Preparación y

Medicine

Your institution must subscribe to JoVE's Medicine section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Este manuscrito describe la entrega eficiente, no viral de miR a las células endoteliales por un vector de PEI / MNP y su magnetización. Por lo tanto, además de la modificación genética, este enfoque permite la orientación magnética de las células y de detección de MRI. La técnica se puede utilizar para mejorar las características de los productos de células terapéuticas.

Cite this Article

Copy Citation | Download Citations

Voronina, N., Lemcke, H., Wiekhorst, F., Kühn, J. P., Frank, M., Steinhoff, G., David, R. Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells. J. Vis. Exp. (123), e55567, doi:10.3791/55567 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Hasta la fecha, los tratamientos quirúrgicos y farmacológicos disponibles para las enfermedades cardiovasculares (ECV) son limitados y a menudo paliativo. Al mismo tiempo, el gen de terapias con células y son enfoques alternativos muy prometedores para el tratamiento de enfermedades cardiovasculares. Sin embargo, la amplia aplicación clínica de la terapia génica está limitada en gran medida por la falta de sistemas de suministro de genes adecuados. El desarrollo de vectores de suministro de genes adecuados puede proporcionar una solución a los retos actuales en la terapia celular. En particular, los inconvenientes existentes, como la eficiencia limitada y retención celular bajo en el órgano lesionado, podría ser superado por ingeniería celular apropiada (es decir, genética) antes del trasplante. El protocolo presentado describe la modificación transitoria eficiente y seguro de las células endoteliales usando una nanopartícula polietilenimina superparamagnético magnético (PEI / MNP) basada en vector de administración. Además, el algoritmo y métodos para la caracterización de células se definen. El éxito intracelluentrega lar de microARN (MIR) en las células endoteliales de la vena umbilical humana (HUVECs) se ha logrado sin afectar la viabilidad celular, la funcionalidad, o la comunicación intercelular. Por otra parte, este enfoque se ha demostrado que causa un efecto funcional fuertes en exógeno introducido MIR. Es importante destacar que la aplicación de este vector basado en MNP asegura magnetización celular, con posibilidades de orientación magnética y rastreo MRI no invasiva de acompañamiento. Esto puede proporcionar una base para la terapéutica de células magnéticamente guiadas, por ingeniería genética que pueden ser monitoreados de manera no invasiva con MRI.

Introduction

Terapia génica y celular son herramientas poderosas que tienen el potencial para resolver los retos actuales en el tratamiento de las enfermedades cardiovasculares. A pesar de que estos dos enfoques actualmente se están probando en ensayos clínicos, que todavía no están listos para una amplia aplicación clínica 1. En particular, un enfoque común para hacer frente a los retos de la terapia génica y celular es el desarrollo de vectores de suministro de genes multifuncionales adecuados para la aplicación clínica. La falta de sistemas de administración de genes segura y eficiente es la preocupación principal de la terapia génica. Al mismo tiempo, la ingeniería genética de productos celulares antes del transplante podría superar los serios desafíos de la terapia celular, tales como la baja eficiencia (por ejemplo, en el campo cardiaco, solamente ~ 5% de mejoría funcional se logra post-trasplante de célula 1 ) y mala retención / injerto al sitio de la lesión (es decir, retención celular cae por debajo de 5 - 10% en cuestión de minutos a horas post-aplicación, independientemente de la vía de administración 2, 3, 4).

Hasta la fecha, los vectores virales son muy superiores a los sistemas no virales en términos de eficiencia, que ha resultado en su aplicación más amplia en los ensayos clínicos (~ 67%) 5. Sin embargo, los vehículos virales conllevan riesgos graves, tales como la inmunogenicidad (y la respuesta inflamatoria posterior, con complicaciones graves), oncogenicidad, y las limitaciones en el tamaño del material genético llevado a 6. Debido a estas preocupaciones de seguridad y los altos costes de la producción del vector viral, el uso de sistemas no virales es preferible en ciertos casos 7, 8. Es especialmente adecuado para los trastornos que requieren corrección genética transitoria, tales como la expresión de factores de crecimiento que controlan la angiogénesis (por ejemplo, para el tratamiento CVD) o la deliveria de las vacunas.

En nuestro grupo, un sistema de entrega se diseñó por combinación ramificado polietilenimina 25-kDa (PEI) y nanopartículas de óxido de hierro superparamagnéticas (MNP) unidas entre sí por la interacción biotina-estreptavidina 9. Este vector es una herramienta potencial para la ingeniería genética de las células, lo que permite su magnetización simultánea antes del trasplante. Este último proporciona una base para la orientación / retención magnética, que es particularmente prometedor hoy en día, como técnicas de segmentación magnéticas avanzadas están siendo desarrollados con éxito 10. Además, las células magnéticamente sensibles resultantes tienen el potencial de ser no invasiva monitoreado por resonancia magnética (MRI) o formación de imágenes de partículas magnéticas 11, 12.

En el caso del vector de PEI / MNP, poliamina asegura de condensación de ácido nucleico y por lo tanto la protección de factor de degradantes s, internalización vector en las células, y endosomal escapar 5. El MNPs complementar las propiedades de PEI, no sólo en términos de orientación magnética, sino también por la reducción de la conocida toxicidad PEI 7, 13, 14. Anteriormente, PEI / MNP propiedades vector se ajustaron en términos de eficiencia en la entrega (es decir, pDNA y los genes miARN) y la seguridad mediante el uso de fibroblastos y células madre mesenquimatosas humanas 15, 16.

En este manuscrito, un protocolo detallado sobre la aplicación de PEI / MNPs para la generación de células miARN-modificado se describe 17. Para este propósito, HUVECs se utilizan y representan un modelo establecido para la angiogénesis in vitro. Son difíciles de transfectar y son susceptibles a la influencia tóxica 18, 19,culo = "xref"> 20. Además, proporcionamos un algoritmo para evaluar dichas células in vitro, incluyendo su orientación, la comunicación intercelular, y la detección de MRI.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Cordones umbilicales humanos para el aislamiento de células se obtuvieron a partir de posparto informados, mujeres sanas que dieron su consentimiento por escrito para el uso de este material para la investigación de acuerdo con la Declaración de Helsinki. El comité de ética de la Universidad de Rostock ha aprobado el estudio presentado (Reg. No. A 2011, 06, 23 de prolongada de septiembre de 2013).

1. Preparación de Transfección Complejos

  1. La biotinilación de polietilenimina (PEI).
    1. Disolver ramificado PEI en agua ultrapura bajo agitación magnética a 300 - 400 rpm durante 24 h a temperatura ambiente (RT) y protegido de la luz para obtener una solución de 0.18 mM. Almacenar la solución a 4 ° C.
    2. Medir la concentración de grupos amino primarios en la solución obtenida 21, 22.
      1. Use solución de reactivo de ninhidrina 2% como reactivo de detección amina 23 mediante la mezcla de 100 l de prmuestra ediluted (1: 200 con agua ultrapura) y 75 l de reactivo de ninhidrina. Incubar durante 30 min a 80 ° C. Enfriar y añadir 100 l de etanol al 50% para la estabilización. Medir la absorbancia a 550 nm en el espectrofotómetro de absorción.
      2. Crear una curva estándar utilizando glicina.
        1. Preparar amino-N solución 0,1 M de stock (0,75 g de glicina en 100 ml de agua desionizada) y sus diluciones, 1: 1, 1: 5, 1:10, 1:20, 1:40, 1:80, 1: 100, 1: 200, y 1: 400, 1: 600. Medir estas soluciones como en la etapa 1.1.2.1 y crear un gráfico con la concentración y la absorbancia en los ejes.
        2. Sobre la base de la trama obtenida y se midió la absorbancia de la solución de PEI, definir la concentración de los grupos a-amino en PEI.
          NOTA: Precaución. solución de reactivo de ninhidrina exclusivamente debe ser utilizado bajo el capó y debe ser almacenado en una atmósfera de nitrógeno. No se puede utilizar cuando el color de la solución cambia debido a la oxidación.
    3. Disolver 100 mg de enlazador de biotina en agua ultrapura inmediatamente antes de su uso para obtener una solución 0,01 mM. Calcular la cantidad requerida de biotina para añadir a PEI multiplicando la concentración de grupos a-amino en PEI (medida en la etapa 1.1.2) por 20 para obtener la cantidad necesaria (en moles) de reactivo de biotinilación.
      1. Añadir la solución de biotina a la solución de PEI a pH 8-9 y se incuba durante 16 h bajo agitación magnética a temperatura ambiente.
    4. Eliminar la biotina que no ha reaccionado por cromatografía de exclusión por tamaño 23. Utilice columnas comercialmente disponibles que contienen una filtración en gel medio apropiado para la purificación de la 25-kDa PEI y seguir las instrucciones del fabricante. Tomar alícuotas después de la purificación para medir la concentración de amina usando un reactivo de detección de aminas (etapa 1.1.2) y para determinar la eficiencia biotina conjugación (etapa 1.2.2). Almacenar el PEI biotinilado obtenido a 4 ° C.
  2. Personajeización de la biotina PEI.
    1. Determinar la concentración de grupos a-amino en PEI después de la biotinilación, como se describe en el paso 1.1.2.
    2. Determinar el grado de biotinilación PEI para verificar el procedimiento de conjugación. Para la cuantificación, utilizar un kit disponible comercialmente, que se basa en la aplicación de tinte HABA (ácido 4 'hydroxyazobenzene-2-carboxílico), para asegurar la correcta determinación colorimétrica de los niveles de biotinilación 24, 25. Siga las instrucciones proporcionadas por el fabricante.
  3. La filtración de MNPs y su caracterización.
    1. Filtro disponible comercialmente revestida con estreptavidina MNP a través de un filtro de jeringa impulsada 0,45-m 16 con el fin de excluir grandes agregados tóxicos. Medir la concentración de hierro final usando un ensayo fotométrico estándar 26.
    2. Examinar la calidad de los micronutrientes en polvo filtrados por la grabaciónla curva de magnetización y por imágenes TEM de acuerdo con protocolos estándar 27, 28.
      1. Diluir la suspensión MNP con agua destilada y colocar 3 l de la suspensión obtenida en una de malla 300 rejilla de cobre revestida de carbono Formvar para el análisis TEM. Posteriormente, colocar este cuadrícula en un portaobjetos de vidrio en una placa calefactora y dejar secar.
      2. Analizar la muestra con un microscopio electrónico de transmisión a 120 kV y verificar el contenido elemental usando un detector de rayos X 27.
  4. etiquetado de 3 colores de complejos de transfección para super-resolución microscopía.
    1. Etiquetar 0,5% de los grupos amino primarios medidos en PEI con NHS-Ester Atto 488 tinte siguientes instrucciones del fabricante. Retire el tinte no unido en exceso mediante cromatografía de exclusión por tamaño, como se describió anteriormente (etapa 1.1.4). Medir la concentración resultante de grupos amino usando un ASSA ninhidrinay (etapa 1.1.2).
    2. De etiquetas disponibles comercialmente de miR revueltos (scr-MIR) con el tinte Cyanine5 usando un kit de marcaje adecuado 15 (indicado en la Lista de Materiales). Medir la concentración de fluoróforo-MIR resultante espectrofotométricamente.
    3. Recién etiquetar el MNP cada vez con colorante conjugado con biotina (por ejemplo, atto 565-biotina) en una relación 1: 1000 w / w proporción. Directamente aplicar el tinte después de añadir el MNP al MIR / PEI durante la formación de los complejos de transfección, por los detalles en Delyangina et al. 16.

2. Preparación de células

  1. aislamiento HUVEC.
    1. Aislar las células de los cordones umbilicales directamente después de la obtención de los cables utilizando digestión con colagenasa desde el interior de la vena del cordón; seguir un protocolo desarrollado previamente 29.
      1. Incubar cada cable con ~ 60 unidades / ml de solución IV de colagenasa de tipo en tampón - cargan en tél vena umbilical - a 37 ° C durante 13 min.
    2. Para todos los experimentos, se reúnen las HUVEC desde un mínimo de 5 pacientes.
      NOTA: El cultivo no debe exceder de 4-5 pasajes. No utilice células contaminadas con micoplasmas, ya que esto provoca una disminución en la eficiencia de transfección. contaminación Mycoplasma debe ser probado para antes de iniciar el protocolo mediante el uso de un kit de PCR para la detección altamente sensible de micoplasmas.
      1. Prueba para la presencia de micoplasma.
        1. Centrifugar 1 ml de sobrenadante de cultivo celular durante 10 min (13.000 xg). Suspender el sedimento en 17 l de dH 2 O y ebullición (93 ° C) durante 3 min. Utilice 2 l de la suspensión para amplificar la región de ADN que codifica para ARN ribosómicos altamente conservadas (16S-rRNA) de varias especies de micoplasmas.
        2. Realice la PCR usando 10 pmol de cada cebador (cebador directo: 5'-CTGACGACAACCATGCACCATCTGTC-3 '; cebador inverso: 5'-GAAAGCGTGGGGAGCAAACAGGATTAG-3') en peineinación con un kit de PCR comercial bajo las siguientes condiciones: 94 ° C durante 3 min; 45 ciclos de 94 ° C durante 30 s, 50ºC durante 30 s, y 72 ° C durante 30 s; y una extensión final a 72 ° C durante 10 min.
        3. Analizar el producto de PCR (292 pb) usando electroforesis en gel de agarosa.
    3. Cualquiera de almacenar las células obtenidas a largo plazo en nitrógeno líquido o cultivo en el medio de crecimiento endotelial suplementado con 100 U / ml de penicilina y 100 g / ml de estreptomicina a 37 ° C en una atmósfera fi ed humidi que contiene 5% de CO2.
  2. caracterización HUVEC.
    1. Caracterizar HUVECs aisladas en términos de su capacidad funcional para construir tubos en la matriz de la membrana basal (por ejemplo, Matrigel) y su expresión de la CD31 marcador endotelial (plaquetas endotelial molécula de adhesión celular, PECAM-1) siguiendo protocolos estándar 30, 31.

3. La transfección

  1. Trypsinize del cultivo de HUVEC (ver paso 4.1.2.) Y contar manualmente las células utilizando un hemocitómetro. Sembrar el HUVECs en placas de pocillos de cultivo celular de plástico de tamaño adecuado, con una densidad celular inicial de aproximadamente 13.000 células / cm2 de superficie de crecimiento, 48 h antes de la transfección hasta que se alcanza el 70-80% de confluencia.
  2. Preparar fresca MIR / PEI / MNP complejos cada vez.
    NOTA: En primer lugar, los complejos de miR / PEI deben ser obtenido (pasos 3.2.1 - 3.2.3); Posteriormente, MNPs, debe añadirse a la solución de miR / PEI (etapa 3.2.4) con el fin de obtener la formulación final de miR / PEI / MNP usado para la transfección (paso 3.3).
    1. Calcular la cantidad de apropiado de miR disponible comercialmente (revueltos, etiquetado o funcional, véase el paso 4) usando la concentración de las acciones proporcionado por el fabricante. Utilice 2,5 pmol de miR / cm 2 de superficie de crecimiento celular. Diluir la MIR en solución de glucosa al 5% para obtain una concentración final de 0,125 pmol de miR / l.
    2. Basándose en la cantidad de miR de la etapa 3.2.1 y la relación óptima NP de 25 32, se calcula la cantidad necesaria de PEI utilizando su concentración medida (etapa 1.1.2). Diluir la PEI (por el volumen requerido calculado) en un volumen igual de solución de glucosa al 5%. Añadir la obtenida pre-diluido PEI a la solución de miR (de la etapa 3.2.1) y agitar la mezcla obtenida durante 30 s.
    3. Incubar la mezcla de miR / PEI obtenida durante 30 min a RT.
    4. Sonicar la MNPs a 35 kHz para menos 20 min en el baño de agua sonicación (ver la Lista de Materiales) a TA, añadir la cantidad apropiada de solución de MNP al MIR / PEI (5-25 g de hierro / ml de preparado de miR / PEI / mezcla MNP 16), vórtice durante 30 s, y se incuba durante 30 min a TA hasta que esté listo.
  3. Añadir la mezcla preparada gota a gota de miR / PEI / MNP directamente al medio de cultivo sobre las células. Usar la mezcla resultante de cul célulamedio ture con MIR / PEI / MNP diluye en glucosa como la solución de transfección. Reemplazar esta mezcla con medio de cultivo fresco 6 h después de la transfección.

4. Análisis de Seguridad del vector

  1. El examen de la viabilidad celular.
    1. Transfectar las HUVECs sembradas en una placa de cultivo de 24 pocillos (pasos 3.1 y 3.2); utilizar Cy3-MIR como las sondas de prueba y revueltos de miR (scr-MIR) como las sondas de compuerta de control para la citometría de flujo. Incubar a 37 ° C en una atmósfera fi ed humidi que contiene 5% de CO2 durante 24 h.
    2. Recoger el sobrenadante y las células transfectadas por tripsinización utilizando 1x Tripsina-EDTA diluido en PBS a las células durante 4 min a 37 ° C. Centrifugar a 300 xg durante 10 min y utilizar para el análisis.
    3. Examinar la viabilidad celular y la eficiencia de absorción de miR 24 h después de la transfección usando citometría de flujo mediante la aplicación de una mancha disponible comercialmente para distinguir entre células vivas / muertas; utilizar protocolos estándar 15
  2. Examinar la seguridad de los complejos de miR / PEI / MNP para las células en ensayos funcionales.
    1. Evaluar la actividad de proliferación de células transfectadas.
      1. Transfectar HUVECs sembradas en una placa de cultivo de 12 pocillos (pasos 3.1 y 3.2) con antisentido funcional MIR (por ejemplo, anti-miR92a para HUVECs 31) e incubar a 37 ° C en una atmósfera fi ed humidi que contiene 5% de CO2 durante 24 h.
      2. Utilice un kit disponible en el mercado para definir el número de células proliferantes por tinción con EdU (5-etinil-2'-desoxiuridina) y escaneado con microscopía confocal basado en láser. Utilice los siguientes parámetros: microscopía objetivo de 40X con aceite de inmersión; láser de excitación 633 nm (para un colorante 647-nm); 5 campos aleatorios a ser grabados en cada muestra. Calcular la tasa de proliferación de las células dividiendo el número de núcleos teñidos-EdU por el número núcleos total (Hoechst-manchado).
    2. Evaluar la capacidad de las células transfectadas para formar estructuras similares a tubos, como se ha descrito previamente 17, 31.
      1. Transfectar las HUVECs sembradas en una placa de cultivo de 24 pocillos (pasos 3.1 y 3.2) con scr-MIR y se incuba durante 48 h a 37 ° C en una atmósfera fi ed humidi que contiene 5% de CO2. Recoger las células transfectadas (como en la etapa 4.1.1).
      2. Seed 3,5 x 10 4 de HUVECs modificados en placas de 24 pocillos recubiertas con 140 l de matriz de membrana basal. Incubar durante 18 h a 37 ° C en una atmósfera fi ed humidi que contiene 5% de CO2.
      3. grabar imágenes de 10 campos al azar en cada pocillo usando escaneo láser confocal (microscopía de contraste diferencial de interferencia) y analizan utilizando el software ImageJ con el plugin "La angiogénesis analizador". Incluir parámetros tales como la longitud total de las ramas, el número de ramas, y el número de junctions en la evaluación. Compare esto con el control no tratado.
  3. Examinar la posible influencia tóxica de complejos de transfección en brecha de la salida (GJ) mediada por la comunicación intercelular (GJIC) mediante pruebas de recuperación de fluorescencia 3D después de photobleaching (FRAP) 33 en 3D.
    1. Semillas de las células en portaobjetos de vidrio recubiertos de gelatina con una parte inferior delgada adecuado para imágenes de células vivas (inmersión en aceite). Transfectar las células como se describe anteriormente en el paso 3.2 con no marcado, MIR no funcional (scr-MIR) e incubar durante 24 h.
    2. Preparar las células para obtener imágenes cargándolos con calceína directamente antes de la microscopía. En particular, sustituir el medio de cultivo con medio fresco que contenía 5 calceína M, incubar durante 20 min, se lava con PBS, y se añade medio de cultivo fresco. Pre-calentar la incubadora del microscopio a 37 ° C y ajustar la concentración de CO 2 al 5%.
      NOTA: Todos los reactivos deben estar calientes para evitar Contrac celularción antes de la medición.
    3. Utilizar un láser de excitación 561 nm para la visualización de células y el experimento FRAP. En primer lugar, seleccionar manualmente las células para la medición como regiones de interés (ROI); células de ensayo deben tener al menos 3 células vecinas. Definir una célula de referencia con brillante fluorescencia, estable que no se blanquea. Definir los límites de una z-pila. Registre la fluorescencia a partir de la parte superior de las células a la parte inferior para incluir 10 - 15 capas.
    4. Lejía las células de ensayo utilizando la potencia del láser 100% y registrar la recuperación de fluorescencia posterior (debido a la transferencia de colorantes GJ-específica de las células vecinas) durante los siguientes 15 min. Grabar los datos en bruto en los z-pilas cada 60 s. En total, realizar las mediciones FRAP con no menos de de 5 - 10 células de ensayo por experimento. Comparar los resultados con células no transfectadas.

5. Prueba de la eficacia de transfección

  1. El examen de la absorción de MIR.
    1. Preparar las sondas como se describe en step 4,1 y utilizarlos simultáneamente para definir la absorción de miR con citometría de flujo.
  2. Confirmar y describir la localización intracelular de complejos de transfección mediante microscopía confocal y la iluminación estructurada superresolución (SIM).
    1. Sembrar el HUVECs en cubreobjetos de vidrio recubiertos de gelatina colocados en los pocillos de placas de cultivo de 24 pocillos, como se describe antes (paso 3.1). Transfectar las células con 3 colores de marcado de miR / PEI / MNP (etapa 1.4) y se incuba durante 24 h a 37 ° C en una atmósfera fi ed humidi que contiene 5% de CO2.
    2. Lavar los cubreobjetos primero con albúmina de suero bovino al 2% (BSA) en solución salina tamponada con fosfato (PBS) y después con sólo PBS. Fijar las células mediante incubación en paraformaldehído al 4% (PFA) a 37 ° C durante 15 min y la mancha núcleos con DAPI siguientes protocolos estándar 16. Lavar 3 veces en el agitador (15 min cada uno) para eliminar el exceso de tinte.
      NOTA: PFA es cancerígeno y debe manejarse con cuidado.
    3. Coloque el prcubreobjetos epared sobre portaobjetos de microscopio utilizando medio de montaje adecuado, dejar secar al menos durante 1 h, y utilizarlos para microscopía, tal como se describe a continuación.
    4. Adquirir imágenes con un objetivo de inmersión en aceite 63X y los siguientes ajustes: SIM 405-, 488-, 561-, y las líneas de láser de 633 nm para la excitación; modo z-pila con una profundidad de 32 bits a los 5 ángulos, 5 fases, con promediado de 4; cuadrícula G2 con una línea 405 de láser, G3 con un 488, G4 con un 561, y G5 con un 633.
  3. Evaluar la funcionalidad del MIR entregado por RT-qPCR en el miR / PEI / MNP-HUVECs frente a sin tratamiento.
    1. Transfectar las HUVECs sembradas en una de 12 pocillos pasos de placas de cultivo (3.1 y 3.2) con antisentido funcional MIR (por ejemplo, anti-miR92a para HUVECs 31) e incubar durante 48 h a 37 ° C en una atmósfera fi ed humidi que contiene 5% de CO2.
    2. Evaluar la entrega anti-miR92a y procesamiento con RT-qPCR utilizando kits disponibles en el mercado (ver los materiales); siga tél las instrucciones del fabricante, tal como se describe en otro lugar 17, 31. En paralelo, examinar la expresión del gen diana (por ejemplo, ITGA5 31).
      NOTA: entrega antagomir contra endógeno de miR se prefiere sobre imita ya que garantiza la medición del resultado real de la MIR y no sólo su acumulación intracelular.

6. Evaluación y Orientación de la célula separación celular magnética

  1. Cell focalización en condiciones estáticas en vitro.
    1. Transfectar las HUVECs en una placa de 24 pocillos (2,5 pmol / cm 2 scr-MIR, NP 25, y 15-25 g / ml MNP), se incuban durante 24 h, lavado, y recogen como se describe anteriormente (paso 4).
    2. Mezclar el sedimento de células obtenido a partir de 1 bien con 1 ml de medio de cultivo fresco y lo coloca en los pocillos de una placa de 12 pocillos. Fijar un pequeño imán de forma local (en el lado) en la parte inferior de la placa usando cinta.
    3. Incubar la suspensión de células durante 24 h y observar la unión de las células y el crecimiento en el área sobre el imán y en la zona sin un imán. Para una evaluación cualitativa, utilizar un microscopio invertido convencional.
  2. Cell focalización en condiciones dinámicas simuladas in vitro.
    1. Transfectar las HUVECs en una placa de 24 pocillos por pasos 3.1 y 3.2 (2.5 pmol / cm 2 Cy3-MIR, NP 25, y el 15 - 25 g / ml MNP), incubar durante 24 h, lavado, y recoger por tripsinización usando 1x tripsina-EDTA diluido en PBS a las células durante 4 min a 37 ° C. Centrifugar a 300 xg durante 10 min.
    2. Mezclar el sedimento de células obtenido a partir de 1 bien con 1 ml de medio de cultivo fresco y lo coloca en el pocillo de una placa de 12 pocillos. Fijar un pequeño imán local (en el lado de un pozo) usando cinta. Coloque la placa de cultivo en el agitador y se incuba la suspensión de células durante 12 h a 150 rpm para simular las condiciones dinámicas 34.
    3. Lavar las células y fijarutilizando 4% PFA. Tinción de los núcleos con DAPI 16. Registre la unión de las células usando barrido láser microscopía confocal con un láser de excitación 514 nm, el modo de z-pila (5 - 12 rebanadas) para obtener los datos en bruto, y la máxima de procesamiento de imagen de proyección de intensidad para crear imágenes para el análisis.
  3. El análisis cuantitativo de células magnéticamente sensibles y no sensibles.
    1. Transfectar las HUVECs en una placa de 24 pocillos (2,5 pmol / cm 2 scr-MIR, NP 25, y 15-25 g / ml MNP), incubar durante 24 h, lavado, y recoger como se describe antes (etapa 6.2.1) . tampón de clasificación Pre-PBS caliente y celular (esterilizada por filtración, ver la Lista de Materiales) a 37 ° C. Vuelva a suspender el sedimento celular obtenido a partir de cada pocillo con 500 l de tampón de clasificación celular.
    2. Aplicar esta suspensión celular a una magnéticas columnas de clasificación fijados por el imán suministrado, lavar las columnas en el imán 3 veces con tampón de células frescas de clasificación, y recoger el flujo a través como el magneticamente fracción que no responde (MAG).
    3. Eliminar las columnas de la imán e inmediatamente recoger la fracción de células magnéticamente sensible (mag +) empujando tampón de clasificación celular fresco a través de la columna utilizando un émbolo.
    4. Centrifugar tanto MAG y mag + a 300 xg durante 10 min. Vuelva a suspender el sedimento celular en PBS, contar las células y evaluar la viabilidad celular con un ensayo de exclusión con azul de Trypan 35. Utilice el sedimento celular obtenido o bien para el análisis a largo plazo (es decir, re-semilla y evaluar después de 24, 48, y 72 h en cultivo 17) o directamente por citometría de flujo (paso 4.1.).
  4. Definir la carga de hierro de las células transfectadas.
    NOTA: Durante la preparación, cualquier contacto de las sondas de células con materiales e instrumentos de óxido de hierro debe ser evitada.
    1. Recoger las HUVECs transfectadas y no transfectadas de control (como en la etapa 4.1.1). Se lavan las células recogidas dos veces en 2% de BSA en PBS 36 b y mezclar cuidadosamente las células con 1 ml de este tampón de lavado y después de centrifugar a 300 xg durante 10 min. Resuspender el sedimento celular obtenido en 250 l de PBS, añadir 100 l de PFA al 4%, y se incuba durante 20 min para fijar las células. Lavar 3 veces con PBS, como se describe anteriormente.
    2. Vuelva a suspender el sedimento celular fijo resultante en 110 l de PBS y transferirlo a 100-l tubos de PCR.
      1. Tomar alícuotas de 10-mu l para el recuento celular y el uso de la muestra restante para la espectroscopia de partículas magnéticas (MPS).
    3. Realizar la medición en un dispositivo MPS disponible en el mercado. Durante la medición, se aplican los siguientes ajustes: el campo magnético de accionamiento B = 25 mT y la frecuencia f 0 = 25 kHz. Para la cuantificación de hierro de las muestras, normalizar el tercer armónico A 3 de la MPS-espectro en el correspondiente A 3, ref de una muestra de referencia MNP con una cantidad de hierro conocida de 2,1 gxref "> 37. Usar las células no tratadas como controles.

7. Límites de detección de MRI Definición

  1. Preparación de las células.
    1. HUVECs de semillas en una placa de 6 pocillos y transfectar (2,5 pmol / cm 2 scr-MIR, NP 25, y el 15 - 25 g / ml MNP) en duplicados o triplicados de acuerdo con la cantidad requerida de las células (para la preparación fantasma). Se incuban las células durante 24 h y lavar, recoger, y fijarlas con PFA al 4%, como se ha descrito antes (etapa 4).
    2. Contar las células obtenidas, preparar alícuotas con el número de células apropiadas (por ejemplo, 10 3, 10 4, 10 5, etc.), y ajustar su volumen a 50 mL.
  2. preparación fantasma de agarosa
    1. Preparar varias capas de agarosa al 2% en tubos de 50 ml con diferentes cantidades de células transfectadas incrustadas entre las capas 38. Durante la preparación, se somete a ultrasonidos y centrifugar la agarosa caliente 38 adestruir las burbujas de aire que provocan artefactos.
      NOTA: Es importante destacar que, fantasmas que contienen 5,5 x 10 5 HUVECs tratadas con complejos de miR / PEI no magnéticos deben estar preparados de la misma manera para servir como controles.
  3. Escanear el obtenido en fantasmas in vitro con un sistema de MRI 7,1 T de los animales después de colocar el fantasma en el centro de la bobina, en paralelo a la del eje z del campo magnético.
    1. Aplicar los siguientes parámetros de la secuencia para una adquisición de la secuencia de eco de gradiente: TR = 66 ms; TE 1 / TE 2 / TE 3 / TE 4 / TE 5 / TE 6 = 1,44 / 2,88 / 4,51 / 6,11 / 7,60 / 9,01 ms; flip ángulo = 3 °; matriz = 128 × 128, interpolada a 256 x 256; campo de visión = 42 mm; 100%; promedios = 1, longitud de los trenes de eco = 1; grosor de corte = 1,5 mm; y 16 rebanadas.
    2. Evaluar la degradación de señal de todos los cuatro tiempos de eco y calcular mapas R2 * (R2 * = 1 / T2 *) usando el software apropiado, como se describe en otra parte 39.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

El objetivo principal del protocolo propuesto es producir células modificadas-MIR magnéticamente sensibles y para llevar a cabo su caracterización precisa (Figura 1). Como resultado, las células transfectadas de manera eficiente, que responden a la selección y orientación magnética y detectables con MRI, se deben obtener.

En primer lugar, las identidades de HUVECs aisladas se confirmaron mediante tinción típica con el CD31 marcador endotelial (PECAM) (Figura 2A) y por su capacidad para formar tubos en la matriz de la membrana basal apropiado (Figura 2B). Las células obtenidas tomaron el MIR introducido por PEI / MNP manera muy eficiente; microscopía demostró que todas las células fueron positivas para una señal de miR etiquetado (Cy3) 24 h después de la transfección (Figura 3A). Es importante destacar, no la muerte celular se registró en comparación con las células no tratadas (Figura 3B), y napariencia Ormal se mantuvo (Figura 3A). Según se observó con microscopía confocal de barrido láser, la señal de Cy3-MIR se encuentra principalmente dentro de las células. Además, una investigación más detallada de la localización intracelular de todas las partes del vector de transfección y miR se llevó a cabo con una mayor resolución usando complejos marcados de 3 colores. SIM, Mir, PEI, y MNP señales fueron detectadas en el citoplasma en la región perinuclear (Figura 3C).

Además, una investigación detallada de la seguridad de la transfección de vectores ha demostrado que el miR / PEI / MNP-HUVECs son capaces de formar tubos sobre la matriz de membrana basal apropiado y que la red resultante es comparable a la de las células no tratadas utilizadas como control positivo (Figura 4A ). Además, las células transfectadas mantienen GJIC, como experimentos 3D-FRAP revelaron. En particular, cuando las células se cargan con fluorescente GJ-permeacolorante ble y uno de ellos está blanqueado, su fluorescencia se recupera debido a la comunicación con las células vecinas y la transferencia de colorantes resultante (Figura 4B).

Es importante destacar que, debido a la presencia de la superparamagnético compuesto 40 (Figura 5A), la aplicación de PEI / MNP permite no sólo la transfección de células, sino también la magnetización simultánea. La cantidad resultante de hierro intracelular se midió usando MPS (Figura 5B) para todas las concentraciones MNP aplicadas dentro de la gama óptima (2,5 pmol / cm 2 de miR; NP 25 complementa con 5-25 g / ml MNP): 0,37 ± 0,079 a 0,7 ± 0.150 pg hierro / célula 17. Como el uso de columnas de separación magnética demostró, por todas estas concentraciones MNP, la cantidad de células magnéticamente sensibles en el volumen total de las células transfectadas es de ~ 70% (Figura 5C). Además, transfectadas HUVECs son visibles con MRI (Figura 5D) en el interior de in vitro de agarosa fantasmas en, imitando susceptibilidad tejido de ratón. Además, la orientación magnética de HUVECs transfectadas en condiciones dinámicas simuladas in vitro ha demostrado ser eficaz (Figura 6). En este montaje experimental, incluso el vigoroso movimiento constante del medio de cultivo no impidió el crecimiento de células que prevalece en la zona cercana a la aplicación del imán.

Figura 1
Figura 1. Representación esquemática de la Producción de HUVEC modificados de miR-magnetizado y su análisis. El PEI / MNP (polietilenimina / vector basada en nanopartículas superparamagnéticas) se aplica para entregar microRNA (MIR) a las células humanas de vena umbilical endoteliales (HUVEC). El producto celular obtenido se caracteriza por los siguientes parámetros: la seguridad (incluyendo la viabilidad celular, funcionaldad, y la capacidad para la comunicación intercelular); la eficiencia de transfección (es decir, la eficiencia de absorción MIR y la funcionalidad después); magnética focalización in vitro en condiciones dinámicas y estáticas simulados; formación de imágenes por resonancia magnética (MRI) de detección. Haga clic aquí para ver una versión más grande de esta figura.

Figura 2
Figura 2. Caracterización de Aislado HUVEC. A. imagen representativa de HUVECs aisladas y cultivadas teñidas con marcador CD31 endotelial. Los núcleos se tiñen con DAPI (azul). La barra de escala es de 20 m. Resultado B. Representante del ensayo de formación de tubo realizado en aislado HUVECs; la imagen se registró usando un microscopio láser confocal de barrido (inter diferencialferencia de contraste) 18 h después de la siembra de células sobre la matriz de membrana basal. La barra de escala es de 100 m. Haga clic aquí para ver una versión más grande de esta figura.

figura 3
Figura 3. MIR Entrega a HUVECs usando PEI / MNP. A. La absorción de etiquetado de miR (Cy3, rojo) 24 h después de la transfección (2,5 pmol / cm 2 de etiquetado-Cy3 Mir, NP 25 y MNP 25 g / ml) y el mantenimiento de la apariencia normal de las células se ilustran. Las imágenes fueron tomadas por microscopía confocal de barrido láser utilizando un láser de excitación 514-nm (Cy3, rojo) y contraste de interferencia diferencial. La barra de escala es de 50 m. B. La viabilidad celular 24 h después de la transfección se evaluó por citometría de flujo. El gráfico representa los resultados obtenidos para HUVECs tratados con las composiciones siguientes complejos: 2,5 pmol / cm 2 de Cy3-MIR; relación de NP 25 complementado con 5 a 25 g / ml de MNPs. Las barras representan la relación entre el número promedio de células viables y de toda la población de células (n = 6; barras de error: SEM). C. microscopía de iluminación (SIM) de formación de imágenes estructurado de 3 colores etiquetado complejos de miR / PEI / MNP tomadas por HUVECs. Las células se transfectaron como se describió anteriormente, se incubaron, y se fijaron 24 h post-tratamiento; los núcleos se tiñeron por contraste con DAPI. Los datos en bruto SIM se registraron en z-pilas y procesados; las imágenes representativas son el resultado de la proyección de intensidad máxima. Se aplicaron los siguientes láseres de excitación: 405 nm (DAPI, azul), 488 nm (Atto488-PEI, naranja), 565 nm (Atto565-MNP, cian) y 633 nm (Cy5-MIR, rojo). La barra de escala es de 5 m. Haga clic aquí para ver una versión más grande de esta figura.

Figura 4
Figura 4. La seguridad de los HUVECs Modificación con MIR / PEI / MNP. A. Un ensayo de formación de tubo se realizó con células transfectadas (2,5 pmol / cm 2 de scr-MIR; NP 25 y MNP 25 g / ml) 48 h post-tratamiento. Las imágenes fueron adquiridas con un microscopio confocal de barrido láser (es decir, contraste de interferencia diferencial) 18 h después de la siembra de células en la matriz de la membrana basal. HUVECs transfectadas con el miR / PEI se utilizaron como control de la toxicidad y las células no tratadas como control positivo. La barra de escala es de 100 m. La trama refleja la relación entre las HUVECs transfectadas y las células no tratadas utilizando varios parámetros: la longitud del tubo, el número de ramas, y los cruces (n = 3, las barras de error: SEM). B. Se evaluó la brecha unión mediada por la comunicación intercelular de HUVECs modificada-MNP de miR / PEI / 24 h post-transfección. Para este propósito, las células se cargaron con el colorante calceína GJ-permeable (naranja); recuperación después de fluorescencia photobleaching (FRAP) se examinó en 3D mediante el escaneo de células de ensayo en z-pilas. Imágenes representativas de células de calceína-cargado antes del blanqueo, directamente después del blanqueo, y 15 min post-blanqueo (con fluorescencia recuperado) se representan. La barra de escala es de 20 m. Haga clic aquí para ver una versión más grande de esta figura.

Figura 5
Figura 5. Cell magnetización resultante de transfección con PEI / MNP y su aplicación. A. imagen representativa de MNPs filtrada, tomada con TEM, que ilustra su morfología agrupado. Un pequeño tamaño (~ 5-15 nm) de partículas de óxido de hierro individuales (que resulta en superparamagnetismo) es por lo tantoconfirmado. La barra de escala es de 100 nm. B. La carga intracelular de las células transfectadas se evaluó por espectroscopia de partículas magnéticas (MPS) 24 h después de la transfección. El panel representativo representa el espectro de MPS de muestras examinadas. En particular, la suspensión MNP puro (50! L) sirvió como referencia (cuadrados azules); los círculos son los espectros de MPS de dos muestras transfectadas de células (círculos rojos: MNP 25 g / ml; círculos verdes: MNP 5 g / ml), mientras que los triángulos grises muestran el espectro de fondo detectada obtenida por una medición sin ninguna muestra. Tenga en cuenta la escala logarítmica de la amplitud (A). C. La cantidad de células magnéticamente modificado se cuantificó mediante la aplicación de HUVECs transfectadas (2,5 pmol / cm 2 de miR; NP 25 complementa con 5-25 g / ml de MNP), se recogió mediante tripsinización 24 h post-tratamiento, a un magnética columna de separación celular. La fracción magnéticamente positivo resultante (es decir, que permanecieron en la columna)fue contada, y su porcentaje de la cantidad total de células transfectadas se refleja en la trama para cada concentración de MNP (triángulos rojos). La viabilidad celular se examinó posteriormente mediante el ensayo de exclusión con azul de Trypan (rombos grises). Los datos se presentan como la media ± SEM (n = 3). D. Una imagen de resonancia magnética ilustrativo de HUVECs transfectadas (300.000 células; 2,5 pmol / cm 2 de miR; NP 25 y 25 g / ml de MNP) incrustado en un fantasma de agarosa se registró con un sistema animal MRI 7,1 T. Haga clic aquí para ver una versión más grande de esta figura.

Figura 6
La Figura 6. En Vitro Targeting magnética de miR / PEI / MNP-HUVECs en simulados Condiciones dinámicas. HUVECs se recogieron 24 h post-transfectarion (2,5 pmol / cm 2 de Cy3-MIR; NP 25 y MNP 25 mg / ml) y se re-sembraron en medio de cultivo fresco en los pocillos, con un pequeño imán conectado localmente a la pared lateral. A su vez, esta placa de cultivo se fijó a un agitador que gira a 150 rpm. La unión celular y el crecimiento se evaluaron 12 h más tarde mediante la fijación de las células con PFA, manchando sus núcleos con DAPI, y la realización de escaneo láser de microscopía confocal (láseres de excitación: 405 nm, DAPI, azul; 514 nm, Cy3, naranja). Imágenes representativas representan el crecimiento celular en el área con la aplicación del imán; sin la aplicación del imán; y en el centro de la cultura así, donde el flujo de líquido se estaba concentrando las células. Las barras de escala son de 50 m. Haga clic aquí para ver una versión más grande de esta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

La producción de células genéticamente cargados con nanopartículas superparamagnéticas por su orientación más controlada magnéticamente se presenta en el protocolo actual. La aplicación exitosa de esta estrategia permite la resolución de algunas dificultades de la terapia celular, tales como baja retención y pobres injerto en el área lesionada 2, 3, 4, proporcionando un producto de células objeto de orientación para el trasplante. Por otra parte, la introducción simultánea de material genético adecuadamente seleccionado podría promover propiedades de células y por lo tanto podría aumentar beneficios funcionales 41.

El protocolo actual se ha desarrollado en HUVECs como modelo. Estas células son conocidas por ser difíciles de transfectar y susceptible a la influencia tóxica 18, 19, 20. el demnivel onstrated de la captación de miR marcado con fluoróforo más del 95% después de PEI / MNP transfección se obtiene típicamente con vectores basados en PEI y comúnmente utilizado reactivos de transfección basada en lípidos catiónicos (por ejemplo, Lipofectamine) 42. Además, la relación óptima NP de 25 corresponde con los valores publicados previamente de 20 - 40 para el NP. Sin embargo, la captación altamente eficiente de la prueba de miR-fluoróforo etiquetado no garantiza necesariamente el procesamiento adecuado de miR y función después de la entrega 43. Este punto es particularmente relevante en el caso de PEI, con su condensación electrostática apretado de NA. Por lo tanto, la capacidad funcional resultante de miR entregado también debe ser probado. Aquí, una de miR funcional expresado endógenamente en HUVEC, se seleccionó miR-92a 31, y anti-MIR contra fue entregado usando PEI y PEI / MNP. Como resultado, una caída casi completa de la diana miR-92a demostró la liberación eficaz de la anti-MIR fesde los complejos de transfección.

Es importante destacar que, en trabajos anteriores, la aplicación con éxito del vector PEI / MNP se demostró para la entrega de ADN de plásmido (pDNA) y miR a otros tipos de células, tanto adherente (por ejemplo, COS7, células madre mesenquimatosas humanas 15, 16) y en de suspensión (por ejemplo, hueso CD133 derivada de la médula + células madre hematopoyéticas 44). Todos estos experimentos han confirmado el hecho conocido de que la eficiencia de transfección y la toxicidad son de tipo dependiente de célula 45. Por lo tanto, la selección de la composición del vector óptimo (es decir, cantidad de miR, relación de NP, y la cantidad de hierro MNP) debe llevarse a cabo para cada tipo de célula particular, utilizando condiciones óptimas previamente establecidas como puntos de referencia.

Por otra parte, el carácter transitorio de la modificación genética alcanzado debe tenerse en cuenta. Por un lado, it es muy adecuado para cierta función, tal como la entrega a corto plazo de factores de crecimiento. Por otra parte, la duración de expresión no puede durar lo suficiente para una variedad de propósitos que requieren la expresión a largo plazo. Sin embargo, la seguridad probada del vector PEI / MNP apoya su posible la administración repetida una vez que las condiciones se optimizan aún más.

PEI y sus derivados se utilizan comúnmente debido a su alta eficiencia en comparación con otros vehículos no virales y su flexibilidad de modificación 7. Sin embargo, a pesar del éxito PEI in vitro e in vivo, su aplicación en ensayos clínicos es muy limitado (es decir, pocos fase 1 y 2 ensayos o pacientes de cáncer) 7, 14 debido a la toxicidad PEI 7, 13. Como trabajos previos de nuestro grupo de 16, así como el presente Protocolo, han demostrado, las NPMson capaces de disminuir la toxicidad PEI significativamente. En particular, MIR / PEI transfección ha dañado la capacidad de las HUVECs para formar tubos en su matriz, en su defecto de este modo un ensayo funcional in vitro principal para estas células. En contraste, el rendimiento de la formación de tubos de miR / PEI / MNP-HUVECs era comparable a las células no tratadas. Notablemente, esta disminución de la toxicidad PEI se logró mediante la introducción de los bajos niveles de componentes tales como óxido de hierro, que son biocompatibles y se utiliza rutinariamente como un reactivo de contraste en sujetos humanos 40.

Aparte de mantener propiedades funcionales, es importante que las células modificadas son capaces de establecer la comunicación intercelular, ya que esta característica es necesaria para la integración adecuada de la terapéutica de células post-trasplante 46. Además, las células modificadas pueden ser explotados como vehículos para la entrega de miR terapéutica a los tejidos lesionados 47. En este caso, su capacity para el intercambio de moléculas con las células vecinas define su éxito como un vehículo. Desde PEI / MNP transfección permite GJIC en HUVECs modificados, que tienen el potencial para la integración in vivo y para proporcionar una entrega de miR a las áreas dañadas.

En particular, los trabajos publicados previamente sobre la magnetización de células para la orientación posterior han informado de la carga de las células de ~ 4 y 30 pg de hierro / célula 48, 49, 50, 51. Estos números superan significativamente los valores de ~ 0,16 a 0,7 pg / célula, que eran suficientes para la orientación in vitro de NA / PEI / MNP-HUVECs en condiciones dinámicas estáticas y simulados. Tales bajas cantidades de hierro son beneficiosos en términos de seguridad: un mecanismo comúnmente conocido de óxido de hierro toxicidad de las nanopartículas asociadas (es decir, la producción de especies reactivas de oxígeno (ROS)) es conocido por estar asociado directamente con la cantidad de internalized nanopartículas 40. Además, varios estudios han demostrado que los altos niveles intracelulares de nanopartículas de óxido de hierro pueden llevar a la desorganización y el daño 52, 53 citoesqueleto dependiente de la dosis. Es importante destacar que la mayoría informó de casos de magnetización de células con fines de segmentación no incluyen la manipulación de células genética. En contraste, el vector de miR / PEI / MNP proporciona una oportunidad para modificar simultáneamente las células y añadir propiedades magnéticas.

Sin embargo, bajo MNP de carga podría no ser suficiente para la orientación magnética en un entorno turbulento con el flujo sanguíneo. Con el fin de acercarse a la desafiante en situación in vivo, condiciones dinámicas fueron simuladas in vitro: placas de cultivo con magnetizado de miR / PEI / MNP-HUVECs en suspensión se colocaron en el agitador giratorio 34. Este experimento claramente no puede cubrir todas las interacciones que se producen envivo. Sin embargo, dio lugar a una mejor comprensión del potencial de la orientación de las células modificadas MNP PEI /. Como resultado, la orientación de células altamente eficiente se demostró cuando incluso agitación activa del medio de cultivo no interfirió con el movimiento de células hacia el imán 54. Para este propósito, HUVECs modificados-MIR se cargaron con al menos ~ 0,16 pg de hierro / célula. Además, las células magnéticamente sensibles pueden ser ordenados. Un procedimiento de separación de células basados ​​en imán aplicado al estudio actual no ha comprometido la viabilidad de las / PEI / MNP-células MIR. Es importante destacar que la aplicación de un campo magnético estático (es decir, la orientación experimentos que implicaban la aplicación de un campo magnético por 12 - 24 h) no tuvo un efecto perjudicial sobre células diana. Por lo tanto, la producción demostrada de células modificadas genéticamente magnetizadas proporciona la base para estudios in vivo adicionales que abordan la eficiencia de retención celular asegurado por la fuerza magnética. En particular, THe de más éxito en los estudios in vivo que emplean la focalización de células magnetizadas 51, 54, 55 usado retención celular después de la administración local en lugar de la orientación de células después de la inyección intravenosa. Por lo tanto, parece deseable retención a base de imán en el sitio de inyección para más en aplicaciones in vivo de células / Modified-MNP PEI / MIR.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

No tenemos que compiten interés económico alguno.

Acknowledgments

Nos gustaría dar las gracias a G. Fulda (Microscopía Electrónica Center, Universidad de Rostock, Alemania) por el apoyo técnico en la adquisición de imágenes de TEM de nanopartículas superparamagnéticas filtrados y en la realización de sus análisis de rayos X. El trabajo llevado a cabo en el RTC Rostock fue apoyado por el Ministerio Federal de Educación e Investigación de Alemania (FKZ 0312138A, FKZ 316.159 y VIP + 03VP00241) y el Estado Mecklemburgo-Pomerania Occidental con fondos estructurales de la UE (FSE / IV-WM-B34- 0030/10 y ESF / IV-BM-B35-0010 / 12) y por la DFG (DA 1296-1), la humedad-Fundación, y la Fundación corazón alemán (F / 01/12). Frank Wiekhorst fue apoyado por el programa de investigación del 7PM de la UE "Nanomag" FP7-NMP-2013-LARGE-7.

Materials

Name Company Catalog Number Comments
PEI 25 kDa Sigma Aldrich 408727
EZ-Link Sulfo-NHS-LC-Biotin Thermo Scientific 21335
PD-10 Desalting Columns GE Healthcare 17085101 Containing Sephadex G-25 Medium
Ninhydrin Reagent solution 2% Sigma Aldrich 7285
Glycine Sigma Aldrich 410225
Pierce Biotin Quantitation Kit Thermo Scientific 28005
Microplate reader Model 680 Bio-Rad
Streptavidin MagneSphere Paramagnetic Particles Promega Z5481
Millex-HV PVDF Filter Merck SLHV013SL 0.45 µm
Libra 120 transmission electron microscope Zeiss Acceleration Voltage 120 kV
Sapphire X-ray detector EDAX-Amatek
Cell culture plastic TPP
NHS-Esther Atto 565 ATTO-TEC GmbH AD 565-31
NHS-Esther Atto 488  ATTO-TEC GmbH AD 488-31
Cy5 miRNA Label IT kit Mirus Bio MIR 9650
Biotin Atto 565 ATTO-TEC GmbH AD 565-71
Collagense Type IV Gibco Thermo Scientific 17104019
Endothelial growth medium, EGM-2 Lonza CC-3156 & CC-4176
Penicillin/Streptomycin Thermo Scientific 15140122 100 U/mL, 100 µg/mL
Matrigel BD Biosciences 356234
anti-PECAM-1 antibody Santa Cruz sc-1506
MS MACS columns Miltenyi Biotec  130-042-201
Near-IR Live/Dead Cell Stain Kit Thermo Scientific L10119
Cy3 Dye-Labeled Pre-miR Negative Control Thermo Scientific AM17120 "Cy3-miR" or "Cyanine-miR3" in the manuscript
Pre-miR miRNA Precursor Molecules - Negative Control  Thermo Scientific AM17110 "scr-miR" in the manuscript
Anti-hsa-miR92a-3p synthetic Inhibitor  Thermo Scientific AM10916
LSM 780 ELYRA PS.1 system Zeiss
Paraformaldehyde Sigma Aldrich 158127 4% solution in PBS
DAPI nuclear stain Thermo Scientific D1306
NucleoSpin RNA isolation Kit Machery-Nagel 740955
mirVana miRNA Isolation Kit Thermo Scientific AM1560
TaqMan MicroRNA Reverse Transcription Kit Thermo Scientific 4366596
StepOnePlus Real-Time PCR System Applied Biosystems
High-Capacity cDNA Reverse Transcription Kit Thermo Scientific 4368814
hsa-miR-92a TaqMan assay Thermo Scientific 000431 Mature miRNA Sequence: UAUUGCACUUGUCCCGGCCUGU
FastGene Taq Ready Mix Nippon Genetics LS27
ITGA5 TaqMan assay Thermo Scientific Hs01547673_m1
RNU6B TaqMan assay Thermo Scientific 001093
18S rRNA Endogenous Control Thermo Scientific 4333760F
Gelatin Sigma Aldrich G7041
CellTrace Calcein Red-Orange Thermo Scientific C34851
PBS Pan Biotech P04-53500
BSA Sigma Aldrich
MACS buffer Miltenyi Biotec  130-091-221
Agarose Sigma Aldrich A9539
7.1 Tesla animal MRI system Bruker Corporation A7906
ImageJ software National Institutes of Health upgraded with an AngiogenesisAnalyzer (NIH)
MPS device Bruker Biospin
Matlab software Mathworks
Ring Neodym Magnet  magnets4you GmbH RM-10x04x05-G ø 10 mm; remanescence is ~ 1.3 T, coercivity ≥ 955 kA/m
Click-iT EdU Alexa Fluor 647 Imaging Kit Thermo Scientific C10340
FluorSave Reagent Merck 345789
Ultrasonic bath Bandelin electronic Type: RK 100 SH

DOWNLOAD MATERIALS LIST

References

  1. Behfar, A., Crespo-Diaz, R., Terzic, A., Gersh, B. J. Cell therapy for cardiac repair-lessons from clinical trials. Nat Rev Cardiol. 11, (4), 232-246 (2014).
  2. Zeng, L., Hu, Q., et al. Bioenergetic and functional consequences of bone marrow-derived multipotent progenitor cell transplantation in hearts with postinfarction left ventricular remodeling. Circulation. 115, (14), 1866-1875 (2007).
  3. Dib, N., Khawaja, H., Varner, S., McCarthy, M., Campbell, A. Cell therapy for cardiovascular disease: a comparison of methods of delivery. J Cardiovasc Transl Res. 4, (2), 177-181 (2011).
  4. Terrovitis, J., Lautamäki, R., et al. Noninvasive Quantification and Optimization of Acute Cell Retention by In Vivo Positron Emission Tomography After Intramyocardial Cardiac-Derived Stem Cell Delivery. J Am Coll Cardiol. 54, (17), 1619-1626 (2009).
  5. Villate-Beitia, I., Puras, G., Zarate, J., Agirre, M., Ojeda, E., Pedraz, J. L. First Insights into Non-invasive Administration Routes for Non-viral Gene Therapy. Gene Therapy - Principles and Challenges. (2015).
  6. Nayerossadat, N., Maedeh, T., Ali, P. A. Viral and nonviral delivery systems for gene delivery. Adv Biomed Res. 1, 27 (2012).
  7. Yin, H., Kanasty, R. L., Eltoukhy, A. A., Vegas, A. J., Dorkin, J. R., Anderson, D. G. Non-viral vectors for gene-based therapy. Nat Rev Genet. 15, (8), 541-555 (2014).
  8. Chira, S., Jackson, C. S., et al. Progresses towards safe and efficient gene therapy vectors. Oncotarget. 6, (31), 30675-30703 (2015).
  9. Li, W., Ma, N., et al. Enhanced thoracic gene delivery by magnetic nanobead-mediated vector. J Gene Med. 10, (8), 897-909 (2008).
  10. Muthana, M., Kennerley, A. J., et al. Use of magnetic resonance targeting to direct cell therapy to target sites in vivo. Nat Commun. 6, 1-11 (2013).
  11. Zheng, B., von See, M. P., et al. Quantitative Magnetic Particle Imaging Monitors the Transplantation, Biodistribution, and Clearance of Stem Cells In Vivo. Theranostics. 6, (3), 291-301 (2016).
  12. Almstätter, I., Mykhaylyk, O., et al. Characterization of magnetic viral complexes for targeted delivery in oncology. Theranostics. 5, (7), 667-685 (2015).
  13. Juliano, R. L. The delivery of therapeutic oligonucleotides. Nucleic Acids Res. (2016).
  14. Chen, J., Guo, Z., Tian, H., Chen, X. Production and clinical development of nanoparticles for gene delivery. Mol Ther Methods Clin Dev. 3, 16023 (2016).
  15. Schade, A., Delyagina, E., et al. Innovative strategy for microRNA delivery in human mesenchymal stem cells via magnetic nanoparticles. Int J Mol Sci. 14, (6), 10710-10726 (2013).
  16. Delyagina, E., Schade, A., et al. Improved transfection in human mesenchymal stem cells: effective intracellular release of pDNA by magnetic polyplexes. Nanomedicine. 9, (7), 999-1017 (2014).
  17. Voronina, N., Lemcke, H., et al. Non-viral magnetic engineering of endothelial cells with microRNA and plasmid-DNA-An optimized targeting approach. Nanomedicine. 12, (8), 2353-2364 (2016).
  18. Hunt, M. A., Currie, M. J., Robinson, B. A., Dachs, G. U. Optimizing transfection of primary human umbilical vein endothelial cells using commercially available chemical transfection reagents. J Biomol Tech. 21, (2), 66-72 (2010).
  19. Zhang, J., Wang, Z., Lin, W., Chen, S. Gene transfection in complex media using PCBMAEE-PCBMA copolymer with both hydrolytic and zwitterionic blocks. Biomaterials. 35, (27), 7909-7918 (2014).
  20. Lim, J., Dobson, J. Improved transfection of HUVEC and MEF cells using DNA complexes with magnetic nanoparticles in an oscillating field. J Genet. 91, (2), 223-227 (2012).
  21. Moore, S., Stein, W. H. A modified ninhydrin reagent for the photometric determination of amino acids and related compounds. J Biol Chem. 211, (2), 907-913 (1954).
  22. Jones, D. L., Owen, A. G., Farrar, J. F. Simple method to enable the high resolution determination of total free amino acids in soil solutions and soil extracts. Soil Biol Biochem. 34, (12), 1893-1902 (2002).
  23. Kircheis, R., Wightman, L., et al. Polyethylenimine/DNA complexes shielded by transferrin target gene expression to tumors after systemic application. Gene Ther. 8, (1), 28-40 (2001).
  24. Green, N. M. A SPECTROPHOTOMETRIC ASSAY FOR AVIDIN AND BIOTIN BASED ON BINDING OF DYES BY AVIDIN. Biochem J. 94, 23 (1965).
  25. Haugland, R. P., You, W. W. Coupling of Antibodies with Biotin. Methods Mol Biol. 418, 13-23 (2008).
  26. Braunschweig, J., Bosch, J., Heister, K., Kuebeck, C., Meckenstock, R. U. Reevaluation of colorimetric iron determination methods commonly used in geomicrobiology. J Microbiol Methods. 89, (1), 41-48 (2012).
  27. Andrade, ÂL., Valente, M. A., Ferreira, J. M. F., Fabris, J. D. Preparation of size-controlled nanoparticles of magnetite. J Magn Magn Mater. 324, (10), 1753-1757 (2012).
  28. Barbaro, D., Di Bari, L., et al. Glucose-coated superparamagnetic iron oxide nanoparticles prepared by metal vapour synthesis are electively internalized in a pancreatic adenocarcinoma cell line expressing GLUT1 transporter. PLoS ONE. 10, (4), e0123159 (2015).
  29. Gaebel, R., Ma, N., et al. Patterning human stem cells and endothelial cells with laser printing for cardiac regeneration. Biomaterials. 32, (35), 9218-9230 (2011).
  30. Martín de Llano, J. J., Fuertes, G., Torró, I., García Vicent, C., Fayos, J. L., Lurbe, E. Birth weight and characteristics of endothelial and smooth muscle cell cultures from human umbilical cord vessels. J Transl Med. 7, 30 (2009).
  31. Bonauer, A., Carmona, G., et al. MicroRNA-92a controls angiogenesis and functional recovery of ischemic tissues in mice. Science. 324, (5935), 1710-1713 (2009).
  32. Wang, W., Li, W., et al. Polyethylenimine-mediated gene delivery into human bone marrow mesenchymal stem cells from patients. J Cell Mol Med. 15, (9), 1989-1998 (2011).
  33. Lemcke, H., Peukert, J., Voronina, N., Skorska, A., Steinhoff, G., David, R. Applying 3D-FRAP microscopy to analyse gap junction-dependent shuttling of small antisense RNAs between cardiomyocytes. J Mol Cell Cardiol. 98, 117-127 (2016).
  34. Cheng, K., Li, T. -S., Malliaras, K., Davis, D. R., Zhang, Y., Marbán, E. Magnetic targeting enhances engraftment and functional benefit of iron-labeled cardiosphere-derived cells in myocardial infarction. Circ Res. 106, (10), 1570-1581 (2010).
  35. Strober, W. Trypan Blue Exclusion Test of Cell Viability. Curr Protoc Immunol. A.3B.1-A.3B.2 (2001).
  36. Chorny, M., Alferiev, I. S., et al. Formulation and in vitro characterization of composite biodegradable magnetic nanoparticles for magnetically guided cell delivery. Pharm Res. 29, (5), 1232-1241 (2012).
  37. Poller, W., Löwa, N., et al. Magnetic Particle Spectroscopy Reveals Dynamic Changes in the Magnetic Behavior of Very Small Superparamagnetic Iron Oxide Nanoparticles During Cellular Uptake and Enables Determination of Cell-Labeling Efficacy. J Biomed Nanotechnol. 12, (2), 337-346 (2016).
  38. Lobsien, D., Dreyer, A. Y., Stroh, A., Boltze, J., Hoffmann, K. T. Imaging of VSOP Labeled Stem Cells in Agarose Phantoms with Susceptibility Weighted and T2* Weighted MR Imaging at 3T: Determination of the Detection Limit. PLoS ONE. 8, (5), 1-10 (2013).
  39. Hernando, D., Kühn, J. -P., et al. R2* estimation using "in-phase" echoes in the presence of fat: the effects of complex spectrum of fat. J Magn Reson Imaging. 37, (3), 717-726 (2013).
  40. Soenen, S. J., Rivera-Gil, P., Montenegro, J. -M., Parak, W. J., De Smedt, S. C., Braeckmans, K. Cellular toxicity of inorganic nanoparticles: Common aspects and guidelines for improved nanotoxicity evaluation. Nano Today. 6, (5), 446-465 (2011).
  41. Robert, D., Kirkton, N. B. Genetic Engineering and Stem Cells: Combinatorial Approaches for Cardiac Cell Therapy. IEEE Eng Med Biol Mag. 27, (3), 85 (2008).
  42. Chen, Y., Wang, W., et al. Development of an MRI-visible nonviral vector for siRNA delivery targeting gastric cancer. Int J Nanomedicine. 7, 359-368 (2012).
  43. Diener, Y., Jurk, M., et al. RNA-based, transient modulation of gene expression in human haematopoietic stem and progenitor cells. Sci Rep. 5, 17184 (2015).
  44. Müller, P., Voronina, N., et al. Magnet-Bead Based MicroRNA Delivery System to Modify CD133+ Stem Cells. Stem Cells Int. 2016, 1-16 (2016).
  45. Yang, H., Vonk, L. A., et al. Cell type and transfection reagent-dependent effects on viability, cell content, cell cycle and inflammation of RNAi in human primary mesenchymal cells. Eur J Pharm Sci. 53, 35-44 (2014).
  46. Chen, C. -H., Sereti, K. -I., Wu, B. M., Ardehali, R. Translational aspects of cardiac cell therapy. J Cell Mol Med. 19, (8), 1757-1772 (2015).
  47. Alaiti, M. A., Ishikawa, M., et al. Up-regulation of miR-210 by vascular endothelial growth factor in ex vivo expanded CD34+ cells enhances cell-mediated angiogenesis. J Cell Mol Med. 16, (10), 2413-2421 (2012).
  48. Landázuri, N., Tong, S., et al. Magnetic targeting of human mesenchymal stem cells with internalized superparamagnetic iron oxide nanoparticles. Small. 9, (23), 4017-4026 (2013).
  49. Carenza, E., Barceló, V., et al. In vitro angiogenic performance and in vivo brain targeting of magnetized endothelial progenitor cells for neurorepair therapies. Nanomedicine. 10, (1), 225-234 (2014).
  50. Kyrtatos, P. G., Lehtolainen, P., et al. Magnetic Tagging Increases Delivery of Circulating Progenitors in Vascular Injury. JACC Cardiovasc Interv. 2, (8), 794-802 (2009).
  51. Huang, Z., Shen, Y., et al. Magnetic targeting enhances retrograde cell retention in a rat model of myocardial infarction. Stem Cell Res Ther. 4, (6), 149 (2013).
  52. Wu, X., Tan, Y., Mao, H., Zhang, M. Toxic effects of iron oxide nanoparticles on human umbilical vein endothelial cells. Int J Nanomedicine. 5, 385-399 (2010).
  53. Soenen, S. J. H., Nuytten, N., De Meyer, S. F., De Smedt, S. C., De Cuyper, M. High Intracellular Iron Oxide Nanoparticle Concentrations Affect Cellular Cytoskeleton and Focal Adhesion Kinase-Mediated Signaling. Small. 6, (7), 832-842 (2010).
  54. Cheng, K., Malliaras, K., et al. Magnetic enhancement of cell retention, engraftment, and functional benefit after intracoronary delivery of cardiac-derived stem cells in a rat model of ischemia/reperfusion. Cell Transplant. 21, (6), 1121-1135 (2012).
  55. Vandergriff, A. C., Hensley, T. M., et al. Magnetic targeting of cardiosphere-derived stem cells with ferumoxytol nanoparticles for treating rats with myocardial infarction. Biomaterials. 35, (30), 8528-8539 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics