen de optimalisatie voor tarweweefsel. Een vergelijking van de belangrijkste stappen in de protocollen, de benodigde weefselinvoer en de DNA-uitvoer worden beschreven in Figuur 1 . De stappen van het gelijkstroomprotocol dat we hebben getest, volgen vergelijkbare omstandigheden als die welke eerder zijn beschreven ( figuur 1A ). Geoogst weefsel moet vers worden verwerkt en onderworpen worden aan differentiële centrifugatie en / of gradiënten om intacte organellen te isoleren. Het nucleaire DNA wordt geëlimineerd voordat de organellen worden gelicht, en tenslotte wordt het DNA geëxtraheerd en gebruikt voor downstream toepassingen. In contrast, in het MF protocol kan plantweefsel worden geoogst en opgeslagen voor gebruik, en intacte organellen zijn niet nodig. In plaats daarvan wordt het nucleaire en organellaire DNA gefractioneerd uit totaal gDNA op basis van De methyleringsstatus van het DNA. Beide protocollen leveren ruwweg gelijke hoeveelheden organellair DNA ( Figuur 1C ). In termen van de totale organellaire DNA-output ten opzichte van weefselinvoer, is het MF-protocol voordelig wanneer weefsel beperkt is, aangezien een klein monster uit een enkele plant kan worden gebruikt en de plant mag worden toegelaten om te groeien voor verdere analyse. Typisch, in DC-protocollen zijn alle luchtweefsels van veel zaailingen nodig, en deze planten worden weggegooid. De DC-methode kan echter worden geoptimaliseerd om specifiek te verrijken voor één organel type over de andere, wat niet mogelijk is met de MF-aanpak. Het is vermeldenswaard dat de totale tijd voor elk protocol ongeveer gelijk is, hoewel er minder hands-on is in de MF-aanpak.

Beide methoden verrijken voor organellair DNA, alhoewel met verschillende proporties van mitochondria en plastidsequenties:

"> Zeer lage hoeveelheden gezuiverd organellair DNA worden verkregen uit een van beide methoden (in de orde van 50 tot 100 ng; Figuur 1C ). Om de niveaus van organische genoomverrijking en nucleaire genoomverontreiniging in DNA te beoordelen, dat is geïsoleerd van zowel de DC als MF Methoden, werd een qPCR-analyse toegepast. In deze analyse werden de relatieve overvloedigheden van drie ampliconen (dat wil zeggen nucleair-specifiek, ACTIN , mitochondrialspecifiek, NAD3 ; Chloroplast-specifiek, PSBB ) werden beoordeeld in totaal genomisch DNA en de organellaire DNA-fractie werd verkregen uit beide methoden ( Figuur 2 ). Kwantificatiecyclus (C q ) waarden werden onderzocht voor elk monster ( Figuur 2A ) en omdat de C q gedefinieerd is als de PCR cyclus, waarbij de fluorescentie van de doelwitversterking boven het fluorescentieniveau van de achtergrond stijgt, hebben C q en doelovervloed een Omgekeerde relatie. InHet DC-monster, de C q van NAD3 en PSBB zijn respectievelijk ~ 17 en ~ 15 cycli eerder dan ACTIN (die een C q van ~ 36 heeft) (zie Figuur 2B voor C q waarden en verrijking niveaus). Dit komt overeen met theoretische 167.181- en 47.790-voudige verrijking voor respectievelijk NAD3 en PSBB , Ten opzichte van ACTIN in het DC-monster ( Figuur 2B , zie de legende van Figuur 2 voor de berekening). In het totale genomische DNA-monster zijn de vouwverrijking voor NAD3 en PSBB ten opzichte van ACTIN slechts respectievelijk 158 en 10.701. Het is niet verrassend om een ​​hoger overvloed van de organellaire ampliconen ten opzichte van het nucleaire amplicon in totaal genomisch DNA te vinden, gezien de organellaire genen bestaan ​​in grotere kopie aantallen per cel dan het nucleaire genoom 37 en dat het aantal organellen pR cel kan verschillen afhankelijk van het weefsel type of de ontwikkelingsfase 38 , 39 . Over het geheel genomen geven de gegevens aan dat de DC-methode bij voorkeur verrijkt voor mitochondria, wat te verwachten is, aangezien centrifugatiesnelheden zijn geoptimaliseerd voor selectief isolatie van mitochondria en het verminderen van nucleaire en chloroplast "vervuiling".

De ongemetyleerde fractie van het totale gDNA van MF toont ook aanzienlijke verrijking van beide organellaire ampliconen en wordt verwacht dat de inheemse relatieve hoeveelheden van deze doelen behouden blijven. De vouwverrijking voor NAD3 en PSBB ten opzichte van ACTIN in de niet-gemethyleerde fractie zijn respectievelijk 20.551 en 1.703.253 ( Figuur 2A en 2B ). In de gemethyleerde fractie zijn de vouwverrijkingen voor NAD3 en PSBB ten opzichte van ACTIN respectievelijk 31 en 823, indiCating dat MBD2-Fc eiwit zeer efficiënt is bij de uitrol van methylated nucleair DNA. Aangezien het chloroplast amplicon een grotere overvloed heeft dan het mitochondriale amplicon in totaal genomisch DNA (~ 6 C q eerder), gemeten fractionering (~ 5 C q eerder) en ongemetyleerde fractie (~ 6 C q eerdere) monsters, suggereert dit dat de Inheemse overvloed van deze ampliconen wordt niet significant veranderd door MDB2 pulldown. Hierbij richten wij ons op de ongemetyleerde (organellaire) fractie vanwege de interesse om deze genen specifiek te sequentiëren. Echter, als het nucleaire genoom de primaire belangstelling is, zou MF en daaropvolgende sequentiebepaling van de gemethyleerde fractie een veel hogere nucleaire genoom dekking dan totale genomische DNA sequencing veroorzaken, door de vermindering van organellair DNA "besmetting".

Het is op te merken dat, als qPCR niet beschikbaar is, eindpunt-PCR (met dezelfde primers als voor qPCR) de qualitaTive assessment of organellar purity. In dit geval zullen zuivere organellaire DNA-monsters versterking voor de mitochondriale en plastide ampliconen tonen, maar geen detecteerbare amplificatie van het nucleaire amplicon op de agarosegel, terwijl totaal genomisch DNA amplificatie voor alle drie primer sets toont, zoals aangetoond in eerdere studies 11 , 12 .

Organellair DNA geïsoleerd uit beide methoden is geschikt voor NGS:

Afgeschermde en gereinigde PE sequentiebepaling leest (zie stap 4.3) werden toegewezen aan eerder gepubliceerde tarieforganellaire referentiemønten en de hoeveelheid lezingen die werden gebruikt voor het mappen van elk monster varieerde van ~ 800.000 tot 1.100.000 leest ( Figuur 3I ). Resultaten van de mapping de novo Illumina sequencing leest op de beschikbare tarwe chloroplast en mitochondria genen zijn consistent met de qPCR resUlts, waarbij de DC-methode DNA levert dat meer verrijkt is in mitochondriaal DNA ( Figuur 3A en 3B , respectievelijk 80% en 10% van de kaart naar respectievelijk de mitochondriale (mt) en chloroplast (cp) genoom) en de MF methode DNA opleveren die waarschijnlijk de inheemse overvloed van de twee organellaire genen weerspiegelt ( Figuren 3A en 3B , respectievelijk 20% en 80% van de kaart naar respectievelijk de mt- en cp-genen). In beide methoden overschrijdt de theoretische dekking (zie de legende van Figuur 3 voor de berekening) van beide organische genen van de tarwe meer dan 100x dekking (en varieert tot ~ 2.000X dekking voor het chloroplastgenoom in de niet-gemethyleerde fractie uit de MF-methode), zelfs Wanneer 12 bibliotheken worden gemultiplexeerd ( Figuur 3C en 3D ; de 6 bibliotheken die in deze analyse zijn opgenomen werden samengevoegd met een extra 6 bibliotheken voor een aparte analyse, voor een totaal van 12 bibliothekenSamengevoegd in een enkele sequencerbaan). Een meer gedetailleerd overzicht van de dekking werd bereikt door het onderzoek van de fractie van het genoom dat op specifieke dieptes wordt behandeld, evenals op basis van de dekkingsniveaus ( Figuur 3E -3I ). Voor de MF-methode was de gemiddelde basisbasis dekking ~ 300 - 450X voor het mt genoom en 4.000 - 5.000X voor het cp genoom. Voor de DC-methode was de gemiddelde per-basis dekking ~ 900 - 1.300 en ~ 500 - 700X voor respectievelijk de mt- en cp-genen. Er was echter een kleine fractie van zowel de mt- en cp-genen die zeer lage of hoge dekking hadden, en dit werd gezien in organellair DNA afgeleid van een van beide methoden ( Figuur 3I ). Regio's met een hogere dan de gemiddelde dekking komen waarschijnlijk overeen met regio's van homologie tussen de organellaire genoomen en regio's met een lage dekking kunnen SNP's of andere kleine varianten tussen de gekweekte cultivars en de gepubliceerde referenties aangeven. Ter ondersteuning van deze gedachte, deze spikesVan hoge dekking waren het meest uitgesproken voor het mt-DNA afgeleid van de MF-methode ( figuren 3E en 3I ), waarschijnlijk door de hoge dekking van het cp-genoom bij deze methode. Onverklaarbaar is de dekking van het cp-genoom meer ongelijk in de MF-methode dan de DC-methode ( Figuur 3G en 3H ), die te wijten zou kunnen zijn aan kleine voorspellingen in de MBD2-Fc-pulldown langs het cp-DNA. Verdere experimenten zullen nodig zijn om te bepalen waarom dit het geval is. Ongeacht, de mt en cp genen hadden relatief even dekking met beide methoden en geen grote gebieden van ontbrekende dekking, die kan worden aangetoond door het onderzoek van de fractie genomen die op een bepaalde diepte zijn gesekwestreerd ( Figuur 3E -3H ). Daarnaast worden de niveaus van dekking voor beide genen beschouwd als voldoende voor stroomafwaartse analyse, zoals variantanalyse. Indien nodig geacht voor de analyse van zeldzame varianten, vermindering van de numbeR van samengestelde monsters zou een grotere dekking bereiken. Als alternatief kan een veel groter aantal monsters op een HiSeq-laan worden samengevoegd, terwijl een nog grotere sequentiediepte bereikt wordt, alhoewel bij een opvolging op sequentielengte, als HiSeq-bibliotheken momenteel beperkt zijn tot de PE150-lengte in tegenstelling tot PE300 MiSeq-bibliotheken.

Om de niveaus van nucleaire genoomverontreiniging te onderzoeken met behulp van een mapping-aanpak, werden PE-mapping-categorieën onderzocht. PE-reads kunnen in een verscheidenheid aan configuraties naar een referentiegenoom plannen. Bij het lezen van 1 en 2 lijken de referenties op een kop-naar-hoofd-manier, met een bepaalde "verwachte" afstand tussen de twee mates (gebaseerd op de gemiddelde inzetgrootte van de bibliotheek en typisch aangeduid als een invoerparameter in de mapprogramma ), Deze PE leest gezegd te worden "concordantly." In tegenstelling hiermee is "discordant" mapping de situatie waar mapjes met een minder of groter dan verwacht dis worden samengesteldTantieme aan het referentiegenoom of de kaart in alternatieve configuraties (hoofd-naar-staart of tail-to-tail). Als er maar één mate in lijn staat met het referentiegenoom, dan wordt dat PE gelezen, noch concordant of discordant aan het referentiegenoom gekoppeld. In alle drie lees-mappingcategorieën kunnen PE-lezingen één of meerdere keren overeenkomen met het referentiegenoom.

Voor zowel DC- als MF-geïsoleerde organellair DNA was lees-mapping naar het mitochondriale genoom voornamelijk in de uitgelijste concordant one-time categorie ( Figuur 4A ), terwijl lezingen die in het chloroplastgenoom in relatief gelijke proporties van concordant een keer worden toegewezen en concordant meer dan Één keer ( Figuur 4B ), waarschijnlijk door de grote omgekeerde herhalingen die aanwezig zijn in het chloroplastgenoom en ook op de extreem hoge dekkingsniveaus. Echter, minder PE leest in kaart gebracht naar het nucleaire genoom en wordt grotendeels meer dan één keer in een map toegewezenNoch concordante of discordante mode ( dwz alleen één partner kan kaarten). Deze zijn meest waarschijnlijk in kaart brengen van "off-target" naar sequenties in het nucleaire genoom, die homoloog zijn voor de organellaire genen of misassembled gebieden. Slechts een geringe hoeveelheid leest (<5%) toegewezen aan het nucleaire genoom concordantly, waaruit een lage verontreinigingsniveaus kerngenoom in organellen DNA geïsoleerd uit het DC MF werkwijze (Figuur 4C), zoals ook blijkt uit de qPCR resultaten (Fig 2A ). De nucleaire fractie na MBD2-Fc-afname van Chinese niet-geëtiolideerde weefsels werd ook gehersequentieerd om te bepalen hoe efficiënt de pulldown is bij de verwijdering van niet-gemmethyleerde DNA. Minder dan 1% van leest in de nucleaire fractie afgeleide bibliotheek die is toegewezen aan organellaire referentie genen, terwijl ~ 45% van alle lezingen die zijn toegewezen aan het nucleaire genoom ( Figuur 4 ). De meeste leest echter op een discordante manier in kaart gebracht, wDie waarschijnlijk de hoge niveaus van misassemblatie en fragmentatie in het nucleaire referentiegenoom van tarwe waarschijnlijk weerspiegelt. Hoe dan ook, de resultaten suggereren dat de MBD2-Fc pulldown zeer efficiënt is bij het verwijderen van niet-gemmethylateerd organellair DNA uit gemethyleerd nucleair DNA. Het is opmerkelijk dat omdat het organellair verrijkte DNA dat uit deze methoden voortvloeit, een mengsel van mitochondria en chloroplastsequenties bevat, en omdat sequentie-overeenkomsten die voortvloeien uit de oude genoverdracht tussen deze organellen in hun genoom blijven, leest de juiste opdracht van de specifieke Genen moeten bioinformatisch opgelost worden.

De Etiolatie van Bladweefsel verandert niet opvallend Organelle Abundances:

Traditioneel zijn geëtioceerde weefsels de voorkeur voor plant mitochondriale DNA-isolatie om de niveaus van fenolica en zetmeel te verminderen, die extraction kunnen interfererenN of downstream toepassingen 13 . Om te bepalen of organische genoomverrijkingsniveaus kunnen veranderd of verbeterd worden door groeivoorwaarden, werden zowel geëtiolideerde en niet-geëtiolideerde weefsels onderworpen aan het MF protocol en sequentiebepaling. Interessant genoeg veranderde etiolatie niet het percentage leest dat in kaart gebracht werd op de organellaire referentie genen ( Figuren 3A en 3B ) of de per-basis dekking ( Figuur 3I ) in vergelijking met niet-geëtiolideerde omstandigheden. We isoleren ook organellair DNA met behulp van differentiële centrifugatie, met zowel geëtolateerde en niet-geëtiolideerde weefsels, en er is weinig verschil in verrijking gevonden tussen de verschillende weefsels met behulp van qPCR (data niet getoond). Dit suggereert dat meer fysiologisch relevante niet-gefiltreerde weefsels kunnen worden gebruikt voor organellaire sequencingstudies zonder significante verandering van verrijking.

Quality Control stelt dat voorMF DNA is het meest geschikt voor langlezen sequencing:

Aangezien langlose sequencing meer toegankelijk wordt voor onderzoekers, wordt de isolatie van DNA met hoog molecuulgewicht steeds belangrijker. Om organellair DNA te beoordelen dat was geïsoleerde met een van beide methoden voor intactheid en kwaliteit, werd PFGE gebruikt. Totaal genomisch DNA migreert typisch als een diffuse smeer in PFGE, en het molecuulgewicht wordt bepaald door het protocol en hoe het DNA werd opgeslagen en na-extractie behandeld. Het totale genomische DNA dat door middel van genomische tips wordt geïsoleerd, moet hoger zijn dan 50 kb, die werd geverifieerd met behulp van PFGE ( Figuur 5 , baan 2). Het totale genomische DNA van de genomische tips wordt gebruikt als de invoer in de Microbiome Enrichment Kit om het nucleair van organellair DNA te fractioneren. De nucleaire fractie verkregen na fractionering neemt af van grootte, maar blijft ongeveer 50 kb centraal ( Figuur 5 , baan 4). Dit is niet zoOmdat de relatief grovere behandeling van de nucleaire fractie als elutie van MBD2-Fc-gebonden kralen warmte- en protease-K-digestie vereist. Door de beperkte massa werd de organellaire fractie niet uitgevoerd op PFGE, maar de volgende analyse met de TapeStation gaf DNA> 50 kb aan (data niet getoond). Het organellair DNA verkregen met differentiële centrifugatie heeft een gemiddelde massa van ~ 20 kb, waarschijnlijk veroorzaakt door het uitgebreide organellaire isolatieprotocol en de daaropvolgende kolom gebaseerde DNA-extractie en concentratie. Gradiëntgebaseerde organellaire isolatie en alternatieve DNA-extractiemethoden kunnen grotere DNA-fragmentgroottes handhaven. Hoe dan ook, DNA van de grootte die in dit protocol wordt verkregen, kan worden gebruikt om 10- of 15-kb sequencing te genereren, leest als er zorg wordt genomen tijdens de voorbereiding van de bibliotheek.

Figuur 1
Figuur 1: een vergelijkende weergave van twee methoDs om te verrijken voor plant organellair DNA. Een traditioneel gelijkstroomprotocol ( A ) is in strijd met het MF protocol ( B ). Het wordt aangeraden om de monsters te bevriezen en te ontdoen; Stappen waarbij de monsters op lange termijn kunnen worden opgeslagen, worden echter aangegeven met stippelpijlen ( A en B ). Belangrijkste verschillen tussen de protocollen worden in rode ( B ) gemarkeerd. ( C ) De tabel vergelijkt de methoden in termen van weefselinvoer, aantal benodigde planten, DNA-uitvoer, en resulterende DNA-grootte. Klik hier om een ​​grotere versie van deze figuur te bekijken.

Figuur 2
Figuur 2: Beoordeling van nucleaire DNA-verontreiniging in organellair DNA geïsoleerd met behulp van twee methoden. ( q (Y-as) is de PCR cyclus waarbij de fluorescentie van de doelversterking stijgt boven het fluorescentieniveau van de achtergrond. ACTIN is een nucleair specifiek doelgen, en respectievelijk NAD3 en PSBB zijn respectievelijk mitochondrië- en chloroplast. De foutbalken geven de standaardafwijking aan tussen drie technische replicaten van elk monster. DC-differentiële centrifugatie methode, niet gemetyleerde fractie DNA dat niet gebonden is aan MBD2-Fc, Totaal gDNA-genomisch DNA dat niet behandeld is met MBD2-Fc, gemetileerde fractie DNA gebonden door MBD2-Fc.
( B ) De tabel toont de C q waarden, die op de grafiek in ( A ) en de vouwverrijking van de organellaire ampliconen ten opzichte van ACTIN worden weergegeven . * Vouwverrijking = 2 (Cq ACTIN - Cq Target) . De formule veronderstelt een perfecte efficiëntie van 2 voor elke primer set, sinds de kleine deviatIonen van elke primer die van 2 is ingesteld is verwaarloosbaar en zou weinig effect hebben op de berekening en de algemene trend ( ACTIN = 1.961, NAD3 = 1.95 en PSBB = 1.989 ). Primer efficiënties werden geëvalueerd door een standaard curve te maken met een reeks van vijf 1:10 verdunningen van het totale genomische DNA. Klik hier om een ​​grotere versie van deze figuur te bekijken.

Figuur 3
Figuur 3: Lees Mapping en Theoretische Dekking van Chloroplast en Mitochondriale Genomes. Percentage van lezingen die zijn toegewezen aan de mitochondriale ( A ) of chloroplast ( B ) Chinese Spring referentie genen. Corresponderende theoretische dekking van de Chinese mitochondriale ( C ) of chloroplast ( D ) referentie genoMes, met inachtneming van genoomgrootten van respectievelijk 450 en 135 kb, berekend aan de hand van de totale leesgetallen en het percentage leest mapping naar de verschillende genen. Genoom-brede verspreiding van de dekking voor organellair DNA uit de MF-methode ( E en G ) of de DC-methode ( F en H ). De gegevens in panelen E - H komen uit het Chinese voorjaar geëtolateerde monster, maar alle andere monsters vertoonden een soortgelijke trend. ( I ) Gemiddelde, laagste en hoogste basisdekking voor alle monsters in panelen A - D. Voorbeeldlabels inclusief "E" wijzen geëtolideerde monsters aan, en "NE" wijst niet-geëtiolideerde monsters aan. DC geeft aan dat DNA geïsoleerde is met de differentiaalcentrifugatiemethode en Unmethylated geeft DNA aan dat in de niet-gemethyleerde fractie is, na het uitrollen met MBD2-Fc (MF protocol). Monsters gemerkt "Chris" wijzen tarwe Triticum aestivum aan'Chris.' CS benoemt monsters van de Triticum aestivum 'Chinese Lente. Opmerking: Vanwege de homologie van de sequentie tussen de chloroplast, mitochondria en nucleaire genen die voortvloeien uit de oude genoverdracht tussen de organellaire genen, alsmede tussen de organellaire en nucleaire genen, kan een klein percentage ruwe lezingen de kaart naar meerdere genen plakken. Daarnaast leest die geen map voor het orga- nellaire referentiegenoom niet in deze figuur worden weergegeven. Vandaar dat de hier weergegeven percentages ( A en B ) niet 100% bedragen. Klik hier om een ​​grotere versie van deze figuur te bekijken.

Figuur 4
Figuur 4: PE-read-mapping naar het kerngenoom van de tarwe. Percentage categorieën PE Lees mapping typen naar de mitochondriale (A) , chloroplast (B) , of nucleaire (C) Chinese Spring referentie genen. - E wijst geëtolideerde monsters en - NE wijst niet-getiideerde monsters aan. DC geeft aan dat DNA geïsoleerde is met de differentiaalcentrifugatiemethode. Unmethylated geeft DNA aan dat in de niet-gemethyleerde fractie is, na het uitrollen met MBD2-Fc in het MF-protocol, en Methylated wijst de nucleaire fractie na MBD2-Fc pulldown aan. Monsters gemerkt "Chris" wijzen tarwe Triticum aestivum 'Chris' aan. CS geeft monsters van tarwe Triticum aestivum 'Chinese Spring' aan. Unmapped reads worden niet getoond. Klik hier om een ​​grotere versie van deze figuur te bekijken.

Oad / 55528 / 55528fig5.jpg "/>
Figuur 5: Onderzoek van DNA Kwaliteit met behulp van PFGE. Het gehele genomische DNA van de tarwe (laan 2), het organische DNA van de tarwe, verkregen bij differentiële centrifugatie (laan 3), en de nucleaire fractie na MF met de MBD2-Fc pulldown-aanpak (laan 4) werden onderworpen aan PFGE op een 1% agarosegel met een 1 kb verlengde ladder gebruikt als markering (rijstroken 1 en 5). Klik hier om een ​​grotere versie van deze figuur te bekijken.

Buffer naam Recept Notes Methode
STE buffer 400 mM sucrose, 50 mM Tris pH 7,8, 20 mM EDTA pH 8,0, 0,6% (w / v) polyvinylpyrrolidon (PVP), 0,2% (w / v) runder serumalbumine (BSA), 0.1% (v / v) P-mercaptoethanol (BME) Buffermengsel die alleen sacharose, Tris en EDTA bevat, kan tot een maand van tevoren worden opgemaakt en bij 4 ° C gehouden. PVP, BSA en BME moeten vers worden toegevoegd aan een aliquot van de benodigde hoeveelheid buffer net voor gebruik. Methode # 1
ST buffer 400 mM sucrose, 50 mM Tris pH 7,8, 0,6% (w / v) polyvinylpyrrolidon (PVP), 0,1% (w / v) runder serumalbumine (BSA) Buffermengsel die alleen sacharose en Tris bevat, kan tot een maand van tevoren worden opgemaakt en bij 4 ° C gehouden. Merk op dat de ST buffer geen EDTA of BME bevat en een lagere concentratie BSA bevat. Methode # 1
DNase voorraad 2 mg / ml DNase in 0,15 M NaCl tot een voorraadconcentratie van 2 mg / ml Bewaar 200 μl aliquots bij -20 ° C. Om DNase werkoplossing voor te bereiden (200 μl DNase oplossing per monster) zieTabel 1 hieronder. Zie het volledige protocol hieronder voor volledige details over DNase-spijsvertering. DNase-werkoplossing moet vers worden bereid. Om de DNase-reactie te stoppen is een oplossing van 400 mM EDTA pH 8,0 vereist (de uiteindelijke concentratie die nodig is om de reactie te stoppen is 0,2 M EDTA, zie volledige protocol voor details). Methode # 1
DNase werkoplossing 0,25 mg / ml DNase en 20 mM MgCl2 in ST Buffer Bereid vers, 200 μl per monster. Concentraties voorbeeld voor de uiteindelijke reactievolume, zodat mengen: 62,5 ui 2 mg / ml DNase (gebaseerd op definitieve 500 ui reactievolume), 4 ui 1 M MgCI2 (op basis van 200 ul DNase oplossingsvolume) en 133,5 ui ST buffer Een eindvolume van 200 μl. Methode # 1
Lysisbuffer 20 mM EDTA pH 8,0; 10 mM Tris pH 7,9; 500 mM guanidine-HCI; 200 mM NaCl; 1% Triton X-100; 0,5 mg / ml lysende enzymen uitTrichoderma harzianum Meng alle ingrediënten met uitzondering van lysende enzymen en sla ze bij kamertemperatuur op. Lysende enzymen moeten vers worden toegevoegd aan een kleine aliquot voor onmiddellijk gebruik. Methode # 2

Tabel 1: Recepten van zelfgemaakte buffers en werkvoorraden.

Concentratie Werkblad
SAMPLE NAME Leeg apparaat gewicht (g) Gewicht van Gevulde Apparaat (g) Gevuld Volume (ul, gevuld minus lege gewichten) Gewicht na 1e spin (20 min *, g) Volume na 1e Spin (ul, gevuldMinus lege gewichten) Gewicht na 2e Spin (X min *, g) Volume na 2e Spin (ul, gevuld minus lege gewichten)
Merk op dat het daadwerkelijk herstelde volume een paar ul minder dan het berekende volume zal zijn.

Tabel 2: Concentratie Werkblad.

Naam Genoom Specificiteit Gene Sequence Source Sequentie (5 '- 3')
Ta_ACTIN - F nucleair Gramene Steiger IWGSC_CSS_1AS_scaff_3272162: 10,663-12,557 CAGGTATCGCTGACCGTATGA
Ta_ACTIN - R nucleair Hetzelfde als hierboven GAAGGTAGGGCTGAACAAGAAAC
Ta_NAD3 - F mitochondriale Toetreding NCBI EU534409.1 GGTGATGCCAGAAGTCGTTT
Ta_NAD3 - R mitochondriale Hetzelfde als hierboven CAGATCAATCTTGTTAGGAGGTACTG
Ta_PSBB - F chloroplast NCBI toetreding KJ592713.1 GCTACCTTTGCTTTGCTCTTCT
Ta_PSBB - R chloroplast Hetzelfde als hierboven GCTGCCTGTTTCCTTGTAGTT

Tabel 3: Lijst met qPCR Primers.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Tot op heden hebben de meeste organellaire sequencing studies een centrum voor traditionele DC-methoden om te verrijken voor specifiek DNA. Methoden om organellen van diverse planten te isoleren zijn beschreven, waaronder mos 40 ; Monocots zoals tarwe 15 en haver 11 ; En dicots zoals arabidopsis 11 , zonnebloem 17 en raapzaad 14 . De meeste protocollen richten zich op bladweefsel 13 , 14 , 15 , 16 , 17 , waarbij sommige zijn aangepast voor verschillende soorten weefsels, waaronder zaden 11 . De isolatie van organellen uit protoplasten is ook aangetoond 41 . Dit is echter niet aan alle systemen vatbaar, en ook niet mogelijk wanneer het weefsel van belang is beperkt. Veel van deze orgaNellaire isolatiemethoden werden ontworpen om intacte organellen te herstellen voor specifieke experimenten, zoals fysiologische studies. Deze protocollen zijn omslachtig en hebben meestal gebruik van dichtheidsgradiënten, zoals sucrose of Percoll-gradiënten, die zeer efficiënt zijn om specifieke organellaire fracties te isoleren, maar hebben een grote weefselinbreng nodig ( dwz meer dan 5 g en meer dan kilogram, afhankelijk van Het weefsel type). De DC-methode kan echter worden geoptimaliseerd om te verrijken voor specifieke cellulaire fracties, zoals de mitochondria of chloroplast, door veranderende spoed snelheden en dichtheidsgradienten te veranderen. Daarentegen vereist de MF-aanpak veel minder uitgangsmateriaal (20 mg), maar mitochondriale en plastide-DNA's zullen aanwezig zijn op hun relatieve overvloed in het weefsel dat wordt gebruikt voor DNA-extractie. Niettemin biedt het MF protocol een alternatieve aanpak voor het isoleren van gemengd organellair DNA en is bijzonder gunstig voor het beginnen met kleine hoeveelheden weefsel.

T O beoordelen de zuiverheid van de monsters na de isolatie van de organen, de meeste studies tot op heden gebruiken alleen eindpunt-PCR en gelelektroforese 11 , 12 . Dit geeft een eerlijke kwalitatieve maatregel van zuiverheid. Echter, lage niveaus van amplificatie worden mogelijk niet weergegeven op een agarosegel. Enkele rapporten bevatten meer kwantitatieve maatregelen van kwaliteitscontrole, zoals qPCR 14 . Voor een kwantitatieve beoordeling van de DNA-monstersecurity die uit beide methoden werd geïsoleerd, hebben we qPCR en sequencing gebruikt om te bepalen hoeveel nucleair DNA in het monster blijft, evenals de relatieve proporties van mitochondriale versus chloroplast DNA. Beide methoden die hier worden beoordeeld zijn efficiënt bij het verwijderen van nucleair DNA. Beide methoden geven een mix van mitochondriale en chloroplast-DNA, al in verschillende verhoudingen.

Groeiende planten in het donker (etiolatie) wordt gerapporteerd om organellaire isolatie te helpen vergemakkelijken door een vermindering van fenolicaRef "> 13. In deze vergelijking vonden we echter geen opmerkelijk voordeel om met geëtolateerd weefsel te werken op lichtgroeiende monsters. Hoewel het aandeel van gespecialiseerde chloroplasten waarschijnlijk hoger zal zijn bij lichtgroei, dan is het totale plastidetal, zoals Weerspiegeld in het aandeel van de mapping naar het chloroplastgenoom, is ongewijzigd onder verschillende lichtomstandigheden. Daarom adviseren we voor het uitvoeren van genomische sequencing op downstream functionele analyses, zoals de beoordeling van heteroplasmie in verschillende weefsels of onder verschillende stressoren of voor expressieanalyses. Planten geteeld onder fysiologisch relevante omstandigheden.

Voor toepassing met kortlose sequencing technologieën, leveren beide technieken in vergelijking hierbij voldoende DNA hoeveelheid en kwaliteit. Om lange lezingen van> 20 kb te bereiken voor single-molecule sequencing toepassingen, is echter een grotere hoeveelheid DNA van hogere kwaliteit noodzakelijk. Bijvoorbeeld, ideaal,> 1 μg pure orgaNellair tarwe DNA met een molecuulgewicht> 20 kb is nodig voor in-house, low-input protocollen voor 20-kb insert bibliotheekpreparaten 42 . Nieuwe, door gebruikers ontwikkelde, lage-invoerprotocollen kunnen de vereisten van DNA verminderen (dat wil zeggen tot 50 ng of zelfs minder 20 ), maar de uitdaging blijft hoogwaardig DNA met hoge molecuulgewicht in de bibliotheekpreparaten. Het is essentieel dat een meerderheid van het DNA> 20 kb is, aangezien kleinere fragmenten bij voorkeur in de SMRTbell worden ingevoegd en de grootteverdeling van de bibliotheek 43 afwerpen. We hebben een aantal zelfgemaakte DNA-extractieprotocollen geprobeerd en een aantal commerciële protocollen voor DNA-extractie (niet getoond). Voor weefselbladweefsel werd het beste evenwicht tussen DNA-kwantiteit en kwaliteit, met name lengte, verkregen onder gebruikmaking van een commerciele kit 27 , 29 . Afhankelijk van de plantensoorten en weefsels van belang, alternatievenDe extractieprotocollen kunnen even geschikt of vruchtbaar zijn. Desalniettemin concluderen we dat de totale extractie van genomisch DNA met een molecuulgewicht van> 50 kb, gevolgd door fractionering met de MBD2-Fc pulldown benadering 28 , geschikt is voor langlezen sequentiebepaling van beperkt uitgangsmateriaal. Toekomstig werk dient de grenzen van het uitgangsmateriaal te testen die nodig is voor de volgende fractionering voor het langzetten van de bibliotheekbereiding en de daaropvolgende langlose sequencing. Kritisch kan deze aanpak een robuuste methode verschaffen om DNA te isoleren uit een subsample van een enkel blad dat geschikt is voor langlezen sequentiebepaling, zonder gehele genoom amplificatie. We anticiperen dat deze aanpak gemakkelijk kan worden aangepast aan aanvullende weefselsoorten en breed toepasselijk is op andere plantensoorten. Het zal bijzonder nuttig zijn in situaties waar de weefselhoeveelheden beperkt zijn, zoals sequentiebepaling bij individuele generaties in een kruisingsschema of in zeldzame weefseltypes.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs verklaren dat ze geen concurrerende belangen hebben.

Het vermelden van handelsnamen of handelsproducten in deze publicatie is uitsluitend bedoeld om specifieke informatie te verstrekken en betekent geen aanbeveling of goedkeuring door het Amerikaanse ministerie van Landbouw. USDA is een leverancier van gelijke kansen en werkgevers.

Acknowledgments

We zouden graag financiering willen ontvangen van het ministerie van Landbouw en Landbouwonderzoek van de Verenigde Staten en van de National Science Foundation (IOS 1025881 en IOS 1361554). Wij danken R. Caspers voor het onderhoud van kassen en plantenzorg. We danken ook het University of Minnesota Genomics Center, waar de Illumina bibliotheek voorbereidingen en sequencing werden uitgevoerd. We zijn ook dankbaar voor de opmerkingen van de tijdschriftenredacteurs en vier anonieme reviewers die ons manuscript verder versterken. We danken OECD ook voor een schenking aan SK om deze protocollen te integreren voor samenwerkingsprojecten met collega's in Japan.

Materials

Name Company Catalog Number Comments
2-mercaptoethanol (beta-mercaptoethanol; BME) Sigma Aldrich M3148-100ml
2-propanol (Isopropyl alcohol/isopropanol), bioreagent Sigma Aldrich I9516
agarose, Bio-Rad Cetified Megabase agarose Bio-Rad 1613108
analytical balance Mettler Toledo AB54-S
balance Mettler Toledo PB1502-S
bovine serum albumin (BSA) Sigma Aldrich B4287-25G
Ceramic grinding cylinders, 3/8in x 7/8in SPEX SamplePrep 2183
Cryogenic Blocks compatible with tissue homogenizer for holding 50 mL tubes SPEX SamplePrep 2664
DNaseI Sigma DN25
ethanol, absolute Decon Laboratories 2716
Ethylenediamine Tetraacetic Acid (EDTA), 0.5 M Solution, pH 8.0 Fisher BP2482-500
gel imaging system
gel stain Such as GelRed or Ethidium Bromide
grinding pestle, wide tip for 2 mL conical tubes
Guanidine-HCl, 8 M solution ThermoFisher 24115
LightCycler 480 SYBR Green I Master Roche 4707516001
liquid nitrogen
Lysing enzymes from Trichoderma harzianum Sigma L1412
Magnesium Chloride G Bioscience 24115
magnetic rack ThermoFisher A13346
microcentrifuge tubes, LoBind 1.5 mL  Eppendorf 22431021
microcentrifuge tubes, standard nuclease-free 1.5 mL Eppendorf
microcentrifuge, refrigerated Sorvall  Legend X1R Or equivalent product, must be capable of reaching at least 18,000 x g with rotors for 50 mL tubes, Oak Ridge tubes, and 1.5 mL tubes
microcentrifuge, room temperature Eppendorf 5424 Or equivalent product, must be capable of reaching at least 18,000 x g with rotor for 1.5 mL and 2 mL microcentrifuge tubes
Microcon DNA Fast Flow Centrifugal Filter Units EMD Millipore MRCFOR100
Miracloth, 1 square per sample cut to fit funnel EMD Millipore 475855
NEBNext Microbiome DNA Enrichment Kit New England Biolabs E2612L
parafilm Parafilm M PM992
plastic pots and trays
polyvinylpyrrolidone (PVP) Fisher BP431-100
Proteinase K Qiagen 19131
Pulsed-Field Gel Electrophoresis rig (e.g. CHEF DR III) Bio-Rad 1703697
purification beads, Agencourt AMpureXP beads Beckman Coulter A63881
QIAamp DNA Mini Kit Qiagen 51304
Qiagen 20/g Genomic Tip DNA Extraction Kit Qiagen 10223
Qiagen Buffer EB (elution buffer) Qiagen 19086
Qiagen DNA Extraction Buffer Set Qiagen 19060
QiaRack Qiagen 19015
qPCR machine (e.g. Roche Light Cycler 480) Roche
qPCR plate sealing film Roche 4729757001
qPCR plate, 96 well plate Roche 4729692001
Qubit assay tubes Life Technologies Q32856
Qubit Broad Spectrum assay kit Life Technologies Q32850
Qubit High Sensitivity assay kit Life Technologies Q32851
RNaseA Qiagen 19101
Serological pipettes (20 mL) and pipet-aid Fisher 13-678-11
Small funnels, 1 per sample
Sodium Chloride Ambion AM9759
Soft paintbrush, 2 per sample
SPEX SamplePrep 2010 Geno/Grinder or another type of tissue homogenizer SPEX SamplePrep Or another comparable tissue homogenizer. If you do not have access to a tissue homogenizer, then grinding in a pre-chilled mortar and pestle will suffice (see protocol for details). However, a homogenizer will give more consistent results and total homogenization time is reduced.
Sucrose Omnipure 8550
TBE
thermomixer
Tris Sigma T2819-100ml
Triton X-100 Promega H5142
tube rotater
tubes, 50 mL conical polypropylene Corning 352070
tubes, 50 mL high-speed polypropylene  ThermoScientific/Nalgene 3119-0050 e.g. Nalgene Oakridge tubes or equivalent
vermiculite
water bath
water, sterile and certified Nuclease-free  Fisher 1481
water, sterile milliQ

DOWNLOAD MATERIALS LIST

References

  1. Liberatore, K. L., Dukowic-Schulze, S., Miller, M. E., Chen, C., Kianian, S. F. The role of mitochondria in plant development and stress tolerance. Free Radic Biol Med. 100, 238-256 (2016).
  2. Samaniego Castruita, J. A., Zepeda Mendoza, M. L., Barnett, R., Wales, N., Gilbert, M. T. Odintifier--A computational method for identifying insertions of organellar origin from modern and ancient high-throughput sequencing data based on haplotype phasing. BMC Bioinformatics. 16, (232), 1-13 (2015).
  3. Zhang, T., Zhang, X., Hu, S., Yu, J. An efficient procedure for plant organellar genome assembly, based on whole genome data from the 454 GS FLX sequencing platform. Plant Methods. 7, (38), 1-8 (2011).
  4. Wambugu, P. W., Brozynska, M., Furtado, A., Waters, D. L., Henry, R. J. Relationships of wild and domesticated rices (Oryza AA genome species) based upon whole chloroplast genome sequences. Sci Rep. 5, (13957), 1-9 (2015).
  5. Iorizzo, M., et al. De novo assembly of the carrot mitochondrial genome using next generation sequencing of whole genomic DNA provides first evidence of DNA transfer into an angiosperm plastid genome. BMC Plant Biol. 12, (61), 1-17 (2012).
  6. Park, S., et al. Complete sequences of organelle genomes from the medicinal plant Rhazya stricta (Apocynaceae) and contrasting patterns of mitochondrial genome evolution across asterids. BMC Genomics. 15, (405), 1-18 (2014).
  7. Skippington, E., Barkman, T. J., Rice, D. W., Palmer, J. D. Miniaturized mitogenome of the parasitic plant Viscum scurruloideum is extremely divergent and dynamic and has lost all nad genes. Proc Natl Acad Sci U S A. 112, (27), E3515-E3524 (2015).
  8. Wicke, S., Schneeweiss, G. M. Chapter 1. Next Generation Sequencing in Plant Systematics. Hörandl, E., Appelhans, M. Koeltz Scientific Books. (2015).
  9. Sloan, D. B. One ring to rule them all? Genome sequencing provides new insights into the 'master circle' model of plant mitochondrial DNA structure. New Phytol. 200, (4), 978-985 (2013).
  10. Woloszynska, M. Heteroplasmy and stoichiometric complexity of plant mitochondrial genomes--though this be madness, yet there's method in't. J Exp Bot. 61, (3), 657-671 (2010).
  11. Ahmed, Z., Fu, Y. B. An improved method with a wider applicability to isolate plant mitochondria for mtDNA extraction. Plant Methods. 11, (56), 1-11 (2015).
  12. Ejaz, M., et al. Comparison of small scale methods for the rapid and efficient extraction of mitochondrial DNA from wheat crop suitable for down-stream processes. Genet Mol Res. 13, (4), 10320-10331 (2014).
  13. Eubel, H., Heazlewood, J. L., Millar, A. H. Isolation and subfractionation of plant mitochondria for proteomic analysis. Methods Mol Biol. 355, 49-62 (2007).
  14. Hao, W., Fan, S., Hua, W., Wang, H. Effective extraction and assembly methods for simultaneously obtaining plastid and mitochondrial genomes. PLoS One. 9, (9), e108291 (2014).
  15. Pomeroy, M. K. Studies on the respiratory properties of mitochondria isolated from developing winter wheat seedlings. Plant Physiol. 53, (4), 653-657 (1974).
  16. Taylor, N. L., Stroher, E., Millar, A. H. Arabidopsis organelle isolation and characterization. Methods Mol Biol. 1062, 551-572 (2014).
  17. Triboush, S. O., Danilenko, N. G., Davydenko, O. G. A method for isolation of chloroplast DNA and mitochondrial DNA from Sunflower. Plant Mol Biol Rep. 16, (2), 183-189 (1998).
  18. Pinard, R., et al. Assessment of whole genome amplification-induced bias through high-throughput, massively parallel whole genome sequencing. BMC Genomics. 7, (216), 1-21 (2006).
  19. Lamble, S., et al. Improved workflows for high throughput library preparation using the transposome-based Nextera system. BMC Biotechnol. 13, (104), 1-10 (2013).
  20. Raley, C., et al. Preparation of next-generation DNA sequencing libraries from ultra-low amounts of input DNA: Application to single-molecule, real-time (SMRT) sequencing on the Pacific Biosciences RS II. bioRxiv. (2014).
  21. Tsai, Y. C., et al. Resolving the Complexity of Human Skin Metagenomes Using Single-Molecule Sequencing. MBio. 7, (1), e01948 (2016).
  22. Feehery, G. R., et al. A method for selectively enriching microbial DNA from contaminating vertebrate host DNA. PLoS One. 8, (10), e76096 (2013).
  23. Yigit, E., Hernandez, D. I., Trujillo, J. T., Dimalanta, E., Bailey, C. D. Genome and metagenome sequencing: Using the human methyl-binding domain to partition genomic DNA derived from plant tissues. Appl Plant Sci. 2, (11), 1-6 (2014).
  24. Noyszewski, A. K., et al. Accelerated evolution of the mitochondrial genome in an alloplasmic line of durum wheat. BMC Genomics. 15, (67), 1-16 (2014).
  25. Qiagen. QIAamp DNA Mini and Blood Mini Handbook. 5th ed, Available from: https://www.qiagen.com/ch/resources/ (2016).
  26. E.M. Corporation. User Guide: Microcon Centrifugal Filter Devices. Available from: http://www.emdmillipore.com/US/en/product/Microcon-DNA-Fast-Flow-Centrifugal-Filter-Unit-with-Ultracel-membrane,MM_NF-MRCF0R100 (2013).
  27. Qiagen. User developed protocol: Isolation of genomic DNA from plants and filamentous fungi using the QIAGEN Genomic-tip - (EN). Available from: https://www.qiagen.com/ch/resources/ (2001).
  28. New England BioLabs, Inc.. NEBNext Microbiome DNA Enrichment Kit: Instruction Manual Version 4.0. Available from: http://www.neb.com/~/media/Catalog/All-Products/371BCB5A557C462D95D1E45E15BBFEA3/Datacards or Manuals/E2612Manual.pdf (2015).
  29. Qiagen. QIAGEN Genomic DNA Handbook. Available from: https://www.qiagen.com/ch/resources/ (2012).
  30. PacificBiosciences. Guidelines for Using the BIO-RAD® CHEF Mapper® XA Pulsed Field Electrophoresis System. Available from: http://www.pacb.com/wp-content/uploads/Unsupported-Guidelines-Using-BIO-RAD-CHEFMapper-XA-Pulsed-Field-Electrophoresis.pdf (2016).
  31. Andrews, S. FastQC: A quality control tool for high throughput sequence data. Available from: http://www.bioinformatics.babraham.ac.uk/projects/fastqc/ (2016).
  32. Bolger, A. M., Lohse, M., Usadel, B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics. 30, (15), 2114-2120 (2014).
  33. Ogihara, Y., et al. Structural dynamics of cereal mitochondrial genomes as revealed by complete nucleotide sequencing of the wheat mitochondrial genome. Nucleic Acids Res. 33, (19), 6235-6250 (2005).
  34. Ogihara, Y., et al. Structural features of a wheat plastome as revealed by complete sequencing of chloroplast DNA. Mol Genet Genomics. 266, (5), 740-746 (2002).
  35. International Wheat Genome Sequencing Consortium (IWGSC). A chromosome-based draft sequence of the hexaploid bread wheat (Triticum aestivum) genome. Science. 345, (6194), (2014).
  36. Langmead, B., Salzberg, S. L. Fast gapped-read alignment with Bowtie 2. Nat Methods. 9, (4), 357-359 (2012).
  37. Bendich, A. J. Why do chloroplasts and mitochondria contain so many copies of their genome? Bioessays. 6, (6), 279-282 (1987).
  38. Kumar, R. A., Oldenburg, D. J., Bendich, A. J. Changes in DNA damage, molecular integrity, and copy number for plastid DNA and mitochondrial DNA during maize development. J Exp Bot. 65, (22), 6425-6439 (2014).
  39. Ma, J., Li, X. Q. Organellar genome copy number variation and integrity during moderate maturation of roots and leaves of maize seedlings. Curr Genet. 61, (4), 591-600 (2015).
  40. Lang, E. G., et al. Simultaneous isolation of pure and intact chloroplasts and mitochondria from moss as the basis for sub-cellular proteomics. Plant Cell Rep. 30, (2), 205-215 (2011).
  41. Tobin, A. K. Subcellular fractionation of plant tissues. Isolation of chloroplasts and mitochondria from leaves. Methods Mol Biol. 59, 57-68 (1996).
  42. PacificBiosciences. Procedure & Checklist - 10 kb to 20 kb Template Preparation and Sequencing with Low (100 ng) Input DNA. Available from: http://www.pacb.com/wp-content/uploads/Procedure-Checklist-10-20kb-Template-Preparation-and-Sequencing-with-Low-Input-DNA.pdf (2015).
  43. PacificBiosciences. Template Preparation and Sequencing Guide. Available from: http://www.pacb.com/wp-content/uploads/2015/09/Guide-Pacific-Biosciences-Template-Preparation-and-Sequencing.pdf (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics