Biyotiplerin Bakımında ve Türevinde Kullanılan Laboratuvar Teknikleri * These authors contributed equally

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Bu el yazması, klinik ve çevresel V arasındaki hızlı ve güvenilir diferansiyasyon için topluca kullanılan bir dizi biyokimyasal tahlilin yanı sıra, uygun Vibrio kolera bakımı tekniklerini tanımlamaktadır. Bir laboratuar ortamında kolera biyotipleri.

Cite this Article

Copy Citation | Download Citations

Brumfield, K. D., Carignan, B. M., Ray, J. N., Jumpre, P. E., Son, M. S. Laboratory Techniques Used to Maintain and Differentiate Biotypes of Vibrio cholerae Clinical and Environmental Isolates. J. Vis. Exp. (123), e55760, doi:10.3791/55760 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Sucul Gram-negatif bakteri Vibrio cholerae , bulaşıcı gastrointestinal hastalık kolera'sının etyolojik ajanıdır. Bu hastalığın yaygınlığı ve şiddeti nedeniyle, V. Kolera, uygun bakım ve kültür teknikleri gerektiren çevresel ve laboratuvar ortamlarında kapsamlı olarak incelenmiştir. Klasik ve El Tor, V'yi oluşturan iki ana biyotiptir. Kolera O1 serogrup, her biri biyotip karakterizasyonu için güvenilir mekanizmalar sağlayan benzersiz genotipik ve fenotipik özellikler gösterir ve kültürel koşulları uyandıran virülans gerektirir. Herhangi bir enfeksiyon ya da salgın için nedensel suşun biyotipinden bağımsız olarak, hastalık için standart tedavi rehidrasyon terapisini antibiyotik rejimi ile takviye edilmesini içerir. Bununla birlikte, biyotip sınıflandırması laboratuar çalışmaları için gerekebilir ve biyomedikal alanda daha geniş etkilere sahip olabilir.2000'lerin başında hem klasik hem de El Tor biyotiplerinden genotipik ve fenotipik özellikler sergileyen klinik izolatlar tespit edildi. El Tor varyantları olarak adlandırılan yeni tanımlanan melezler, klinik ve çevresel izolat biyotip tanımlamasının önceki geleneksel tek deney tanımlama protokollerinden daha karmaşık hale gelmesine neden oldu. V'yi tanımlamanın yanı sıra. Kolera genel bakım ve kültür teknikleriyle, bu el yazması PCR temelli genetik ekranlar ve fenotipik tahliller (polimiksin B direnci, sitrat metabolizması, proteolitik aktivite, hemolitik aktivite, motilite ve glikoz metabolizması ile Voges- Proskauer tahlili), klasik ve El Tor biyotiplerini tanımlamak ve / veya ayırmak için topluca kullanılır. Bu analizler birlikte, alternatif olarak veya buna ek olarak pahalı, yoğun emek yoğun deneyler için etkili bir sistematik yaklaşım sağlamaktadır.V. Kolera klinik (ve çevresel) izolatlar.

Introduction

Kolera kirlenmiş yiyeceklerin veya sudaki Gram-negatif bakteri Vibrio cholerae'nin bulunduğu suyun tüketiminden kaynaklanan distal ince bağırsağın bir hastalığıdır. Kolera semptomları, kusma ve kontrol edilemeyen sulanmış ishale neden olur ve ciddi şekilde dehidrasyona yol açar ve düzgün tedavi edilmezse ölümle sonuçlanacaktır. V. Kolera, hücre yüzeyi lipopolisakarid O-antijeninin yapısına dayanan 200'den fazla serogrupa bölünebilir. Bununla birlikte, sadece 2 serogrup, O1 ve O139, epidemik veya pandemik potansiyel 1 , 2 göstermiştir. Dahası, serogrup O139, öncelikle Güneydoğu Asya 3 , 4 için izole edilirken, O1 serogrup dünya çapında dağıtılır. Ayrıca, O1 serogrup 2 ana biyotipe ayrılabilir: klasik ve El Tor. Klasik biyotip, ilk 6 kolera salgından sorumluyduS devam ediyor. Yürürlükteki yedinci pandemi, klasik biyotipi 5 , 6 , 7 ortamında küresel olarak değiştiren El Tor biyotipinin bir sonucudur. Son zamanlarda, klasik ve El Tor biyotiplerinin 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 ayırıcı özelliklerini içeren ve bu tarihten itibaren El Tor varyantları 13 , 17 olarak adlandırılan suşlar ortaya çıkmıştır. Bazı El Tor varyantları, daha önce gözlemlenenden daha hızlı ve şiddetli hastalığın ilerlemesi ile artan virülans yetenekleri gösterdiğini vurguluyorAjan tanımlama ve hastalık önleme ve tedavisine yönelik daha kapsamlı bir yaklaşım gereği 8 , 9 , 18 . Biyotip tanımlaması tedaviyi derhal belirtmezken, aşı geliştirmede ilerlemeler ve gelecekteki terapötik ajanlar biyotip ayrımından yararlanabilir.

Burada listelenen protokollerin ilk serisi, araştırmacıların V'yi düzgün bir şekilde muhafaza etmelerini sağlayacaktır. Kolera atıkları laboratuar ortamında. Tutarlılık ve müteakip analiz, stokların hazırlanmasını ve izolatların büyümesini gerektirir; bu, biyotipe bağımlı değildir. Bununla birlikte, virülans gen ekspresyonunu optimal olarak teşvik etmek için, bağımsız biotipe özgü kültürleme teknikleri gereklidir 19 . Ayrıca, bu yazıda çeşitli genetik ve biyokimyasal tahliller için hazırlıklar özetlenmiştir.

Kolera toksini (BT) ve toksin birlikteGulated pilus (TCP), V'nin her iki biyotipinde ana düzenleyici ToxT tarafından kontrol edilen iki ana virülans faktördür. Kolera O1 serogrup 20 . CT, beş CtxB'den oluşan iki parçalı bir toksindir Tek bir CtxA altbirimini çevreleyen alt birimlerdir ve kolera ile ilişkili hızlı elektrolit kaybından sorumludur. TCP, tcp operon ( tcpABQCRDSTEF ) tarafından kodlanan bir tip IV pilus olup, distal ince bağırsağın tutunması ve kolonizasyonu ile ilgilidir. TcpA , pilusun yapımı için gerekli olan tek tek pilin alt birimlerini kodlayan tcp operonunun ilk genidir 8 . CtxA için gen dizisi, klasik ve El Tor biyotipleri arasında tamamen korunurken, ctxB ve tcpA iki biyotip arasında farklılık gösterir, ancak her biyotip 8'de korunmaktadır. CtxB , iki taban pozisyondan başka biotipler arasında tamamen korunmuştur(115 ve 203). El Tor biyotipinde, timin 115 ve 203 baz pozisyonlarında bulunurken, klasik biyotip bu bazlarda sitozin içerir. TcpA her biyotip içinde tamamen korunur, ancak biyotipler arasındaki çoklu bazlarda farklılık gösterir. Bu genetik farklılıklar birincil biyotip tanımlama markörleri olarak görev yapar ve bu siteleri de içeren polimeraz zincir reaksiyonu (PCR) amplifikasyon ürününün diziliminden sonra, izotop dizileri, biyotip arka planını belirlemek için vahşi tip (WT) klasik O395 veya WT El Tor N16961 ile karşılaştırılabilir Belirli bir V. cholerae izolatında BT ve TCP'nin sırasıyla.

Klasik ve El Tor biyotipleri 21 , 22 , 23 arasındaki fenotipik ayrımları karakterize etmek için çok sayıda protokol geliştirildi. Polimiksin B, Gram negatif bakta dış hücre zarı bütünlüğünü tehlikeye atan bir peptid antibiyotiktirTeria ve polimiksin B direnci, polimiksin B direnci tahlili ile görselleştirilebilir 21 . Sitrat Kreb döngüsünün birincil alt tabakasıdır ve sitratın tek bir karbon kaynağı olarak metabolize olabilme özelliği, sitrat metabolizması tahlili 22 kullanılarak saptanabilir. HapR , çeşitli promotör bölgelerine bağlanan ve gen ve operon ifadesini düzenleyen, global bir düzenleyiciyi ve ana çekirdeği algılayan düzenleyiciyi kodlar V. cholerae, HapR'de kodlar 24 . V. cholerae'nin bazı patojenik suşları, hapR geninde, virülans gen ekspresyonunun yoğunluğa bağlı düzenlenmesinin 24 , 25 yaşında kaybolmasına neden olan doğal olarak meydana gelen bir çerçeve kayması mutasyonuna sahiptir. Süt agar medyumu kullanarak HapR ile düzenlenmiş proteaz aktivitesinin ölçülmesi, araştırmacıya belirli bir izolatın işlevsel bir HapR 23 içerdiğini belirlemesine izin verir.Hemoliz testi, bir suşun kırmızı kan hücrelerini parçalayan hemolitik enzimleri salgılama kabiliyeti için test eder; Hemoliz derecesi kan agar plakalarında 23 görülebilir. Hareket genellikle V. cholerae virulence ile ilişkilidir ve motilite agar plakaları 23 kullanılarak analiz edilebilir. Voges-Proskauer tahlili, bir suşun tek bir karbon kaynağı olarak glikozu fermente etme ve yan ürün asetoin 21 üretme kabiliyeti için test eder. El Tor değişkenlerinin ortaya çıkmasıyla, geniş genotipik tarama yapılmadan ve V'nin biyotip arka planını çıkarmadan önce, herhangi bir fenotipik analizin sonuçlarını tahmin etmek zordur. Kolera izolatları için, bu tahlillerin 23 bir araya getirilmesinin ve sonuçların Tablo 2'deki gibi referans suşlarla karşılaştırılması önerilir.

Burada, toplu olarak bahsedilenleri kullanan bir seri protokol geliştirdik.V genini karakterize eden daha kapsamlı bir yaklaşım için genotipik ve fenotipik testler. Kolera biyotipleri. Ayrıca, bilinen V genotipik ve fenotipik ayrımlarını tanımladık. Kolera El Tor değişkenleri (MQ1795 ve BAA-2163), yaygın olarak kullanılan biyotip referans suşlarına kıyasla (WT klasik O395, WT El Tor C6706 ve WT El Tor N16961, Tablo 1 ) karşılaştırılmıştır. El Tor varyantlarının ortaya çıkışı, daha önce kullanılan tekli tahlil biyotip karakterizasyon protokollerinin güvenilirliğine meydan okuyor; Bununla birlikte, bu çoklu tahlil tanımlama sistemi, klinik ve çevresel V'nin daha güvenilir tanımlanmasına olanak tanır. Kolera izolatları.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Not: Her tahlil için zaman faktörleri ayrı ortam hazırlıkları için farklı zaman gerektirdiğinden yapılmalıdır. Örneğin, katı agar plakası ortamının yeterince soğumasına ve kurumasına (1-2 gün) izin verilmelidir. Ek zaman faktörleri ( yani, tek koloni ve gece boyunca kültür büyümesi) her protokol altında belirtilmiş ve Tablo 2'de bulunmuştur.

1. Medyanın Hazırlanması

  1. 1x Fosfat Tamponlu Tuz (PBS)
    1. 4.0 g NaCI, 0.1 g KCI, 0.72 g Na2HP04 ve 0.12 g KH2PO4 tartın. Bileşenleri 1 L'lik bir Erlenmeyer şişesi içerisinde birleştirin, hacmi deiyonize su ile 500 mL'ye ayarlayın, bir pH metre kullanarak pH'ı 7.2'ye ayarlayın ve çözeltiye damla damla HC1 ilave edin ve 0.22 μm'lik bir filtre kullanarak otoklav veya filtre sterilize edin. 1x PBS süresiz olarak oda sıcaklığında saklanabilir.
      DİKKAT: HC1 konsantre bir asittir ve buna göreKurumsal, yerel, eyalet ve federal yönetmeliklere. Uygun taşıma talimatları için, üretici tarafından sağlanan güvenlik bilgi formuna bakın.
  2. Luria-Bertani (LB) Broth
    1. 5.0 g tripton, 2.5 g maya özütü ve 2.5 g NaCI'yi tartın. Bileşenleri 1 L'lik bir şişede birleştirin, hacmi deiyonize su, otoklav ile 500 mL'ye ayarlayın ve 6 aya kadar oda sıcaklığında saklayın. Klasik biyotip virulence indükleme koşulları için, otoklavlamadan önce HC1 kullanarak pH'ı 6.5'e ayarlayın.
  3. % 0.03 (a / h) NaHC03 içeren AKI Ortamı
    1. Bileşen 1 için (AKI ortamı): 7.5 g pepton, 2.0 g maya ekstraktı ve 2.5 g NaCl tartılır. Bileşenleri 1 L'lik bir şişede birleştirin, deiyonize su ve otoklav ile hacmi 450 mL'ye ayarlayın. AKI ortamı oda sıcaklığında 6 aya kadar depolanabilir.
    2. Bileşen 2 için (NaHC03): 1.5 g NaHC03 tartılır ve hacim ayarlanırSteril bir vezikülde deiyonize su ile 50 mL'ye kadar soğutulur. Filtre, 0.22 um'lik bir filtre kullanarak NaHCO 3'ü sterilize edin. NaHCO 3 , kullanımdan hemen önce hazırlanmalıdır.
    3. Kullanmadan önce Bileşen 2'yi Bileşen 1'e filtreleyerek iki bileşeni aseptik olarak birleştirerek 1:10 oranını oluşturun.
  4. Luria-Bertani (LB) Ağar Pleytleri
    1. 5.0 g tripton, 2.5 g maya özütü, 2.5 g NaCl ve 7.5 g agardan tartılır. Bileşenleri 1 L'lik bir Erlenmeyer şişesi içinde birleştirin, hacmi, deiyonize su, otoklav ile 500 mL'ye ayarlayın ve standart boyutlu 100 mm x 15 mm steril Petri kaplarında hazırlayın. Kaplamalı ortam, kapak tarafı 4 ° C'de 6 aya kadar plastik içinde saklanabilir.
  5. Polimiksin B ile Tamamlanan LB Agar Plakaları
    1. Bileşen 1 (LB agar) için: 5.0 g tripton, 2.5 g maya özütü, 2.5 g NaCl ve 7.5 g agar tartılır. Bileşenleri 1 L'lik bir Erlenmeyer şişesi içerisinde birleştirin, hacmi 500 mL'ye ayarlayın.Deiyonize edilmiş su ve otoklav.
    2. Bileşen 2 (polimiksin B) için: polimiksin B'yi steril 2 mL mikrosantrifüj tüpünde 50.000 IU / μL konsantrasyona kadar deiyonize su içinde eritin ve 0.22 μm filtre kullanarak sterilize edin.
    3. Bileşen 1 dokunulduğunda serin, ancak katılaşmadıktan sonra, 50 μM / μL'lik bir nihai konsantrasyon oluşturarak Bileşen 1'e aseptik olarak 500 μL Bileşen 2 ekleyin ve iyice karıştırın. Petri kaplarına karışık agar medyum dökerek standart boyutlu 100 mm x 15 mm steril Petri yemekleri hazırlayın. Kaplamalı ortam, plastik kaplı olarak 3 aya kadar, kapak tarafı da 4 ° C'de saklanabilir.
  6. Minimal Sitrat Orta Agar Tabakları
    1. Bileşen 1 için (bromotiol mavisi olan agar): 7.5 g agar ve 0.02 g bromotimol mavi ağırlığındadır. Bileşenleri 1 L'lik bir Erlenmeyer şişesi içinde birleştirin, deiyonize su ile hacmi 450 mL'ye ayarlayın ve karışımı otoklavlayın.
    2. Bileşen 2 için (10x VBMM): 1 tartın0,0 g MgS04 7H20, 10,0 g sitrik asit H2O, 50,0 g susuz K2HPO4 ve 17,5 g NaNH4HP04 4H20. Bileşikleri 1 L'lik bir Erlenmeyer şişe içerisinde birleştirin, hacmi 500 mL'ye ayarlayın Deiyonize su ve otoklav ile veya 0.22 um'lik bir filtre kullanarak filtre sterilize edin. 10x VBMM oda sıcaklığında 6 aya kadar depolanabilir.
    3. Bileşen 1'e 50 mL Bileşen 2 ekleyin ve Petri kaplarına karışık agar medyum dökerek standart boyutlu 100 mm x 15 mm steril Petri yemekleri hazırlayın. Kaplamalı ortam, kapak tarafı 4 ° C'de 6 aya kadar plastik içinde saklanabilir.
  7. Süt Agar Tabakları
    1. Parça 1 (süt) için: 1 litrelik bir Erlenmeyer şişe içinde kuru gıdadan 8.0 g ağırlığında, deiyonize su ve otoklav ile hacmi 200 mL'ye ayarlayın.
    2. Bileşen 2 (beyin-kalp infüzyonlu agar) için: 3.68 g beyin-kalp infüzyonu ve 6.0 g agar ağırlığındadır. Konuyu birleştir500 mL'lik bir Erlenmeyer şişesi içerisinde çözündürülür, hacmi deiyonize su ve otoklav ile 200 mL'ye ayarlayın.
    3. İki bileşeni, otoklavdan sonra Bileşen 1'e dökerek birleştirin ve iyice karıştırın. 150 mm x 15 mm steril Petri yemekleri hazırlayın. Süt plakaları plastik kaplı, kapak tarafı 4 ° C'de bir hafta kadar saklanabilir. Karışık agar medya Petri yemekleri dökerek 150 mm x 15 mm steril Petri yemekleri hazırlayın.
  8. Hareketlilik Agar Tabakları
    1. Bileşen 1 (LB agar) için: 5.0 g tripton, 2.5 g maya özütü, 2.5 g NaCl ve 2.0 g agar tartılır. Kurucu maddeleri 1 L'lik bir Erlenmeyer şişesi içerisinde birleştirin, hacmi deiyonize su ve otoklav ile 500 mL'ye ayarlayın.
    2. Bileşen 2 için (% 1 (a / a) trifeniltetrazolyum klorür; TTC): 0,25 g TTC ağırlığında. Steril vezikül içinde deiyonize su ile hacmi 25 mL'ye ayarlayın ve 0.22 μm filtre kullanarak filtre sterilize edin. Oda sıcaklığında sarılı 6 aya kadar saklayınIşık maruziyetini en aza indirgemek için folyo halinde.
    3. Otoklavlı medyaya 2.5 mL% 1 (w / v) steril TTC ekleyin.
    4. Ortamı olabildiğince kalın (≥50 mL / plaka) büyük 150 mm x 15 mm steril Petri kaplarına koyun. Kaplamalı ortam, kapak tarafı 4 ° C'ye kadar bir hafta kadar plastik saklanabilir. Karışık agar medya Petri yemekleri dökerek 150 mm x 15 mm steril Petri yemekleri hazırlayın.
  9. Voges-Proskauer (VP)
    1. Bileşen 1 için (Methyl Red-Voges-Proskauer broth; MR-VP): 500 mL'lik bir Erlenmeyer şişesi içinde 1.7 g MR-VP ortamı tartın, hacmi deiyonize su ve otoklav ile 100 mL'ye ayarlayın. Steril MR-VP suyu oda sıcaklığında 6 aya kadar depolanabilir.
    2. Bileşen 2 için (% 5 (a / a) alfa (α) naftol): 1.0 g α-naftolü steril bir vezikül içinde tartın ve hacmi,% 95 etanol ile 20 mL'ye ayarlayın. Α-naftol oda sıcaklığında 1 hafta boyunca depolanabilir ve ışık exp değerini en aza indirgemek için folyoyla sarılabilir.osure.
    3. Bileşen 3 için (% 40 (w / v) potasyum hidroksit; KOH) steril vezikül içinde 20.0 g KOH tartın, steril deiyonize su ile hacmi 50 mL'ye ayarlayın. KOH, plastik bir kapta oda sıcaklığında 6 aya kadar depolanabilir.

2. V. Bakım ve Büyüme. Kolera suşları

  1. Dondurulmuş Stok Kültürlerinin Hazırlanması ve Kullanımı
    1. Steril 2 mL lik bir mikrosantrifüj tüpünde santrifüj (≥8,600 xg) ile 2 dakika boyunca sıvı gece boyunca kültürde 1.8 mL peletleyin, süpernatantı alın ve pipetleme ile taze LB suyu 900 μL'de hücre peletini tekrar askıya alın.
    2. Kültürü steril% 60 (v / v) gliserol 900 mcL ekleyin ve vorteksleme ile karıştırın.
    3. Karışımı steril 2 mL'lik kriyojenik bir tüpe aktarın ve -80 ° C'de süresiz olarak saklayın.
    4. Kullanmak için, steril bir inokülasyon halkası kullanarak küçük miktarda dondurulmuş stok çıkarın ve LB ag üzerinde tek koloniler çizinAr levhaları. Kültürlerin tamamen çözülmesini önlemek için donduktan hemen sonra -80 ° C'ye getirin. Plakaları kapak tarafı aşağıya 37 ° C'de 12 ila 16 saat inkübe edin.
  2. Sıvı Ortamda Gecelik Kültürlerin Büyümesi
    1. Donmuş stoktan LB agar plakalarına tek koloniler için (2.1.4'e göre) çizgiler. Plakaları kapak tarafı aşağıya 37 ° C'de 12 ila 16 saat inkübe edin.
    2. Steril bir aplikatör çubuğu ile tekli koloni yüzeyine dokunarak ve sıvı suyu içine koloni aktararak, tek bir koloni ile steril 10 mL kültür tüp 4 ml sıvı LB suyu inoküle edin.
    3. 37 ° C'de 12 ila 16 saat 225 rpm'de çalkalayıcı inkübatörde havalandırma ile inkübe edin.
  3. Büyüme Eğrisi
    1. Daha önce protokol 2.2'de belirtildiği gibi, sıvı LB suyu içinde gece kültür hazırlayın.
    2. Gece kültürünün 1: 100 seyreltmesini 250 μL gece kültürü 2'ye aktararak yapın5 mL taze LB suyu, steril 250 mL'lik Erlenmeyer şişesi içerisinde.
    3. Sıvı kültürlerin optik yoğunluğunu 600 nm'de (OD 600 ) her saat başı inokülasyon (T 0 ) zamanında ölçün.
    4. 37 ° C'ye kadar 30 saate kadar 225 rpm'de çalkalayıcı inkübatöründe havalandırma ile gece kültürü 1: 100 oranında seyreltin veya kültür maksimum yoğunluğa erişene kadar inkübe edin.
    5. OD 600'ün Zamanına grafiği çizin ve her suş için yaklaşık katlama süresini belirlemek için doğrusal regresyonu kullanın.
  4. El Tor Biotip Virulans İndükleme Koşulları
    1. Donmuş stoktan LB agar plakalarına tek koloniler çizin. Plakaları kapak tarafı aşağıya inkübe edin, 12-16 saat boyunca 37 ° C'de.
    2. Tek bir koloni ile% 0.03 (w / v) NaHC03 içeren 10 mL AKI ortamı inoküle edin.
    3. 37 ° C'de havalandırma olmadan kültürü 3.5 saat inkübe edin.
    4. 7 mL kültür çıkarın ve kalan 3 mL kültürü inkübe edinBir çalkalayıcı inkübatöre havalandırma ile 225 rpm'de ilave bir 4 saat tekrar uygulayın.
  5. Klasik Biyotip Virulans İndükleme Koşulları
    1. Donmuş stoktan LB agar plakalarına tek koloniler çizin. Plakaları kapak tarafı aşağıya 37 ° C'de 12 ila 16 saat inkübe edin.
    2. Tek bir koloni ile 4 mL sıvı LB suyu (pH 6.5) aşılayın.
    3. 30 ° C'de 12 ila 16 saat 225 rpm'de çalkalayıcı inkübatöründe havalandırma ile inkübe edin.
  6. 1x PBS'de Hücre Peletini Yıkama
    1. Steril 2 mL lik bir mikrosantrifüj tüpünde santrifüje (≥8,600 xg) ile 2 dakika boyunca gece boyunca kültür 1.8 mL peletleyin ve bir pipet kullanarak süpernatantı çıkarın. Pipetleme ile 1.8 mL 1x PBS içinde hücre süspansiyonunu yeniden askıya alın.
    2. Yıkama prosedürünü üç kez tekrarlayın, ardından 1.8 mL 1x PBS içinde nihai bir yeniden süspansiyon uygulayın.

3. V karakterizasyonu. Kolera biyotipleri

  1. PCtxB ve tcpA'yi kullanarak CR tabanlı Genetik Ekranlar
    1. Sırasıyla ctxB ve tcpA'nın translasyonel başlangıç ​​ve durma yerlerinin yaklaşık 50-70 bp yukarı akış ve aşağı akış hızlarına sahip bir dizi primer dizayn edin.
    2. Daha önce protokol 2.2'de belirtildiği gibi, sıvı LB suyu içinde gece kültür hazırlayın.
    3. Kromozomal DNA'yı, Gram negatif bakteriler için tasarlanmış piyasada bulunan bir kit kullanarak izole edin. Saflaştırılmış kromozomal DNA -20 ° C'de süresiz olarak saklanabilir. Ticari olarak temin edilebilen kitleri kullanarak kromozomal DNA izolasyonu genellikle yaklaşık 4 saat sürer.
    4. Kromozomal DNA örneğinin yüksek kalitede olmasını sağlamak için bir mikro-hacim spektrofotometre kullanın (A 260/280 > 1.8).
    5. Her bir kromozom DNA izolatı için, steril 200 μL PCR tüpü içerisinde buz üzerine polimeraz zincir reaksiyonu (PCR) hazırlayın ve standart PCR bileşenleri kullanılarak ctxB ve tcpA bölgelerini çoğaltın: Taq polimeraz ve buFfer (veya eşdeğerleri), dNTP çözeltisi ve ileri / geri primerler. Standart PCR parametrelerini kullanın (~ 3 saat). Örneğin, aşağıdaki protokolü kullanın:
      1. İlk denatürasyon 95 ° C'de 120 sn.
      2. 95 ° C'de 60 saniye boyunca denature edin.
      3. Anneal astarları 60 ° C'de 45 saniye süreyle.
      4. 90 ° C'de 72 ° C'de genleşin.
      5. 34 devir için 3.1.5.2 ile 3.1.5.4 arasındaki adımları tekrarlayın.
      6. Son uzantı 72 ° C 600 s.
      7. Sonsuz 4 ° C'de tutun.
    6. Standart bir 6x DNA jel yükleme boyası kullanarak ilgili PCR ürünlerinin 5 μl'ini boyayın ve 1x Tris-Borat-EDTA (TBE) içerisinde% 1 agaroz jel üzerine yaklaşık 10 mcL 1 kb merdiven ve 10 uL PCR ürünü yükleyin. tampon.
    7. Jel elektroforezi 130 V'da boya önü jelin sonuna gelene kadar (yaklaşık 90 dakika) çalıştırın. Voltaj ve çalışma süreleri ekipmana bağlı olarak değişebileceğinden, sabit izleme önerilir.
    8. Doğrulama üzerineBeklenen büyüklükte başarılı PCR amplifikasyonu, kalan 45 μL PCR ürününü ticari olarak mevcut bir DNA temiz ve konsantratör kiti kullanarak arındırın.
    9. Sıra, PCR amplifikasyonu için kullanılan aynı primerler kullanılarak PCR ürün (lerini) temizledi ve yerel sıralama düzeni talimatlarına göre hazırlandı.
    10. Her bir izolattan gelen gen dizilerinin FASTA biçimini, NCBI web sitesinde (http://www.ncbi.nlm.nihm.gov/gene/) bulunan yayınlanmış diziyle karşılaştırarak, arama sorgu kutusundaki aşağıdaki erişim numaralarını arayın.
    11. CtxB : (klasik) VC0395_A1059 ile VC0395_A1060 (El Tor) arasında VC_1456
    12. TcpA : (klasik) VC0395_A0353 (El Tor) VC_0828
  2. Spotting yoluyla biyotip sınıflandırması için fenotipik tahliller
    1. Daha önce protokol 2.2'de belirtildiği gibi, sıvı LB suyu içinde gece kültür hazırlayın.
    2. Hücre pelet (ler) i protokol 2.6'da belirtildiği şekilde yıkayın.
    3. Bir pipetleİlgili ortamda 1 μL yıkanmış küf kültürleyin. Orta seçim ve inkübasyon spesifikasyonları için Tablo 2'ye bakın.
  3. Hareket Testi
    1. Daha önce protokol 2.2'de belirtildiği gibi gece boyunca kültür (leri) sıvı LB suyu içinde hazırlayın.
    2. Hücre pelet (ler) i protokol 2.6'da belirtildiği şekilde yıkayın.
    3. Yıkanan sıvı kültür içine inokülasyon bıçağı takarak motilite agar plakalarını aşılayın ve medyaya dikey olarak "bıçakla" sokun. Her inokülasyon sırasında, bir boğaz yakıcı kullanarak tel bıçağını sterilize edin ve ağarı bıçaklandığında, sonuçların değişmesi için inokulasyon bıçağının bükülmediğinden emin olun.
    4. Plakaları kapak tarafını 14 ila 24 saat boyunca 37 ° C'de inkübe edin. 14 saat sonra, hareketlilik plakalarını yakından izleyerek kültürlerin aşırı büyümesini önleyin.
  4. Voges-Proskauer (VP) Testi
    1. Daha önce protokol 2.2'de belirtildiği gibi gece boyunca kültür (leri) sıvı LB suyu içinde hazırlayın.
    2. İnoküle et 4ML metil kırmızı Voges-Proskauer veya MR-VP besiyeri ile önceden hazırlanmış 10 ul'lik bir gece kültürü, steril bir kültür tüpünde 4 mL MR-VP suyu içine pipetle konur ve 12 ila 16'lık 225 rpm'de bir çalkalayıcı kuluçka havası ile inkübe edilir Saat 37 ° C'de.
    3. Sırasıyla steril kültür tüpleri içinde 1 mL'lik MR-VP gece kültürü kısımlarına 150 uL% 5 (a / a) a-naftol ve 50 μL% 40 (a / a) KOH ilave edin.
    4. Kısaca vorteks ve renk değişikliği gelişene kadar oda sıcaklığında 4 saate kadar bekletin.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Herhangi bir bakteri suşunun uygun şekilde bakım ve kullanımı için, ilgili suşların katlanma zamanını bilmek tavsiye edilir. Burada, yaygın olarak kullanılan V'nin değişen büyüme oranları. Kolera suşları bir büyüme eğrisi vasıtasıyla gösterildi ve yaklaşık çiftleme süreleri doğrusal regresyon kullanılarak hesaplandı. WT El Tor N16961 ve El Tor varyantı MQ1795, WT klasik O395'e (~ 2 saat) kıyasla daha kısa katlanma süreleri (sırasıyla ~ 1 saat ve ~ 1 saat) göstermiştir ( Şekil 1 ; Tablo 2 ).

V. cholerae genetik manipülasyonu ve müteakip analiz çoğunlukla biyotipler arasında doğru bir şekilde ayırma kabiliyetine dayanır. PCR tabanlı genetik ekranlar ve fenotipik analizler, V'nin biyotip arka planlarını ayırt etmek için güvenilir bir sistem olarak topluca uygulanmıştır. Kolera klinik ve çevreselsolates; Temsil için, biyotip referans suşları (WT klasik O395, WT El Tor C6706 ve WT El Tor N16961) ve temsili El Tor türevleri (MQ1795 ve BAA-2163) dahil edildi ( Tablo 1 ). WT klasik O395, klasik ctxB ve tcpA sekanslarını gösterdi. Tersine, WT El Tor suşları N16961 ve C6706, El Tor ctxB ve tcpA sekanslarını göstermiştir. İlginçtir, MQ1795 ve BAA-2163, klasik biyotip ctxB altbirimini O395'e kıyasla içeriyordu, ancak her iki El Tor varyantı da El Tor biyotip arka planını gösteren tcpA içeriyordu ( Tablo 1 ). WT klasik biyotip türü O395 polimiksin B'ye karşı duyarlılık gösterirken, WT El Tor biyotip türleri (C6706 ve N16961), polimiksin B ile takviye edilmiş LB agar plakalarında direnç göstermiş ve büyüme göstermiştir. Temsili El Tor varyant suşları (MQ1795 ve BAA-2163) WT El Tor biyotip straine göre antibiyotik benzer dirençIns (C6706 ve N16961) ( Şekil 2 , Tablo 2 ). WT klasik biyotip türü O395, minimal sitrat ortamında büyümedi; WT El Tor suşları (C6706 ve N16961) sitratın bir karbon kaynağı olarak kullanılabildiğini ve minimal sitrat medyasında büyüme sergilediğini ortaya koydu. Temsilci El Tor değişken biyotip türleri (MQ1795 ve BAA-2163), WT El Tor biyotip türlerine (C6706 ve N16961) kıyasla büyümüştür ( Şekil 3 , Tablo 2 ). WT klasik O395 suşu ve WT El Tor suşu N16961, fonksiyonel olmayan bir HapR'ye sahiptir ve bu nedenle HapR ile düzenlenmiş proteaz aktivitesi göstermez; WT El Tor suşu C6706 ve temsili El Tor türevleri (MQ1795 ve BAA-2163), aşılama noktasından çıkan bir boşluk bölgesi olarak hapR-pozitif olarak görselleştirilmiştir ( Şekil 4 , Tablo 2 ). WT klasik suş O395, hemolitik enzimleri salgılar ve dolayısıylaE γ-hemolitik iken, WT El Tor biyotip türleri (C6706 ve N16961) ve temsil eden El Tor değişken suşları (MQ1795 ve BAA-2163), aşılama noktasını çevreleyen kırmızı kan hücrelerini tamamen çözen ve β-hemoliz izleyen hemolitik enzimleri salgılar ( Şekil 5 ; Tablo 2 ). Motilite, biyotip türleri arasında ve içinde değişir; Bununla birlikte, WT El Tor suşu N16961 ve El Tor varyantları (MQ1795 ve BAA-2163), nispeten daha az hareketli WT klasik O395 ve WT El Tor suşu C6706'ya kıyasla hiper motilite göstermiştir ( Şekil 6 , Tablo 2 ). WT klasik O395 suşu ve temsilcisi El Tor türevleri, asetoin üretmek için glukozu metabolize etmedi, WT El Tor biyotip türleri, Voges-Proskauer tahlili sırasında derin kırmızı bir renk oluşmasıyla gösterildiği gibi, glikoz fermentasyonunun bir yan ürünü olarak asetoin üretti ( Şekil 7 Tablo 2 ).

Gerginlik CtxB geni TCPA'yı Referans
Taban 115 Taban 203 biyotip biyotip
O395 C C klasik klasik 8
C6706 T T El Tor El Tor 8
N16961 T T El Tor El Tor 8
MQ1795 C C klasik El Tor 13
BAA-2163 C C klasik El Tor 8

Tablo 1: Vibrio cholerae Referans Suşlarının Biyotipli Bağımlı Genetik Farklılıkları . Bu tabloda, ctxB ve tcpA genlerinde bulunan DNA taban değişiklikleri ve göreli konumları gösterilmektedir . WT klasik O395 ve WT El Tor suşları N16961 ve C6706 yaygın olarak kullanılan biyotip referans suşlarıdır. MQ1795 ve BAA-2163, El Tor değişkenleri olarak bilinir.

tahlil Uygulama Orta Seçim Kuluçka Beklenen sonuçlar
O395 C6706 N16961 MQ1795 BAA-2163
2.3) Büyüme Eğrisi 27 Çeşitli V. cholerae suşlarının çoğalma zamanlarını belirler. 1.2) Sıvı LB Çözeltisi 30 saate kadar (havalandırmayla 37 ° C) ~ 2 saat ND * ~ 1 saat ~ 1 saat ND *
3.1) ctxB ve tcpA 8 kullanarak PCR Tabanlı Genetik Ekran CtxB'nin klasik ve El Tor biyotip arka planlarını ayırt eder N / A N / A klasik El Tor El Tor klasik klasik
TcpA'nın klasik ve El Tor biyotip arka planlarını ayırt eder N / A N / A klasik El Tor El Tor El Tor El Tor
3.2) Polimiksin B Direnci 21 Polimiksin B antibiyotiğine duyarlılık 1.5) polimiksin B ile takviye edilmiş LB agar plakaları 18 saat (37 ° C) - + + + +
3.2) Sitrat Metabolizması 22 Sitratın tek karbon kaynağı olarak metabolize olabilme becerisi 1.6) Minimal sitrat orta agar plakaları 24 saat (37 ° C) - + + + +
3.2) Kazein Hidrolizi 23 HapR ile düzenlenmiş proteaz aktivitesi 1.7) Süt agar plakaları 18 saat (37 ° C) - - + + +
3.2) Hemoliz 23 Hemolitik aktiviteyi ölçer Kan agar plakaları 48 saat (37 ° C) Gama Beta Beta Beta Beta
3.3) Hareketlilik 23 Hareket derecesini ölçer 1.8) Hareketlilik agar plakaları 14-24 saat (37 ° C) 10 mm 15 mm 21 mm 25 mm 29 mm
3.4) Voges-Proskauer 21 Glokozu fermente etme ve yan ürün olarak asetoin üretme becerisini ölçer 1.9) Sıvı Voges-Proskauer ortamı 4 saate kadar (oda sıcaklığı) - + + - -
Not: "ND *" belirlenmediğini gösterir; "+" Olumlu bir sonuca işaret eder; "-" negatif bir sonucu gösterir

Tablo 2: Genetik ve Fenotipik Tahliller Özeti Vibrio cholerae Biotype Distinction. Bu tablo, bu çalışmada kullanılan klasik ve El Tor biyotipleri arasında ayrım yapmak için toplu olarak kullanılan çeşitli genetik ve fenotipik testleri, uygulamaları ve beklenen sonuçları özetlemektedir. Protokol numaraları ve spesifik protokollere yapılan referanslar Test sütununda belirtilmiştir. "ND *" Belirlenmediğini gösterir ; "+" Olumlu bir sonuca işaret eder; "-" negatif bir sonuca işaret eder.

Şekil 1
Şekil 1: V. WT Klasik O395, WT El Tor N16961 ve El Tor Variant MQ1795'in kolerae Büyüme Eğrisi. 37 ° C havalandırma ile LB suyu içinde yetiştirilen biyotip referans suşlarının (WT klasik O395 ve WT El Tor N16961) büyüme oranları ve temsilci El Tor Variant MQ1795, OD 600 e'nin ölçülmesiyle analiz edildiÇok saat başında T 0'dan başlar. Büyüme eğrileri, her bir deneme için bağımsız bir kültür olayını temsil eden her replikasyonla birlikte, 8 bağımsız deneysel kopyada gerçekleştirildi. WT El Tor türü N16961 ve El Tor varyantı MQ1795, daha uzun bir katlama zamanı ile gözlemlendiği gibi WT klasik O395 suşuna (~ 2 saat) kıyasla daha kısa katlanma süreleri (sırasıyla ~ 1 saat ve ~ 1 saat) göstermiştir. Bu rakamın daha büyük bir versiyonunu görmek için lütfen tıklayınız.

şekil 2
Şekil 2: Polimiksin B İle Tamamlanan LB Agar Kullanılarak Polimiksin B Direncinin Belirlenmesi B. Polimiksin B peptit antibiyotiğine direnç, 50 IU / μL polimiksin B ile takviye edilmiş LB agar üzerinde büyüme kabiliyeti ile belirlendi. WT klasik soy O395, agar üzerinde herhangi bir büyüme göstermedi. Özel SayıPolimiksin B ile ortaya çıkmış ve antibiyotik duyarlı olduğu düşünülmüştür. WT El Tor suşları (C6706 ve N16961) ve temsili El Tor türevleri (MQ1795 ve BAA-2163), antibiyotik varlığında büyüme sergilerken, polimiksin B'ye dirençli sayılırlar. Plakalar, 37 ° C'de 18 saat inkübe edildi. Bu rakamın daha büyük bir versiyonunu görmek için lütfen tıklayınız.

Şekil 3
Şekil 3: Minimal Sitrat Ortamını Kullanarak Sitrat Metabolizmasının Ölçülmesi. Sitratın tek bir karbon kaynağı olarak kullanılması, izolatın minimal sitrat ortamda büyüme kabiliyeti ile belirlenmiştir. WT klasik soy O395, minimal sitrat ortamında büyümedi (negatif). Büyüme, tüm WT El Tor suşları (C6706 ve N16961) ve temsilci ElTor türevi (MQ1795 ve BAA-2163), sitratın tek bir karbon kaynağı (pozitif) olarak kullanılabilme yeteneğini göstermiştir. Plakalar, 37 ° C'de 18 saat inkübe edildi. Bu rakamın daha büyük bir versiyonunu görmek için lütfen tıklayınız.

Şekil 4
Şekil 4: Süt Ağarı Ortamını Kullanarak HapR ile düzenlenen Proteolitik Kazein Hidrolizinin Ölçülmesi. HapR ile düzenlenen proteaz aktivitesi yoluyla kazein hidrolizi, süt agarında aşılanma noktasını çevreleyen bir boşluk görsel bölgesi ile tespit edildi. WT klasik O395 suşu ve WT El Tor suşu N16961 gibi fonksiyonel olmayan bir HapR içeren suşlar, aşılama noktasını çevreleyen bir boşluk bölgesi ( hapR- negatif) üretmedi . WT El Tor suşu C6706 ve temsili El Tor varyantları (MQ1795 ve BAA-2163), farklı boyutlardaki boşluk alanları ( hapR- pozitif) olarak görselleştirilebilen işlevsel bir HapR'yi içerir. Plakalar, 37 ° C'de 18 saat inkübe edildi. Bu rakamın daha büyük bir versiyonunu görmek için lütfen tıklayınız.

Şekil 5
Şekil 5: Kan Agar Media Kullanılarak Hemolitik Aktivitesi Ölçülmesi. Hemolitik aktivite, koyun kanı ile desteklenmiş agar plakaları kullanılarak ölçüldü. WT klasik suşu O395, kırmızı kan hücrelerini çözen enzimleri (γ-hemolitik) salgılamaz. WT El Tor suşları (N16961 ve C6706) ve temsilcisi El Tor türevleri (MQ1795 ve BAA-2163), hemolitik enzimler salgılar ve aşılanma noktasını çevreleyen yarı saydam bir bölge (β-hemolitik) ile sonuçlanır. Plakalar, 37 ° C'de° C 48 saat boyunca. Bu rakamın daha büyük bir versiyonunu görmek için lütfen tıklayınız.

Şekil 6
Şekil 6: Motiliteli Agar Plakalarını Kullanarak Motiliteyi Belirleme. Motilite bölgesi, TTC tuzunun görsel bir renk değişikliği ile gösterildi ve TTC, metabolizma yapıldığında berraktan kırmızıya dönüşerek bakterilerin nereye hareket ettiğini gösterdi. El Tor Seri N16961 (21 mm) ve temsili El Tor varyantları (MQ1795 (25 mm) ve BAA-2163 (29 mm)) WT klasik O395 suşu (10 mm) ve WT El Tor suşu C6706'nın (15 mm) ) O395 ve C6706'ya göre hiper-motilite göstermiştir. Plakalar, 37 ° C'de 18 saat inkübe edildi. lütfen tıklayınBu şeklin daha büyük bir versiyonunu görmek için buraya tıklayın.

Şekil 7
Şekil 7: Voges-Proskauer Testi. Glukoz fermantasyonu yoluyla asetoin üretimi, Voges-Proskauer tahlili kullanılarak belirlendi. WT klasik O395 suşu ve temsili El Tor türevleri (MQ1795 ve BAA-2163) glukoz fermantasyonu sonucu (negatif) asetoin üretmedi. WT El Tor suşları (N16961 ve C6706) yan ürün asetoin üretti ve derin kırmızı renk değişikliği (pozitif) ile görselleştirilebilir. Tüpler, oda sıcaklığında 4 saat inkübe edildi. Bu rakamın daha büyük bir versiyonunu görmek için lütfen tıklayınız.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Belirlenen 200'den fazla V. Kolera serogrupları, sadece O1 ve O139 epidemik potansiyele sahiptir. O1 serogrup iki biyotipe ayrılabilir: klasik ve El Tor. Bununla birlikte, El Tor'un 13 ve 17 tipi olarak adlandırılan melez soyları, El Tor'un biyotip arka planına sahip ve 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 klasik özelliklere sahip oldukları ortaya çıkmıştır. Bu el yazmasında anlatılan protokoller, V. cholerae'nin çeşitli klinik ve klinik dışı izolatlarını karakterize etme ve / veya ayırt etme ile ilgilenen araştırmacılara güvenilirÇoklu tahlil tanımlama sistemi. Alternatif olarak güvenilir bir çoklu tahlil tanımlama sisteminin kullanılması, daha önce kurulmuş olan tek deney tanımlama sistemlerine ve emek yoğun genetik ekranlara kıyasla bir gelişmedir. Tüm genotipik ve fenotipik analizler karşılaştırma için WT klasik O395 suşu ve WT El Tor suşları C6706 ve N16961 içermelidir ( Tablo 1 ). Klasik ve El Tor biyotip türleri referans olarak dahil edilmekle birlikte, çalışmalarımıza dahil olan MQ1795 ve BAA-2163 gibi izolatlar, biyotipten fenotipik profiller ( Şekil 2 , Şekil 3 , Şekil 4 , Şekil 5 , Şekil 6 , Şekil 7 , Tablo 2 ), güvenilir karakterizasyon için birden fazla genotipik ve fenotipik özellik analizi gerekliliğini göstermektedir. Tüm protokoller aseptik yapılmalıdır.Aksi belirtilmediği sürece oda sıcaklığında kurutulmuştur. V. Kolera, ölümcül gastrointestinal hastalık kolerasının etiyolojik ajanı olan bir Biyogüvenlik Seviyesi 2 (BSL-2) patojendir; Tüm materyallerin ve atık ürünlerin düzgün bir şekilde elleçlenmesi ve bertaraf edilmesi, kurumsal, yerel, eyalet ve federal yönetmeliklere göre uygulanmalıdır.

Tüm ortamların ve reaktiflerin hazırlanması, minimum 18 MΩ-cm hassasiyetine kadar deiyonize analitik dereceli reaktifler ve saf su ile gerçekleştirilmelidir. İşlemden önce, ortam hazırlanmalı ve yeterince kurumaya bırakılmalıdır (1-2 gün); Agar yüzeyinde kalıntı sıvı bulunmadığında tabaklar yeterince kuru kabul edilir. Hareket yelpazesi ve bakteriyel büyümeyi çevreleyen açıklık bölgelerinden dolayı, motilite ve süt plakaları plaka başına 50 mL'ye kadar büyük Petri kaplarında (150 mm x 15 mm) hazırlanmalı ve 1 hafta kadar plastik içinde sarılabilmelidir , LiD-tarafı aşağı 4ºC'de. Ek olarak, hareketlilik plakalarının agar konsantrasyonu, motiliteyi yavaşlatmak için ayarlanabilir; Bununla birlikte, 500 mL'lik çözelti başına 3 g'ı geçen agarın aşılması önerilmez, zira genel hareketliliği önemli ölçüde azaltacak ve böylece farklılıklar gözlemlenemeyecektir. Diğer tüm plaka ortamları, standart ebatlı Petri kaplarında (100 mm x 15 mm) plaka başına yaklaşık 25 mL'ye hazırlanmalı ve kapak tarafı 4 ºC'de plastik altına sarılı altı aya kadar saklanmalıdır. Polimiksin B plakalarının hazırlanması için, polimiksin B eklenmeden önce otoklavdan sonra erimiş ortamın soğumasına izin verilmesi önemlidir, çünkü aşırı sıcaklık antibiyotikleri bozabilir. Polimiksin B plakaları, plastik kaplı, kapak altı, 4ºC'de 3 aya kadar depolanabilir. Bu yazıda tartışılan tahliller, tek koloni büyümesi için bir gün (12-16 saat), geceleme kültürlerinin büyümesi için ek bir gün (12-16 saat) ve genotipik (kromozomal DN için ~ 4 saat) için üçüncü bir gün gerektirirPCR için bir izolasyon ve ~ 3 saat) veya fenotipik deneyler (18-48 saat, Tablo 2 ). Bu el yazmasında anlatılan fenotipik analizlerin biyokimyasal analizi öncesinde, kültürler sonuçların çarpılmaması için kalan kültür ortamının taşınmasını önlemek için 1x PBS'de yıkanmalıdır. Ek olarak, polimiksin B, sitrat, proteaz aktivitesi, hemoliz ve hareketlilik testleri aynı anda tek bir yıkanmış gece boyunca kültür kullanılarak inoküle edilebilir. Kaplamalı ortamı tespit ederken, kültürlerin sıçraması meydana gelebilir ve suşlar arasında çapraz kontaminasyona neden olabilir. Sıçramayı önlemek için, kültürü pipetten tamamen çıkarmaktan kaçının, bunun yerine kültürü pipetin ilk durağında bırakmayı bırakın. Ayrıca, lekelerin kuluçka öncesi agar yüzeyine tam olarak emdirilmesine izin verin ve sonuçları etkileyebilecek agarın delinmemesi için özen gösterin. Fenotipik analizler, boşluk bölgelerine neden olur ( Şekil 4 ; Şekil 5 ; Tablo 2) Ve / veya hareketliliği ( Şekil 6 , Tablo 2 ) karşılaştırma analizi için ilgili çapların ölçülebileceği açıklık veya büyüme alanlarının birleştirilmesini önlemek için maksimum aralıklarla yerleştirilmelidir. İnkübasyon sürelerinden sonra, izotatlar biyotip referans suşlarına göre (WT klasik O395, WT El Tor C6706 ve WT El Tor N16961) imgelendirilebilir ve analiz edilebilir.

Bu yazıda özetlenen sıralama vasıtasıyla PCR'ye dayalı genetik ekranlar, başlangıç ​​PCR amplifikasyonunu takiben izolatın biyotip arka planını ctxB ve tcpA'ya göre tanımlamak için kullanılabilir. Standart sıralama kuralları, amplifiye bölgenin boyutuna (ctxB için 580 bp ve tcpA için 1420 bp) bağlı olarak belirli bir miktarda PCR ürünü gerektirir ve reaksiyonları ayarlamak için kurulan protokoller takip edilebilir. Kısaca, bireysel ileri ve rTers dizi reaksiyonları, 3-5 pmol primer / reaksiyon ile hazırlanmalı ve hacim, 1.5 mL'lik bir mikrosantrifüj tüpünde steril ultra saf su ile 20 ul'ye ayarlanmalıdır. Hem PCR amplifikasyonu hem de dizilim için primer tasarımında yardım için, NCBI primer tasarım aracı http://www.ncbi.nlm.nih.gov/tools/primer-blast/ kullanılabilir. Başarılı bir yükseltme ve ctxB ve TCPA sekanslanması, aşağıdaki primerler kullanılarak gerçekleştirilebilir (5 '→ 3'): ctxB- ileri GGGAATGCTCCAAGATCATCGATGAGTAATAC, ctxB -reverse CATCATCGAACCACAAAAAAGCTTACTGAGG, TCPA -İlet CCGCACCAGATCCACGTAGGTGGG, TCPA -reverse GTCGGTACATCACCTGCTGTGGGGGCAG. CtxB'nin kodlama bölgesinin tamamının , 115 ve 203 nolu baz pozisyonları (El Tor'daki klasik ve timidin her ikisinde de sitozin hariç) her iki biyotip boyunca muhafaza edildiğine dikkat edilmelidir. Buna ek olarak, tcpA'da , biyotipler arasında çoklu taban değişiklikleri korunmaktadır;Biyotipler arasında ayrım yapmaya yardımcı olmak için kullanılabilen iki biyotip arasında ( Tablo 1 ) iffer.

V model organizmayı içeren birçok laboratuar çalışmasında. Kolera, uygun bakım ve kültür teknikleri önemlidir 27 . Yaygın olarak kullanılan V büyüme oranları. WT klasik suş O395 ve WT El Tor suşu N16961 gibi kolera biyotip referans suşları, El Tor varyant izolatlarının karakterizasyonu hakkında yararlı bilgiler sağlayabilir ( Şekil 1 , Tablo 2 ). V boyunca değişen büyüme oranları nedeniyle. Kolera izolatları, kültürler geç sabit fazda maksimum bulanıklığa ulaşana kadar her saat spektrofotometre emilim okumaları yapmak önemlidir. Fazla hücre öküsüyle sonuçlanan bulanıklık platosu nedeniyle orta-geç ölüm fazı görselleştirilemeyebilir. Steril L'ye 1: 4 oranında seyreltik kültür Absorbans okumaları bir OD 600 ≈ 1.0'da zirveye ulaştığından tam bir büyüme eğrisi elde etmek ve enstrümanın hassaslığını korumak için B broth yapılmalıdır. Çoklu suşlar üzerinde büyüme eğrileri yaparken, absorbans okumaları, okumalar arasındaki tutarlılığı sağlamak için her suş için yaklaşık 5 dakika aralıklarla zamanlanmalıdır. V'yi anlama. Kolera biyotipi büyüme oranları, virülans gen ekspresyon çalışmaları, metabolik aktivitelerin analizi ve uygun kültürleme ve saklama koşulları gibi birçok araştırmada kritik önem taşır. Sonraki analizler için, geceleme kültürleri geç büyümedeki (12-16 saat) sabit büyüme evresine kadar işleme tabi tutulmalı ve hücre çoğalmasını maksimize edip hücresel bütünlüğü muhafaza etmelidir.

Bununla birlikte, klasik ve El Tor biyotip türleri için kültür koşulları, V'deki virulans gen ekspresyonunun benzeridir. Kolera, biyotipe spesifik virülans indükleyici koşullar gerektirirRef "> 19. CT ve TCP'nin iki önemli virülans faktörü ana regülatör ToxT tarafından kontrol edilir ve spesifik büyüme koşulları altında optimal şekilde ifade edilir, örneğin El Tor virülans indükleyici koşullar altında ToxT tam hücre özütünün işlenmesi ile analiz edilebilir ( WCE) veya hücre peletini 3.5 saatte bulurken, CT ve TCP ekspresyonu, sırasıyla, 7.5 saatte hücre serbest süpernatanı ve WCE'yi işleyerek analiz edilebilir.8,20 Bu el yazması boyunca gösterilen değişken genotipik ve fenotipik özellikler, Çeşitli V. Kolera biyotipleri, daha önce kullanılan tekli tahlil biyotip karakterizasyonuna alternatif olabiliyor ve bunun için gerekli olanı gösterebilir.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarların açıklayacak bir şeyi yok.

Acknowledgements

NIH Ulusal Tıp Bilimleri Enstitüsünden bir Kurumsal Gelişim Ödülü (IDeA), P20GM103506 aracılığıyla New Hampshire-INBRE tarafından desteklenen araştırma.

Materials

Name Company Catalog Number Comments
1 kb DNA Ladder New England Biolabs N3232S https://www.neb.com/products/n3232-1-kb-dna-ladder
60% Glycerol Calbiochem 356352 http://www.emdmillipore.com/US/en/product/Glycerol%2C-Molecular-Biology-Grade---CAS-56-81-5---Calbiochem,EMD_BIO-356352
Agar Becto, Dickinson and Co. 214030 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=214030&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D214030%26typeOfSearch%3DproductSearch
Agar with brain-heart infusion Becto, Dickinson and Co. 237500 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=237500&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D237500%26typeOfSearch%3DproductSearch
Agarose Peqlab 732-2789 https://de.vwr.com/store/catalog/product.jsp?catalog_number=732-2789&_DARGS=/store/cms/de.vwr.com/de_DE/header_2016111711383215.jsp_AF&_dynSessConf=1766917479792147141&targetURL=/store/catalog/product.jsp%3Fcatalog_number%3D732-2789&lastLanguage=en&/vwr/userprofiling/EditPersonalInfoFormHandler.updateLocale=&_D%3AcurrentLanguage=+&currentLanguage=en&_D%3AlastLanguage=+&_D%3A/vwr/userprofiling/EditPersonalInfoFormHandler.updateLocale=+
Anhydrous K2HPO4 Fisher Scientific P288-500 https://www.fishersci.com/shop/products/potassium-phosphate-dibasic-anhydrous-crystalline-powder-certified-acs-fisher-chemical-5/p288500?searchHijack=true&searchTerm=P288500&searchType=RAPID
Blood Agar Plates Remel R01200 Store at 4 °C;  http://www.remel.com/Catalog/Item.aspx?name=Blood+Agar
Boric Acid Fisher Scientific A73-500 https://www.fishersci.com/shop/products/boric-acid-crystalline-certified-acs-fisher-chemical-6/a73500?searchHijack=true&searchTerm=A73500&searchType=RAPID
Bromothymol Blue Fisher Scientific B388-10 https://www.fishersci.com/shop/products/bromothymol-blue-certified-acs-fisher-chemical/b38810?searchHijack=true&searchTerm=B38810&searchType=RAPID
Cirtric acid ·H2O Fisher Scientific S72836-3 https://www.fishersci.com/shop/products/citric-acid-monohydrate-4/s728363#?keyword=s728363
Deoxynucleotide (dNTP) Solution Kit New England Biolabs N0446S Store at -20 °C;  https://www.neb.com/products/n0446-deoxynucleotide-solutionset
Disodium EDTA Fisher Scientific S311-500 https://www.fishersci.com/shop/products/ethylenediaminetetraacetic-acid-disodium-salt-dihydrate-crystalline-certified-acs-fisher-chemical-7/s311500?searchHijack=true&searchTerm=S311500&searchType=RAPID
DNA Clean & Concentrator™ -25 Kit Zymo Research D4007 http://www.zymoresearch.com/dna/dna-clean-up/zymoclean-gel-dna-recovery-kit
GelGreen Nucleic Acid Stain Biotium 41005 https://biotium.com/product/gelgreentm-nucleic-acid-gel-stain-10,000x-in-water/
Genesys 10SUV-VIS Spectrophotometer Thermo Scientific 840-208100 https://www.thermofisher.com/order/catalog/product/840-208100?ICID=search-840-208100
Gentra Puregene Yeast/Bact. Kit Qiagen 158567 https://www.qiagen.com/us/shop/sample-technologies/dna/dna-preparation/gentra-puregene-yeastbact-kit/#orderinginformation
HCl Fisher Scientific A144-212 Corrosive;  https://www.fishersci.com/shop/products/hydrochloric-acid-certified-acs-plus-fisher-chemical-10/a144212?searchHijack=true&searchTerm=A144212&searchType=RAPID
KCl Fisher Scientific P217-500 https://www.fishersci.com/shop/products/potassium-chloride-crystalline-certified-acs-fisher-chemical-4/p217500?searchHijack=true&searchTerm=P217500&searchType=RAPID
KH2PO4 Fisher Scientific P285-500 https://www.fishersci.com/shop/products/potassium-phosphate-monobasic-crystalline-certified-acs-fisher-chemical-5/p285500?searchHijack=true&searchTerm=P285500&searchType=RAPID
KOH Fisher Scientific P250-500 https://www.fishersci.com/shop/products/potassium-hydroxide-pellets-certified-acs-fisher-chemical-5/p250500?searchHijack=true&searchTerm=P250500&searchType=RAPID
Le Loop Decon Labs Inc. MP190-25 http://deconlabs.com/products/leloop/
Le Stab Decon Labs Inc. MP186-5 http://deconlabs.com/products/lestab/
MgSO4·7H2O Fisher Scientific M63-500 https://www.fishersci.com/shop/products/magnesium-sulfate-heptahydrate-crystalline-certified-acs-fisher-chemical-3/m63500?searchHijack=true&searchTerm=M63500&searchType=RAPID
Mini-Sub Cell GT Horizontal Electrophoresis System Bio Rad Labs 1704406 http://www.bio-rad.com/en-us/product/mini-sub-cell-gt-cell?WT.srch=1&WT.mc_id=aw-cbb-NA-sub_cell_systems_brand_gold&WT.knsh_id=7eb1981f-a011-42a3-aece-1236ff453373
MR-VP Broth Difco 216300 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=216300&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3Dmr-vp%2Bmedium%26typeOfSearch%3DproductSearch
Na2HPO4 Fisher Scientific S374-500 https://www.fishersci.com/shop/products/sodium-phosphate-dibasic-anhydrous-granular-powder-certified-acs-fisher-chemical-5/s374500?searchHijack=true&searchTerm=S374500&searchType=RAPID
NaCl Fisher Scientific S271-10 https://www.fishersci.com/shop/products/sodium-chloride-crystalline-certified-acs-fisher-chemical-6/s27110?searchHijack=true&searchTerm=S27110&searchType=RAPID
NaHCO3 Fisher Scientific S233-500 https://www.fishersci.com/shop/products/sodium-bicarbonate-powder-certified-acs-fisher-chemical-5/s233500?searchHijack=true&searchTerm=S233500&searchType=RAPID
NaNH4HPO4·4H2O Fisher Scientific S218-500 https://www.fishersci.com/shop/products/sodium-ammonium-phosphate-tetrahydrate-crystalline-certified-fisher-chemical/s218500?searchHijack=true&searchTerm=S218500&searchType=RAPID
NanoDrop Lite Spectrophtometer Thermo Scientific ND-LITE-PR https://www.thermofisher.com/order/catalog/product/ND-LITE-PR?ICID=search-ND-LITE-PR
Nonfat dry milk Nestle Carnation N/A N/A
Peptone Becto, Dickinson and Co. 211677 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=211677&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D211677%26typeOfSearch%3DproductSearch
Petri Dishes (100 mm x 15 mm) Fisher Scientific FB0875712 https://www.fishersci.com/shop/products/fisherbrand-petri-dishes-clear-lid-12/fb0875712#?keyword=FB0875712
Petri Dishes (150 mm x 15 mm) Fisher Scientific FB0875714 https://www.fishersci.com/shop/products/fisherbrand-petri-dishes-clear-lid-12/fb0875714?searchHijack=true&searchTerm=FB0875714&searchType=RAPID
Polymyxin B sulfate salt Sigma-Aldrich P1004-10MU Store at 2-4 °C; http://www.sigmaaldrich.com/catalog/product/sial/p1004?lang=en&region=US
Taq DNA Polymerase New England Biolabs M0273S Store at -20 °C; https://www.neb.com/products/m0273-taq-dna-polymerase-with-standard-taq-buffer
Taq Reaction Buffer New England Biolabs M0273S Store at -20 °C;  https://www.neb.com/products/m0273-taq-dna-polymerase-with-standard-taq-buffer
Thermal Cycler Bio-Rad C1000 Touch™  Bio Rad Labs 1840148 http://www.bio-rad.com/evportal/evolutionPortal.portal?_nfpb=true&_pageLabel=search_page&sfMode=search&sfStartNumber=1&clearQR=true&js=1&searchString=1840148&database=productskus+productcategories+productdetails+abdProductDetails+msds+literatures+inserts+faqs+downloads+webpages+assays+genes+pathways+plates+promotions&tabName=DIVISIONNAME
Triphenyltetrazolium chloride Alfa Aesar A10870 https://www.alfa.com/en/catalog/A10870/
Tris Base Fisher Scientific BP152-1 https://www.fishersci.com/shop/products/tris-base-white-crystals-crystalline-powder-molecular-biology-fisher-bioreagents-7/bp1521?searchHijack=true&searchTerm=BP1521&searchType=RAPID
Tryptone Becto, Dickinson and Co. 211705 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=211705&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D211705%26typeOfSearch%3DproductSearch
Yeast Extract Becto, Dickinson and Co. 212750 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=212750&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D212750%26typeOfSearch%3DproductSearch
α-napthol MP Biomedicals 204189 http://www.mpbio.com/product.php?pid=05204189

DOWNLOAD MATERIALS LIST

References

  1. Shimada, T., et al. Extended serotyping scheme for Vibrio cholerae. Curr. Microbiol. 28, (3), 175-178 (1994).
  2. Yamai, S., Tadayuki, O., Toshio, S., Yasuji, K. Distribution of serogroups of Vibrio cholerae non-O1 non-O139 with specific reference to their ability to produce cholera toxin, and addition of novel serogroups. Jpn. J. Infect. Dis. 71, (10), 1037-1045 (1997).
  3. Karaolis, D. K., Lan, R., Reeves, P. R. The sixth and seventh cholera pandemics are due to independent clones separately derived from environmental, nontoxigenic, non-O1 Vibrio cholerae. J. Bacteriol. 177, (11), 3191-3198 (1995).
  4. Albert, M. J., et al. Large epidemic of cholera-like disease in Bangladesh caused by Vibrio cholerae O139 synonym Bengal. Lancet. 342, (8868), 387 (1993).
  5. Barua, D. History of Cholera. Cholera. Barua, D., Greenough III, W. B. Plenum Publishing Corporation. 1-36 (1992).
  6. Morales, R., Delgado, G., Cravioto, A. Population Genetics of Vibrio cholerae. Vibrio cholerae-Genomics and Molecular Biology. Faruque, S. M., Nair, G. B. Caister Academic Press. 29-47 (2008).
  7. Samadi, A. R., Chowdhury, M. K., Huq, M. K., Khan, M. U. Seasonality of classical and El Tor cholera in Dhaka, Bangladesh: 17-year trends. Trans. R. Soc. Trop. Med. Hyg. 77, (6), 853-856 (1983).
  8. Son, M. S., Megli, C. J., Kovacikova, G., Qadri, F., Taylor, R. K. Characterization of Vibrio cholerae O1 El Tor biotype variant clinical isolates from Bangladesh and Haiti, including a molecular genetic analysis of virulence genes. J. Clin. Microbiol. 49, (11), 3739-3749 (2011).
  9. Ghosh-Banerjee, J., et al. Cholera toxin production by the El Tor variant of Vibrio cholerae O1 compared to prototype El Tor and classical biotypes. J. Clin. Microbiol. 48, (11), 4283-4286 (2010).
  10. Ansaruzzaman, M., et al. The Mozambique cholera vaccine demonstration project coordination group. Cholera in Mozambique, variant of Vibrio cholerae. Emerg. Infect. Dis. 10, (11), 2057-2059 (2004).
  11. Ansaruzzaman, M., et al. Genetic diversity of El Tor strains of Vibrio cholerae O1 with hybrid traits isolated from Bangladesh and Mozambique. Int. J. Med. Microbiol. 297, (6), 443-449 (2007).
  12. Lan, R., Reeves, P. R. Pandemic spread of cholera: genetic diversity and relationships within the seventh pandemic clone of Vibrio cholerae determined by amplified fragment length polymorphism. J. Clin. Microbiol. 40, (1), 172-181 (2002).
  13. Nair, G. B., Faruque, S. M., Bhuiyan, N. A., Kamruzzaman, M., Siddique, A. K., Sack, D. A. New variants of Vibrio cholerae O1 biotype El Tor with attributes of the classical biotype from hospitalized patients with acute diarrhea in Bangladesh. J. Clin. Microbiol. 40, (9), 3296-3299 (2002).
  14. Nair, G. B., et al. Isolation of Vibrio cholerae O1 strains similar to pre-seventh pandemic El Tor strains during an outbreak of gastrointestinal disease in an island resort in Fiji. J. Med. Microbiol. 55, (11), 1559-1562 (2006).
  15. Nair, G. B., Mukhopadhyay, A. K., Safa, A., Takeda, Y. Emerging hybrid variants of Vibrio cholerae O1. Vibrio cholerae—Genomics and Molecular Biology. Faruque, S. M., Nair, G. B. Horizon Scientific Press. 179-190 (2008).
  16. Safa, A., et al. Genetic characteristics of Matlab variants of Vibrio cholerae O1 that are hybrids between classical and El Tor biotypes. J. Med. Microbiol. 55, (11), 1563-1569 (2006).
  17. Nusrin, S., et al. Diverse CTX phages among toxigenic Vibrio cholerae O1 and O139 strains isolated between 1994 and 2002 in an area where cholera is endemic. J. Clin. Microbiol. 42, (12), 5854-5856 (2004).
  18. Carignan, B. M., Brumfield, K. D., Son, M. S. Single nucleotide polymorphisms in regulator-encoding genes have an additive effect on virulence gene expression in a Vibrio cholerae clinical isolate. mSphere. 1, (5), e00253 (2016).
  19. Iwanaga, M., Yamamoto, K., Higa, N., Ichinose, Y., Nakasone, N., Tanabe, M. Culture conditions for stimulating cholera toxin production by Vibrio cholerae O1 El Tor. Microbiol. Immunol. 30, (11), 1075-1083 (1986).
  20. DiRita, V. J., Claude, P., Georg, J., Mekalanos, J. J. Regulatory cascade controls virulence in Vibrio cholerae. Proc. Natl. Acad. Sci. USA. 88, (12), 5403-5407 (1991).
  21. Kovacikova, G., Lin, W., Skorupski, K. Duel regulation of genes involved in acetoin biosynthesis and motility/biofilm formation by the virulence activator AphA and the acetate-responsive Lys-R type regulator AlsR in Vibrio cholerae. Mol. Microbiol. 57, (2), 420-433 (2005).
  22. Vogel, H. J., Bonner, D. M. Acetylornithinase of Escherechia coli: partial purification and some properties. J. Biol. Chem. 218, (1), 97-106 (1956).
  23. Son, M. S., Taylor, R. K. Genetic screens and biochemical assays to characterize Vibrio cholerae O1 biotypes: classical and El Tor. Curr. Protoc. Microbiol. 6A.2.1-6A.2.17 (2011).
  24. Kovacikova, G., Skorupski, K. Regulation of virulence gene expression in Vibrio cholerae by quorum sensing: HapR functions at the aphA promoter. Mol. Microbiol. 46, (4), 1135-1147 (2002).
  25. Wang, Y., et al. The prevalence of functional quorum-sensing systems in recently emerged Vibrio cholerae toxigenic strains. Environ. Microbiol. Rep. 3, (2), 218-222 (2011).
  26. Sanders, E. R. Aseptic laboratory techniques. J. Vis. Exp. (63), e3064 (2012).
  27. Martinez, R. M., Megli, C. J., Taylor, R. K. Growth and laboratory maintenance of Vibrio cholerae. Curr. Protoc. 6A.1.1-6A.1.6 (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics