Laboratorieteknikker brukes til å opprettholde og skille biotyper av * These authors contributed equally

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Dette manuskriptet beskriver riktige Vibrio cholerae vedlikeholdsteknikker i tillegg til en rekke biokjemiske analyser, samlet brukt for rask og pålitelig differensiering mellom klinisk og miljøvennlig V. Koleraebiotyper i laboratorieinnstilling.

Cite this Article

Copy Citation | Download Citations

Brumfield, K. D., Carignan, B. M., Ray, J. N., Jumpre, P. E., Son, M. S. Laboratory Techniques Used to Maintain and Differentiate Biotypes of Vibrio cholerae Clinical and Environmental Isolates. J. Vis. Exp. (123), e55760, doi:10.3791/55760 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Den akvatiske gramnegative bakterien Vibrio cholerae er det etiologiske middel av den smittsomme gastrointestinale sykdommen kolera. På grunn av den globale forekomsten og alvorlighetsgraden av denne sykdommen, V. Kolerae har blitt grundig studert i både miljø- og laboratorieinnstillinger, og krever riktig vedlikeholds- og dyrkningsteknikker. Klassisk og El Tor er to hovedbiotyper som komponerer V. Cholerae O1 serogruppe, som hver viser unike genotypiske og fenotypiske egenskaper som gir pålitelige mekanismer for biotype karakterisering, og krever forskjellige virulensinducerende dyrkningsbetingelser. Uavhengig av biotypen av årsaksstammen for en gitt infeksjon eller utbrudd, omfatter standardbehandling for sykdommen rehydreringsterapi supplert med et regime av antibiotika. Imidlertid kan biotypeklassifisering være nødvendig for laboratorieundersøkelser og kan ha bredere virkninger på det biomedisinske feltet.I begynnelsen av 2000 ble kliniske isolater identifisert som utviser genotypiske og fenotypiske egenskaper fra både klassiske og El Tor-biotyper. De nylig identifiserte hybrider, kalt El Tor-varianter, har forårsaket klinisk og miljø-isolerende biotypidentifikasjon for å bli mer komplisert enn tidligere tradisjonelle enkeltanalysidentifikasjonsprotokoller. I tillegg til å beskrive V. Cholerae generelle vedlikeholds- og dyrkningsteknikker beskriver dette manuskriptet en serie genspesifikke ( ctxB og tcpA ) PCR-baserte genetiske skjermbilder og fenotypiske analyser (polymyksin B-resistens, citratmetabolisme, proteolytisk aktivitet, hemolytisk aktivitet, motilitet og glukosemetabolisme via Voges- Proskauer-analyse) kollektivt brukt til å karakterisere og / eller skille mellom klassiske og El Tor-biotyper. Sammen gir disse analysene en effektiv systematisk tilnærming som kan brukes som et alternativ, eller i tillegg til dyre, arbeidskrevende eksperimenter i karakterenV. Kolerae kliniske (og miljømessige) isolater.

Introduction

Kolera er en sykdom i den distale tynntarmen forårsaket av forbruket av forurenset mat eller vann som inneholder den vandige Gram-negative bakterien Vibrio cholerae . Symptomer på kolera inkluderer oppkast og ukontrollabel vannaktig diaré, noe som fører til alvorlig dehydrering, som hvis den ikke behandles ordentlig, vil resultere i døden. V. Kolerae kan deles inn i over 200 serogrupper basert på strukturen av celleoverflate-lipopolysakkarid-O-antigenet. Imidlertid har bare 2 serogrupper, O1 og O139, vist epidemi- eller pandemisk potensial 1 , 2 . Videre har serogruppe O139 vært primært isolert til Sørøst-Asia 3 , 4 , mens serogruppe O1 distribueres over hele verden. Videre kan O1 serogruppen deles inn i 2 hovedbiotyper: klassisk og El Tor. Den klassiske biotypen var ansvarlig for den første 6 kolera pandemienS mellom 1817 og 1923. Den pågående syvende pandemien er et resultat av El Tor-biotypen, som globalt har fordrevet den klassiske biotypen i miljøet 5 , 6 , 7 . Nylig har stammer oppstått som inneholder kjennetegn ved både klassiske og El Tor biotyper 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 og har siden blitt betegnet El Tor varianter 13 , 17 . Noen El Tor varianter har vist forhøyede virulensegenskaper med raskere og alvorlig sykdomsprogresjon enn tidligere observert, understrekerBehovet for en mer omfattende tilnærming til agentidentifikasjon og forebygging og behandling av sykdommer 8 , 9 , 18 . Mens biotypidentifikasjon ikke umiddelbart diktiserer behandling, kan videre fremskritt i vaksineutvikling og fremtidige terapeutiske midler ha nytte av biotypeforskjell.

Den første serien av protokoller som er oppført her, vil gjøre det mulig for forskerne å opprettholde V på riktig måte. Koleraestammer i en laboratorieinnstilling. Konsistens og etterfølgende analyse krever lagerberedning og vekst av isolater, som ikke er biotypeavhengig. For å optimalisere induksjon av virulensgenekspresjon er det imidlertid nødvendig med uavhengige biotypespesifikke dyrkningsteknikker 19 . I tillegg er forberedelse for ulike genetiske og biokjemiske analyser skissert i dette manuskriptet.

Kollatoksin (CT) og toksin-ko-reGulert pilus (TCP) er to hovedvirulensfaktorer styrt av master regulator ToxT i begge biotyper av V. Cholerae O1 serogruppe 20 . CT er et todelt toksin bestående av fem CtxB Underenheter rundt en enkelt CtxA underenhet, og er ansvarlig for det hurtige elektrolyttabet forbundet med kolera. TCP er en type IV pilus kodet av tcp operon ( tcpABQCRDSTEF ), og er involvert i vedlegg og kolonisering av den distale tynntarmen. TcpA er det første genet av tcp operonen som koder for de enkelte pilinunderenheter som er essensielle for bygging av pilus 8 . Gensekvensen for ctxA er helt bevart mellom klassiske og El Tor-biotyper, mens ctxB og tcpA er forskjellig over de to biotyper, men konserveres innenfor hver biotype 8 . CtxB er helt bevart mellom biotyper unntatt ved to basisposiSatser (115 og 203). I El Tor-biotypen ligger thymin ved basestillinger 115 og 203, mens den klassiske biotypen inneholder cytosin ved disse basene. TcpA er helt konservert innen hver biotype, men varierer ved flere baser mellom biotyper. Disse genetiske skillene tjener som primære biotypeidentifikasjonsmarkører, og etter sekvensering av polymerasekjedereaksjons-PCR-amplifikasjonsproduktet, inkludert disse stedene, kan isolerte sekvenser sammenlignes med villtype (WT) klassisk O395 eller WT El Tor N16961 for å bestemme biotype-bakgrunnen Av henholdsvis CT og TCP i et gitt V. cholerae- isolat.

Tallrike protokoller er utviklet for å karakterisere fenotypiske forskjeller mellom de klassiske og El Tor biotyper 21 , 22 , 23 . Polymyxin B er et peptidantibiotikum som kompromitterer integriteten til den ytre cellemembranen i gramnegativ bacTeria og polymyxin B-resistens kan visualiseres gjennom polymyksin B-resistensanalysen 21 . Citrat er et primært substrat av Krebs syklus, og evnen til å metabolisere sitrat som en eneste karbonkilde kan bestemmes ved bruk av citratmetabolisme-analysen 22 . HapR koder for en global regulator og master quorum-sensing regulator i V. cholerae, HapR, som binder til ulike promotorregioner og regulerer gen- og operonuttrykk 24 . Noen patogene stammer av V. cholerae har en naturlig forekommende rammeskiftmutasjon i hapR- genet som har forårsaket denne tetthetsavhengig regulering av virulensgenuttrykk for å gå tapt 24 , 25 . Måling av HapR-regulert proteaseaktivitet ved bruk av melkeagarmedia gjør at forskeren kan identifisere hvorvidt en bestemt isolat inneholder en funksjonell HapR 23 . DeHemolyse assay tester for en stamme evne til å utskille hemolytiske enzymer som lyser røde blodceller; Graden av hemolyse kan visualiseres på blodagarplater 23 . Motilitet er ofte forbundet med virulens i V. cholerae og kan analyseres ved bruk av motilitetsagarplater 23 . Voges-Proskauer-analysen tester for en belastnings evne til å gjære glukose som en eneste karbonkilde og produsere biproduktet acetoin 21 . Med fremkomsten av El Tor-varianter er det vanskelig å forutsi resultatene av en gitt fenotypisk analyse uten omfattende genotypisk screening, og før avledningen av biotype-bakgrunnen av V. Kolerae- isolater, anbefales det å utføre denne sammenstillingen av analysene 23 og sammenligne resultatene med referanse stammer som i tabell 2 .

Her har vi avansert en rekke protokoller, som kollektivt bruker avoremetNtioned genotypiske og fenotypiske analyser for en mer omfattende tilnærming til karakterisering av V. Koleraebiotyper. Videre har vi beskrevet de genotype og fenotypiske forskjeller av kjent V. Cholerae El Tor-varianter (MQ1795 og BAA-2163), sammenlignet med vanlige biotype referansestammer (WT klassisk O395, WT El Tor C6706 og WT El Tor N16961; Tabell 1 ). Fremveksten av El Tor-varianter har presentert utfordringer for påliteligheten av tidligere anvendte enkeltassaybiotype karakteriseringsprotokoller; Imidlertid vil dette multiple assay identifikasjonssystemet tillate mer pålitelig karakterisering av klinisk og miljøvennlig V. Kolerae isolater.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Merk: Tidsperspektiver for hvert analys må gjøres ettersom individuelle mediepreparater krever forskjellige tider. For eksempel bør solid agarplaten medier ha tilstrekkelig avkjøling og tørking (1-2 dager). Ytterligere tidsoverveielser ( dvs. enkeltkoloni og over natten kulturvekst) er spesifisert under hver protokoll og finnes i tabell 2 .

1. Forberedelse av media

  1. 1x fosfatbuffert saltvann (PBS)
    1. Veier 4,0 g NaCl, 0,1 g KCl, 0,72 g Na 2 HPO 4 og 0,12 g KH 2 PO 4 . Kombiner bestanddelene i en 1 L Erlenmeyer-kolbe, juster volumet til 500 ml med avionisert vann, juster pH til 7.2 ved hjelp av en pH-meter og tilsett HCl dråpevis til løsningen, og autoklaver eller filter steriliser ved hjelp av et 0,22 μm filter. 1x PBS kan lagres ved romtemperatur på ubestemt tid.
      FORSIKTIG: HCl er en konsentrert syre og skal håndteres i henhold tilTil institusjonelle, lokale, statlige og føderale forskrifter. For riktige retningslinjer for håndtering henvises til sikkerhetsdatabladet fra produsenten.
  2. Luria-Bertani (LB) buljong
    1. Veid 5,0 g trypton, 2,5 g gjærekstrakt og 2,5 g NaCl. Kombiner bestanddelene i en 1 L flaske, juster volumet til 500 ml med deionisert vann, autoklaver og lagre ved romtemperatur i opptil 6 måneder. For klassisk biotype virulensinducerende forhold, juster pH til 6,5 ved å bruke HC1 før autoklavering.
  3. AKI-medium inneholdende 0,03% (vekt / volum) NaHC03
    1. For komponent 1 (AKI-medium): Veid 7,5 g pepton, 2,0 g gjærekstrakt og 2,5 g NaCl. Kombiner bestanddelene i en 1 L flaske, juster volumet til 450 ml med avionisert vann og autoklav. AKI-medium kan lagres ved romtemperatur i opptil 6 måneder.
    2. For komponent 2 (NaHCO 3 ): veie 1,5 g NaHCO 3 , og juster volumetTil 50 ml med deionisert vann i en steril vesikkel. Filtrer steriliser NaHCO3 ved å bruke et 0,22 μm filter. NaHCO 3 må tilberedes umiddelbart før bruk.
    3. Aseptisk kombinere de to komponentene som oppretter et 1:10 forhold ved å filtrere komponent 2 i komponent 1 før bruk.
  4. Luria-Bertani (LB) Agarplater
    1. Veid 5,0 g trypton, 2,5 g gjærekstrakt, 2,5 g NaCl og 7,5 g agar. Kombiner bestanddelene i en 1 L Erlenmeyer-kolbe, juster volumet til 500 ml med deionisert vann, autoklaver og lag i standardstørrelser på 100 mm x 15 mm sterile petriskål. Plettede medier kan lagres innpakket i plast i opptil 6 måneder, lokkesiden opp til 4 ° C.
  5. LB Agarplater suppleres med Polymyxin B
    1. For komponent 1 (LB agar): vei 5,0 g trypton, 2,5 g gjærekstrakt, 2,5 g NaCl og 7,5 g agar. Kombiner bestanddelene i en 1 L Erlenmeyer-kolbe, juster volumet til 500 mL wiDeionisert vann og autoklav.
    2. For komponent 2 (polymyxin B): Oppløs polymyksin B i avionisert vann i et sterilt 2 ml mikrocentrifugerør til en konsentrasjon på 50.000 IE / μL og filtersteriliser ved bruk av et 0,22 μm filter.
    3. Når komponent 1 er kult å berøre, men ikke ennå størknet, tilsetter aseptisk 500 μl komponent 2 til komponent 1 og skaper en sluttkonsentrasjon på 50 IE / μl og blandes grundig. Forbered i standardstørrelser 100 mm x 15 mm sterile petriskål ved å hente blandet agarmedium inn i petriskålene. Plated media kan lagres innpakket i plast i opptil 3 måneder, lokk opp på 4 ° C.
  6. Minimal Citrat Medium Agar Plater
    1. For komponent 1 (agar med bromtymolblått): veie 7,5 g agar og 0,02 g bromtymolblått. Kombiner bestanddelene i en 1 L Erlenmeyer-kolbe, juster volumet til 450 ml med deionisert vann og autoklaver blandingen.
    2. For komponent 2 (10x VBMM): vei 1.0 g MgSO 4 7H 2 O, 10,0 g sitronsyreH 2 O, 50,0 g vannfritt K 2 HPO 4 og 17,5 g NaNH 4 HPO 4 4H 2 O. Kombiner bestanddelene i en 1 L Erlenmeyer-kolbe, juster volumet til 500 ml Med deionisert vann og autoklav eller filtersterilisere ved bruk av et 0,22 μm filter. 10x VBMM kan lagres ved romtemperatur opptil 6 måneder.
    3. Tilsett 50 ml komponent 2 til komponent 1 og tilbered i standard størrelse 100 mm x 15 mm sterile petriskål ved å hente blandet agarmedium inn i petriskålene. Plettede medier kan lagres innpakket i plast i opptil 6 måneder, lokkesiden opp til 4 ° C.
  7. Melkeagarplater
    1. For komponent 1 (melk): Veid 8,0 g øyeblikkelig, ikke-tørr, tørr melk i en 1 L Erlenmeyer-kolbe, juster volumet til 200 ml med avionisert vann og autoklav.
    2. For komponent 2 (agar med hjerne-hjerteinfusjon): Veid 3,68 g hjerne-hjerteinfusjon og 6,0 g agar. Kombiner conStituenter i en 500 ml Erlenmeyer-kolbe, juster volumet til 200 ml med deionisert vann og autoklav.
    3. Kombiner de to komponentene ved å hente komponent 2 i komponent 1, etter autoklavering og bland grundig. Tilbered i 150 mm x 15 mm sterile petriskål. Melkeplater kan lagres i opptil en uke innpakket i plast, lokksiden ned ved 4 ° C. Forbered i 150 mm x 15 mm sterile petriskål ved å hente blandet agarmedium i petriskålene.
  8. Motilitetsagarplater
    1. For komponent 1 (LB agar): vei 5,0 g trypton, 2,5 g gjærekstrakt, 2,5 g NaCl og 2,0 g agar. Kombiner bestanddelene i en 1 L Erlenmeyer-kolbe, juster volumet til 500 ml med avionisert vann og autoklav.
    2. For komponent 2 (1% (w / v) trifenyltetrazoliumklorid; TTC): veie 0,25 g TTC. Juster volumet til 25 ml med deionisert vann i en steril vesikkel og filtersteriliser ved bruk av et 0,22 μm filter. Oppbevares i opptil 6 måneder ved romtemperatur innpakketI folie for å minimere lyseksponering.
    3. Tilsett 2,5 ml 1% (w / v) sterilt TTC til autoklaverte medier.
    4. Hell media så tykt som mulig (≥50 mL / tallerken) i store 150 mm x 15 mm sterile petriskål. Plated media kan lagres innpakket i plast i opptil en uke, lokkesiden opp ved 4 ° C. Forbered i 150 mm x 15 mm sterile petriskål ved å hente blandet agarmedium i petriskålene.
  9. Voges-Proskauer (VP)
    1. For komponent 1 (Methyl Red-Voges-Proskauer buljong, MR-VP): veie 1,7 g MR-VP medium i en 500 mL Erlenmeyer-kolbe, juster volumet til 100 mL med avionisert vann og autoklav. Steril MR-VP-buljong kan lagres ved romtemperatur i opptil 6 måneder.
    2. For komponent 2 (5% (w / v) alfa (a) naftol): vei 1,0 g a-naftol i en steril vesikkel og juster volumet til 20 ml med 95% etanol. Α-naftol kan oppbevares ved romtemperatur i opptil 1 uke innpakket i folie for å minimere lys eksponeringosure.
    3. For komponent 3 (40% (w / v) kaliumhydroksyd, KOH): veie 20,0 g KOH i en steril vesikkel, juster volumet til 50 ml med sterilt deionisert vann. KOH kan lagres i opptil 6 måneder ved romtemperatur i en plastbeholder.

2. Vedlikehold og vekst av V. Koleraestammer

  1. Forberedelse og bruk av frosne lagerkulturer
    1. Pellet 1,8 ml flytende natten overkultur i 2 minutter ved sentrifugering (≥8 600 xg) i et sterilt 2 ml mikrocentrifugerør, fjern supernatant og suspender cellemellet i 900 μL frisk LB-buljong ved pipettering.
    2. Tilsett 900 μL sterilt 60% (v / v) glyserol til kulturen og bland ved vortexing.
    3. Overfør blandingen til et sterilt 2 ml kryogenrør og lagre på ubestemt tid ved -80 ° C.
    4. For å bruke, fjern en liten mengde frossen stamme ved hjelp av en steril inokuleringssløyfe og streak for enkle kolonier på LB agAr plater. Straks returnere frosset lager til -80 ° C etter bruk for å forhindre at kulturer helt tineres. Inkubér platene lokksiden ned i 12 til 16 timer ved 37 ° C.
  2. Vekst av overnatterkulturer i flytende medium
    1. Streak for enkeltkolonier (i henhold til avsnitt 2.1.4) fra frossen stamme på LB agarplater. Inkubér platene lokksiden ned i 12 til 16 timer ved 37 ° C.
    2. Inokuler 4 ml flytende LB-buljong i et sterilt 10 ml kulturrør med en enkelt koloni ved å berøre overflaten av den enkelte koloni med en steril applikatorpinne og overføre kolonien til væskebuljongen.
    3. Inkuber med lufting i en shaker-inkubator ved 225 rpm i 12 til 16 timer ved 37 ° C.
  3. Vekstkurve
    1. Klargjør over nattkultur i flytende LB-buljong som tidligere nevnt i protokoll 2.2.
    2. Lag en 1: 100 fortynning av over natten kulturen ved å overføre 250 ul over natten kultur til 25 ml frisk LB-buljong i en steril 250 ml Erlenmeyer-kolbe.
    3. Mål den optiske tettheten av væskekulturene ved 600 nm (OD 600 ) hver time som begynner på tidspunktet for inokuleringen (T 0 ).
    4. Inkubér en 1: 100 fortynning av over natten kultur med lufting i en shaker inkubator ved 225 rpm i opptil 30 timer ved 37 ° C, eller til dyrking når maksimal tetthet.
    5. Graf OD 600 vs Time, og bruk lineær regresjon for å bestemme omtrentlig fordoblingstid for hver belastning.
  4. El Tor Biotype Virulence Inducing Conditions
    1. Streak for enkle kolonier fra frosset lager på LB agarplater. Inkuber platene ned på siden, i 12 til 16 timer ved 37 ° C.
    2. Inokulere 10 ml AKI-medium inneholdende 0,03% (w / v) NaHC03 med en enkelt koloni.
    3. Inkuber kulturen uten lufting ved 37 ° C i 3,5 timer.
    4. Fjern 7 ml kultur og inkuber de resterende 3 ml kultusRe med lufting i en shaker-inkubator ved 225 rpm i ytterligere 4 timer.
  5. Klassisk biotype virulensinduksjonsbetingelser
    1. Streak for enkle kolonier fra frosset lager på LB agarplater. Inkubér platene lokksiden ned i 12 til 16 timer ved 37 ° C.
    2. Inokuler 4 ml flytende LB-buljong (pH 6,5) med en enkelt koloni.
    3. Inkuber med lufting i en shaker-inkubator ved 225 rpm i 12 til 16 timer ved 30 ° C.
  6. Vask cellepellet i 1x PBS
    1. Pellett 1,8 ml nattkultur i 2 minutter ved sentrifugering (≥8 600 xg) i et sterilt 2 ml mikrocentrifugerør og fjern supernatanten ved hjelp av en pipette. Resuspender cellepellet i 1,8 ml 1 x PBS ved pipettering.
    2. Gjenta vaskeprosedyr tre ganger etterfulgt av en endelig resuspendering i 1,8 ml 1x PBS.

3. Karakteriserer V. Koleraebiotyper

  1. PCR-baserte genetiske skjermer som bruker ctxB og tcpA
    1. Utform et sett med primere som annealerer ca. 50-70 bp oppstrøms og nedstrøms for de translasjonelle start- og stoppsteder av henholdsvis ctxB og tcpA.
    2. Klargjør over nattkultur i flytende LB-buljong som tidligere nevnt i protokoll 2.2.
    3. Isoler kromosomalt DNA ved bruk av et kommersielt tilgjengelig sett designet for gramnegative bakterier. Renset kromosomalt DNA kan lagres på ubestemt tid ved -20 ° C. Kromosomal DNA-isolasjon ved bruk av kommersielt tilgjengelige kits tar vanligvis ca. 4 timer.
    4. Bruk et mikrovolumspektrofotometer for å sikre at den kromosomale DNA-prøven er av høy kvalitet (A 260/280 > 1,8).
    5. For hvert kromosomalt DNA-isolat, lag polymerasekjedereaksjon (er) (PCR) på is i sterile 200 μl PCR-rør (er) og amplifiser områder av ctxB og tcpA ved bruk av standard PCR-komponenter: Taq polymerase og buFfer (eller ekvivalenter), dNTP-løsning og fremover / revers-primere. Bruk standard PCR parametere (~ 3 timer). For eksempel, bruk følgende protokoll:
      1. Innledende denaturering ved 95 ° C i 120 s.
      2. Denaturer ved 95 ° C i 60 s.
      3. Anneal primere ved 60 ° C i 45 s.
      4. Forleng ved 72 ° C i 90 s.
      5. Gjenta trinn 3.1.5.2 til 3.1.5.4 i 34 sykluser.
      6. Endelig forlengelse 72 ° C i 600 s.
      7. Uendelig hold ved 4 ° C.
    6. Fargestoff 5 μL av respektive PCR-produkt (er) ved bruk av en standard 6x DNA gelpåfyllingsfarge og belaste ca. 10 μl 1 kb ladder og 10 μl PCR-produkt på en 1% agarosegel i 1 x Tris-Borat-EDTA (TBE) buffer.
    7. Kjør gelelektroforese ved 130 V til fargestoffet når slutten, men ikke av, av gelen (ca. 90 min). Konstant overvåkning anbefales fordi spenning og kjøretid kan variere avhengig av utstyret.
    8. Ved bekreftelse avVellykket PCR-amplifisering ved forventet størrelse, rens de gjenværende 45 μl PCR-produktene med et kommersielt tilgjengelig DNA-rent og konsentratorkit.
    9. Sekvensrenset PCR-produkt (er) ved bruk av de samme primere som brukes til PCR-amplifikasjon, og utarbeide etter lokale retningslinjer for sekvenseringsfasilitet.
    10. Sammenlign FASTA-formatet til gensekvenser fra hvert isolat til den publiserte sekvensen som er tilgjengelig på NCBIs nettsted (http://www.ncbi.nlm.nih.gov/gene/) ved å søke følgende opptaksnummer i søkefeltet.
    11. CtxB : (klassisk) region mellom VC0395_A1059 til VC0395_A1060 (El Tor) VC_1456
    12. TcpA : (klassisk) VC0395_A0353 (El Tor) VC_0828
  2. Fenotypiske analyser for biotype klassifisering via spotting
    1. Klargjør over nattkultur i flytende LB-buljong som tidligere nevnt i protokoll 2.2.
    2. Vask cellepelleten (e) som angitt i protokoll 2.6.
    3. Bruk en pipette tilSpot 1 μl vasket kultur på respektive medium. For middels utvalg og inkubasjonsspesifikasjoner, se tabell 2.
  3. Motilitetsanalyse
    1. Klargjøre over natten kultur (er) i flytende LB buljong som tidligere nevnt i protokoll 2.2.
    2. Vask cellepelleten (e) som angitt i protokoll 2.6.
    3. Inokuler motilitetsagarplater ved å sette inokulerende stab i den vaskede flytende kulturen og "stikke" vertikalt inn i mediet. Mellom hver inokulasjon steriliserer du trådstiften ved hjelp av en Bunsen-brenner, og når du stikker agar, sørg for at den inokulerende staben ikke bøyer, da dette kan forandre resultatene.
    4. Inkubér platene på siden opp i 14 til 24 timer ved 37 ° C. Etter 14 t må skjermmotilitetsplater tett for å hindre overvekst av kulturer.
  4. Voges-Proskauer (VP) Assay
    1. Klargjøre over natten kultur (er) i flytende LB buljong som tidligere nevnt i protokoll 2.2.
    2. Inokulere 4Ml metylrød Voges-Proskauer eller MR-VP-buljong ved pipettering av 10 ul tidligere preparert over natten dyrking i 4 ml MR-VP-buljong i et sterilt dyrkningsrør og inkubering med beluftning i en shaker-inkubator ved 225 rpm i 12 til 16 H ved 37 ° C.
    3. Tilsett 150 μl 5% (w / v) a-naftol og 50 μl 40% (w / v) KOH til 1 ml alikvoter av MR-VP over natten kultur i sterile kulturrør.
    4. Kort vortex og la stå ved romtemperatur i opptil 4 timer til fargeendring utvikler seg.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

For riktig vedlikehold og bruk av enhver bakteriell belastning anbefales det å kjenne doblingstiden for den / de aktuelle stammen. Herav varierer vekstratene til vanlig brukte V. Koleraestammer ble demonstrert gjennom en vekstkurve, og omtrentlige doblingstider ble beregnet ved hjelp av lineær regresjon. WT El Tor N16961 og El Tor variant MQ1795 viste kortere fordoblingstider (~ 1 h og ~ 1 h henholdsvis) enn WT klassisk O395 (~ 2 h) ( Figur 1 , Tabell 2 ).

V. cholerae genetisk manipulering og etterfølgende analyse er ofte avhengig av evnen til å skille riktig mellom biotyper. PCR-baserte genetiske skjermbilder og fenotypiske analyser ble samlet implementert som et pålitelig system for å skille mellom biotype bakgrunner av V. Kolerae klinisk og miljømessig isolates; For representasjon, biotype referansestammer (WT klassisk O395, WT El Tor C6706 og WT El Tor N16961) og representative El Tor-varianter (MQ1795 og BAA-2163) ble inkludert ( Tabell 1 ). WT klassisk O395 viste klassiske ctxB- og tcpA- sekvenser. Omvendt demonstrerte WT El Tor-stammer N16961 og C6706 El Tor ctxB og tcpA- sekvenser. Interessant inneholdt MQ1795 og BAA-2163 den klassiske biotype ctxB -underenheten som var sammenlignbar med O395, men begge El Tor-varianter inneholdt tcpA som indikerer El Tor-biotypebakgrunnen ( Tabell 1 ). WT klassisk biotypestamme O395 viste følsomhet overfor polymyksin B, mens WT El Tor-biotypestammer (C6706 og N16961) viste resistens og viste vekst på LB-agarplater suppleret med polymyxin B. De representative El Tor-variantstammer (MQ1795 og BAA-2163) viste Lignende resistens mot antibiotika i forhold til WT El Tor biotype straIns (C6706 og N16961) ( figur 2 , tabell 2 ). WT klassisk biotypestamme O395 vokste ikke på minimalt citratmedium, mens WT El Tor-stammer (C6706 og N16961) var i stand til å benytte citrat som en karbonkilde og utviste vekst på minimalt citratmedium. Representative El Tor-variantbiotypestammer (MQ1795 og BAA-2163) viste vekst som var sammenlignbar med den for WT El Tor-biotypestammen (C6706 og N16961) ( Figur 3 , Tabell 2 ). WT klassisk stamme O395 og WT El Tor stamme N16961 har en ikke-funksjonell HapR, og viste således ikke HapR-regulert proteaseaktivitet; WT El Tor-stamme C6706 og representative El Tor-varianter (MQ1795 og BAA-2163) er hapR- positiv-visualisert som en sonen av klaring som kommer fra poenget med inokulering ( figur 4 , tabell 2 ). WT klassisk stamme O395 utskiller ikke hemolytiske enzymer og var derforE γ-hemolytisk, mens WT El Tor-biotypestammer (C6706 og N16961) og representative El Tor-variantstammer (MQ1795 og BAA-2163) utskiller hemolytiske enzymer som helt lyser røde blodlegemer som omgir poenget med inokulering og viste β-hemolyse ( Figur 5 ; tabell 2 ). Motiliteten varierer over, og innenfor, biotypestammer; Imidlertid viste WT El Tor-stammen N16961 og El Tor-varianter (MQ1795 og BAA-2163) hypermotilitet sammenlignet med den relativt mindre motile WT klassiske stammen O395 og WT El Tor stamme C6706 ( Figur 6 , Tabell 2 ). WT klassisk stamme O395 og representative El Tor-varianter metaboliserte ikke glukose for å produsere acetoin, mens WT El Tor-biotypestammer produserte acetoin som et biprodukt av glukosefermentering, som indikert ved utvikling av en dyp rød farge under Voges-Proskauer-analysen ( Figur 7 Tabell 2 ).

Press CtxB gen TCPA Henvisning
Base 115 Base 203 biotype biotype
O395 C C klassisk klassisk 8
C6706 T T El Tor El Tor 8
N16961 T T El Tor El Tor 8
MQ1795 C C klassisk El Tor 1. 3
BAA-2163 C C klassisk El Tor 8

Tabell 1: Biotypeavhengige genetiske forskjeller av Vibrio cholerae referansestammer. Vist i denne tabellen er DNA-baseendringene og relative stillinger i generene ctxB og tcpA . WT klassiske O395 og WT El Tor stammer N16961 og C6706 er vanlige biotype referansestammer. MQ1795 og BAA-2163 er kjente El Tor-varianter.

analyse~~POS=TRUNC Søknad Middels utvalg inkubasjon forventede resultater
O395 C6706 N16961 MQ1795 BAA-2163
2.3) Vekstkurve 27 Bestemmer doblingstider for ulike V. cholerae-stammer 1.2) Flytende LB-buljong Opptil 30 timer (37 ° C med lufting) ~ 2 timer ND * ~ 1 time ~ 1 time ND *
3.1) PCR-basert genetisk skjerm ved bruk av ctxB og tcpA 8 Differensierer mellom klassiske og El Tor biotype bakgrunner av ctxB N / A N / A klassisk El Tor El Tor klassisk klassisk
Differensierer mellom klassiske og El Tor biotype bakgrunner av tcpA N / A N / A klassisk El Tor El Tor El Tor El Tor
3.2) Polymyxin B Resistance 21 Følsomhet overfor antibiotika polymyxin B 1,5) LB agarplater suppleres med polymyxin B 18 timer (37 ° C) - + + + +
3.2) Citratmetabolisme 22 Evne til å metabolisere sitrat som eneste kullkilde 1.6) Minimale citratmediumagarplater 24 timer (37 ° C) - + + + +
3.2) Kaseinhydrolyse 23 HapR-regulert proteaseaktivitet 1.7) Melkagarplater 18 timer (37 ° C) - - + + +
3.2) hemolyse 23 Måler hemolytisk aktivitet Blod agarplater 48 timer (37 ° C) gamma Beta Beta Beta Beta
3.3) Motilitet 23 Måler grad av motilitet 1,8) Motilitetsagarplater 14-24 timer (37 ° C) 10 mm 15 mm 21 mm 25 mm 29 mm
3.4) Voges-Proskauer 21 Måler evne til å gjære glocose og produsere acetoin som et biprodukt 1,9) Flytende Voges-Proskauer medium Opptil 4 timer (romtemperatur) - + + - -
Merk: "ND *" betyr ikke bestemt; "+" Angir et positivt resultat; "-" angir et negativt resultat

Tabell 2: Sammendrag av genetiske og fenotypiske analyser brukt for Vibrio cholerae Biotype Distinction. Denne tabellen oppsummerer de ulike genetiske og fenotypiske analysene, applikasjonene og de forventede resultatene som ble brukt til å skille mellom klassiske og El Tor-biotyper anvendt i denne studien. Protokollnumre og referanser til spesifikke protokoller er angitt i analysekolonnen. "ND *" betyr ikke bestemt; "+" Angir et positivt resultat; "-" angir et negativt resultat.

Figur 1
Figur 1: V. Kolerae vekstkurve for WT klassisk O395, WT El Tor N16961 og El Tor Variant MQ1795. Veksthastigheter for biotype referansestammer (WT klassisk O395 og WT El Tor N16961) og representativ El Tor Variant MQ1795, dyrket i LB-buljong med lufting ved 37 ° C, ble analysert ved å måle OD 600 eVeldig time begynner på T 0 . Vekstkurver ble utført på 8 uavhengige eksperimentelle replikater, med hver replik som representerer en uavhengig dyrkningshendelse for hvert forsøk. WT El Tor-stammen N16961 og El Tor-varianten MQ1795 viste kortere fordoblingstider (~ 1 h og ~ 1 h henholdsvis) i forhold til WT klassisk stamme O395 (~ 2 timer), som observert av en lengre doblingstid. Vennligst klikk her for å se en større versjon av denne figuren.

Figur 2
Figur 2: Bestemmelse av polymyksin B-resistens ved bruk av LB-agar suppleret med polymyksin B. Resistens mot peptidantibiotisk polymyksin B ble bestemt ved å kunne vokse på LB-agar supplert med 50 IE / μl polymyxin B. WT klassisk stamme O395 viste ingen vekst på agar supplTilsatt polymyxin B og ble ansett følsom for antibiotikumet. Mens WT El Tor-stammer (C6706 og N16961) og representative El Tor-varianter (MQ1795 og BAA-2163) viste vekst i nærvær av antibiotika og ble vurdert resistente mot polymyxin B. Plater ble inkubert ved 37 ° C i 18 timer. Vennligst klikk her for å se en større versjon av denne figuren.

Figur 3
Figur 3: Måling av Citrat Metabolisme ved hjelp av minimal citratmedium. Evnen til å benytte citrat som en eneste karbonkilde ble bestemt av isolatets evne til å vokse på minimal citratmedium. WT klassisk stamme O395 vokste ikke på minimalt citratmedium (negativt). Veksten var tydelig av alle WT El Tor stammene (C6706 og N16961) og representant ElTor-varianter (MQ1795 og BAA-2163), som viste evnen til å benytte citrat som en eneste karbonkilde (positiv). Plater ble inkubert ved 37 ° C i 18 timer. Vennligst klikk her for å se en større versjon av denne figuren.

Figur 4
Figur 4: Måling av HapR-regulert proteolytisk kaseinhydrolys ved bruk av melkeagarmedium. Kaseinhydrolyse gjennom HapR-regulert proteaseaktivitet ble bestemt ved en visuell sonen av klaring som omgikk poenget med inokulering på melkeagar. Stammer som inneholder en ikke-funksjonell HapR, slik som WT klassisk stamme O395 og WT El Tor stamme N16961, produserte ikke en sone for klaring som omgikk poenget med inokulering ( hapR- negativ). WT El Tor stamme C6706 og representative El Tor varianter (MQ1795 og BAA-2163) inneholder en funksjonell HapR, som kan visualiseres som varierende mellomstore soner ( hapR- positiv). Plater ble inkubert ved 37 ° C i 18 timer. Vennligst klikk her for å se en større versjon av denne figuren.

Figur 5
Figur 5: Måling av hemolytisk aktivitet ved bruk av blodagarmedier. Hemolytisk aktivitet ble målt ved bruk av agarplater suppleret med sauens blod. WT klassisk stamme O395 sekreterer ikke enzymer som lyser røde blodlegemer (y-hemolytisk). WT El Tor-stammer (N16961 og C6706) og representative El Tor-varianter (MQ1795 og BAA-2163) utskiller hemolytiske enzymer, noe som resulterte i en gjennomskinnelig sone for klaring som omgir poenget med inokulering (p-hemolytisk). Plater ble inkubert ved 37 ° C° C i 48 timer. Vennligst klikk her for å se en større versjon av denne figuren.

Figur 6
Figur 6: Bestemmelse av motilitet ved bruk av motilitetsagarplater. Sone av motilitet ble indikert ved en visuell fargeendring av saltet TTC som vender fra klart til rødt når det metaboliseres, hvilket indikerer hvor bakteriene har beveget seg. WT klassisk belastning O395 (10 mm) og WT El Tor stamme C6706 (15 mm) viste minimal motilitet, mens El Tor-stamme N16961 (21 mm) og representative El Tor-varianter (MQ1795 (25 mm) og BAA-2163 (29 mm) ) Viste hypermotilitet i forhold til O395 og C6706. Plater ble inkubert ved 37 ° C i 18 timer. Vennligst klikkHer for å se en større versjon av denne figuren.

Figur 7
Figur 7: Voges-Proskauer-analyse. Acetoinproduksjon via glukosefermentering ble bestemt ved bruk av Voges-Proskauer-analysen. WT klassisk stamme O395 og representative El Tor varianter (MQ1795 og BAA-2163) produserte ikke acetoin som et resultat av glukosefermentering (negativ). WT El Tor-stammer (N16961 og C6706) produserte biproduktet acetoin og kan visualiseres ved en dyp rød fargeendring (positiv). Rør ble inkubert ved romtemperatur i 4 timer. Vennligst klikk her for å se en større versjon av denne figuren.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Av de over 200 identifiserte V. Kolerae serogrupper, har kun O1 og O139 epidemisk potensial. O1 serogruppen kan deles inn i to biotyper: klassisk og El Tor. Imidlertid har hybridstammer, betegnet El Tor-varianter 13 , 17 , oppstått som besitter El Tor-biotypebakgrunnen, og har klassiske karakteristika 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 . Protokollene beskrevet i dette manuskriptet er utformet for å gi etterforskere, som er interessert i å karakterisere og / eller skille forskjellige kliniske og ikke-kliniske isolater av V. cholerae , med en påliteligMulti-assay identifikasjonssystem. Bruk av et pålitelig multi-assay-identifikasjonssystem som et alternativ er en forbedring i forhold til tidligere etablerte enkeltanalysesystemer og arbeidsintensive genetiske skjermbilder. Alle genotypiske og fenotypiske analyser bør inkludere WT klassisk stamme O395 og WT El Tor stammene C6706 og N16961 for sammenligning ( Tabell 1 ). Selv om de klassiske og El Tor-biotypestamlene er inkludert som referanse, kan isolater som MQ1795 og BAA-2163 inkludert i våre studier vise fenotypiske profiler fra enten biotype ( Figur 2 , Figur 3 , Figur 4 , Figur 5 , Figur 6 , Figur 7 , tabell 2 ), som illustrerer behovet for analyse av flere genotypiske og fenotypiske egenskaper for pålitelig karakterisering. Alle protokoller bør utføres aseptiskLy 26 ved romtemperatur med mindre annet er angitt. V. Cholerae er et biosikkerhetsnivå 2 (BSL-2) patogen som er etiologisk middel for den potensielt dødelige gastrointestinale sykdommen kolera; Riktig håndtering og avhending av alt materiale og avfallsprodukter må håndheves etter institusjonelle, lokale, statlige og føderale forskrifter.

Forberedelse av alle medier og reagenser må utføres ved hjelp av analysekvalitet reagenser og ultrapure vann deionisert til en følsomhet på minst 18 MΩ-cm. Før bearbeiding skal media fremstilles og tillates å tørke tilstrekkelig (1-2 dager); Plater anses å være tilstrekkelig tørre når ingen resterende væske er tilstede på overflaten av agar. På grunn av det motile området og soner for klaring rundt bakteriell vekst, bør motilitet og melkplater fremstilles i store petriskåler (150 mm x 15 mm) opp til 50 ml per plate og kan lagres i opptil 1 uke innpakket i plast , LiD-siden ned ved 4 ºC. I tillegg kan agarkonsentrasjonen av motilitetsplatene justeres for å bremse motiliteten; Det anbefales imidlertid ikke å overskride 3 g agar per 500 ml løsning, da dette vil redusere den generelle motiliteten betydelig, slik at forskjeller ikke vil kunne observeres. Alle andre platemedia bør være forberedt til ca. 25 ml per plate i standardstørrelser, Petri-tallerkener (100 mm x 15 mm) og kan lagres i opptil seks måneder innpakket i plast, lokksiden ned ved 4 ºC. For fremstilling av polymyxin B-plater er det viktig å la det smeltede media avkjøles etter autoklavering før tilsetning av polymyxin B, da overdreven varme kan nedbryte antibiotika. Polymyxin B-platene kan lagres i opptil 3 måneder innpakket i plast, lokksiden ned ved 4 ºC. Analyser som diskuteres i dette manuskriptet krever en dag for enkeltkoloni vekst (12-16 timer), en ytterligere dag for vekst av over natten kulturer (12-16 timer), og en tredje dag for hensyn til genotypisk (~ 4 timer for kromosomal DNEn isolasjon og ~ 3 timer for PCR) eller fenotypiske analyser (18-48 timer, tabell 2 ). Før den biokjemiske analysen av fenotypiske analyser som er beskrevet i dette manuskriptet, bør kulturer vaskes i 1x PBS for å forhindre gjenværende kulturmediumoverføring fra skjevresultat. I tillegg kan polymyxin B, citrat, proteaseaktivitet, hemolyse og motilitetsanalyser inokuleres samtidig ved bruk av en enkelt vasket over natten kultur. Når man spotter plettede medier, kan splatter av kulturer forekomme og kan føre til krysskontaminering mellom stammer. For å forhindre splatter, unngå å utskyve kulturen helt fra pipetten, i stedet slutte å kaste ut kulturen ved første stopp av pipetten. I tillegg tillate flekker å absorbere fullt ut i agaroverflaten før inkubering, og pass på at du ikke punkterer agar, noe som kan påvirke resultatene. Fenotypiske analyser som resulterer i klaringssoner ( Figur 4 , Figur 5 , Tabell 2) Og / eller motilitet ( figur 6 , tabell 2 ) som omgir poenget med inokulering, bør maksimalt være avstand for å hindre sammenslåing av områder med clearance eller vekst henholdsvis hvor de respektive diametre kan måles for komparativ analyse. Etter indikert inkubasjonstid kan isolater avbildes og analyseres i forhold til biotype referansestammer (WT klassisk O395, WT El Tor C6706 og WT El Tor N16961).

De PCR-baserte genetiske skjermene gjennom sekvensering skissert i dette manuskriptet kan brukes til å identifisere isolatets biotype-bakgrunn med hensyn til ctxB og tcpA , etter initial PCR-amplifisering. Standard sekvenseringsretningslinjer krever en bestemt mengde PCR-produkt avhengig av størrelsen på den amplifiserte regionen (580 bp for ctxB og 1420 bp for tcpA ), og for å sette opp reaksjonene kan etablerte protokoller følges. Kort sagt, individuell fremover og reverse sekvenseringsreaksjoner bør være forberedt med 3-5 pmol primer / reaksjon, og volumet bør justeres til 20 pl med sterilt ultrarent vann i et 1,5 ml mikrosentrifugerør. For hjelpemiddel i primerutforming for både PCR-amplifikasjon og sekvensering, kan NCBI primerutforming verktøy http://www.ncbi.nlm.nih.gov/tools/primer-blast/ benyttes. Vellykket amplifikasjon og sekvensering av CtxB og TCPAs er blitt oppnådd ved anvendelse av de følgende primere (5 '→ 3'): ctxB- fremover GGGAATGCTCCAAGATCATCGATGAGTAATAC, CtxB -Motsatt CATCATCGAACCACAAAAAAGCTTACTGAGG, TCPA -forward CCGCACCAGATCCACGTAGGTGGG, TCPA -Motsatt GTCGGTACATCACCTGCTGTGGGGGCAG. Det bør bemerkes at hele den kodende regionen av CtxB er konservert over begge biotyper med unntak av basen posisjonene 115 og 203 (begge cytosin i klassisk og tymin i El Tor). I tillegg, i TCPA blir multiple baseforandringer er konservert blant de biotyper at dagerIffer over de to biotyper ( tabell 1 ), som kan brukes til å skille mellom biotyper.

I mange laboratorieundersøkelser som involverer modellorganismen V. Koleraer , riktig vedlikehold og dyrkningsteknikker er kritiske 27 . Vekstraten til vanlig brukte V. Cholerae biotype referansestammer, som WT klassisk stamme O395 og WT El Tor stamme N16961, kan gi nyttig innsikt i karakteriseringen av El Tor variant isolater ( Figur 1 , Tabell 2 ). På grunn av de varierende vekstratene over V. Kolerae- isolater, er det viktig å ta spektrofotometerets absorbansavlesning hver time til kulturen når maksimal turbiditet i den sentrale stasjonære fasen. Mid-to-late dødsfase kan ikke visualiseres på grunn av et platå i turbiditet som skyldes overskytende cellulært rusk. En 1: 4 fortynning av kultur til steril L B-buljong bør utføres for å oppnå en fullstendig vekstkurve og opprettholde presisjonen av instrumentet, da absorbansavlesningene toppes ved en OD 600 ≈ 1,0. Ved utførelse av vekstkurver på flere stammer, bør absorbansavlesning være tidsavhengig ca. 5 minutter fra hverandre for å sikre konsistens mellom avlesningene. Forstå V. Koleraebiotypeveksthastigheter er avgjørende for mange undersøkelser, inkludert virulensgenekspresjonsstudier, analyse av metabolske aktiviteter og riktige dyrknings- og lagringsbetingelser. For etterfølgende analyse bør natten over kulturer behandles i sen logg til tidlig stasjonær vekstfase (12-16 timer) for å maksimere celleveksten, men opprettholde fortsatt cellulær integritet.

Oppdrettsbetingelser for klassiske og El Tor-biotypestammer er liknende, men analyse av virulensgenuttrykk i V. Kolerae krever biotypespesifikke virulensinducerende tilstanderRef "> 19. De to viktigste virulensfaktorene CT og TCP styres av master regulator ToxT og uttrykkes optimalt under spesifikke vekstbetingelser, for eksempel under El Tor virulensfremkallende forhold. ToxT kan analyseres ved behandling av helcelleekstrakt WCE), eller cellepelleten, på 3,5 timer, mens CT og TCP-ekspresjon kan analyseres ved behandling av den cellefrie supernatanten og WCE ved 7,5 timer henholdsvis 8 , 20. De varierende genotypiske og fenotypiske egenskaper som er demonstrert gjennom dette manuskriptet, indikerer hvordan Forskellige V. Cholerae-biotyper kan være, og illustrere behovet for et alternativ til tidligere anvendt enkelt-assaybiotype karakterisering.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ingenting å avsløre.

Acknowledgements

Forskning støttet av New Hampshire-INBRE gjennom en institusjonell utviklingspris (IDeA), P20GM103506, fra National Institute of General Medical Sciences of the NIH.

Materials

Name Company Catalog Number Comments
1 kb DNA Ladder New England Biolabs N3232S https://www.neb.com/products/n3232-1-kb-dna-ladder
60% Glycerol Calbiochem 356352 http://www.emdmillipore.com/US/en/product/Glycerol%2C-Molecular-Biology-Grade---CAS-56-81-5---Calbiochem,EMD_BIO-356352
Agar Becto, Dickinson and Co. 214030 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=214030&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D214030%26typeOfSearch%3DproductSearch
Agar with brain-heart infusion Becto, Dickinson and Co. 237500 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=237500&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D237500%26typeOfSearch%3DproductSearch
Agarose Peqlab 732-2789 https://de.vwr.com/store/catalog/product.jsp?catalog_number=732-2789&_DARGS=/store/cms/de.vwr.com/de_DE/header_2016111711383215.jsp_AF&_dynSessConf=1766917479792147141&targetURL=/store/catalog/product.jsp%3Fcatalog_number%3D732-2789&lastLanguage=en&/vwr/userprofiling/EditPersonalInfoFormHandler.updateLocale=&_D%3AcurrentLanguage=+&currentLanguage=en&_D%3AlastLanguage=+&_D%3A/vwr/userprofiling/EditPersonalInfoFormHandler.updateLocale=+
Anhydrous K2HPO4 Fisher Scientific P288-500 https://www.fishersci.com/shop/products/potassium-phosphate-dibasic-anhydrous-crystalline-powder-certified-acs-fisher-chemical-5/p288500?searchHijack=true&searchTerm=P288500&searchType=RAPID
Blood Agar Plates Remel R01200 Store at 4 °C;  http://www.remel.com/Catalog/Item.aspx?name=Blood+Agar
Boric Acid Fisher Scientific A73-500 https://www.fishersci.com/shop/products/boric-acid-crystalline-certified-acs-fisher-chemical-6/a73500?searchHijack=true&searchTerm=A73500&searchType=RAPID
Bromothymol Blue Fisher Scientific B388-10 https://www.fishersci.com/shop/products/bromothymol-blue-certified-acs-fisher-chemical/b38810?searchHijack=true&searchTerm=B38810&searchType=RAPID
Cirtric acid ·H2O Fisher Scientific S72836-3 https://www.fishersci.com/shop/products/citric-acid-monohydrate-4/s728363#?keyword=s728363
Deoxynucleotide (dNTP) Solution Kit New England Biolabs N0446S Store at -20 °C;  https://www.neb.com/products/n0446-deoxynucleotide-solutionset
Disodium EDTA Fisher Scientific S311-500 https://www.fishersci.com/shop/products/ethylenediaminetetraacetic-acid-disodium-salt-dihydrate-crystalline-certified-acs-fisher-chemical-7/s311500?searchHijack=true&searchTerm=S311500&searchType=RAPID
DNA Clean & Concentrator™ -25 Kit Zymo Research D4007 http://www.zymoresearch.com/dna/dna-clean-up/zymoclean-gel-dna-recovery-kit
GelGreen Nucleic Acid Stain Biotium 41005 https://biotium.com/product/gelgreentm-nucleic-acid-gel-stain-10,000x-in-water/
Genesys 10SUV-VIS Spectrophotometer Thermo Scientific 840-208100 https://www.thermofisher.com/order/catalog/product/840-208100?ICID=search-840-208100
Gentra Puregene Yeast/Bact. Kit Qiagen 158567 https://www.qiagen.com/us/shop/sample-technologies/dna/dna-preparation/gentra-puregene-yeastbact-kit/#orderinginformation
HCl Fisher Scientific A144-212 Corrosive;  https://www.fishersci.com/shop/products/hydrochloric-acid-certified-acs-plus-fisher-chemical-10/a144212?searchHijack=true&searchTerm=A144212&searchType=RAPID
KCl Fisher Scientific P217-500 https://www.fishersci.com/shop/products/potassium-chloride-crystalline-certified-acs-fisher-chemical-4/p217500?searchHijack=true&searchTerm=P217500&searchType=RAPID
KH2PO4 Fisher Scientific P285-500 https://www.fishersci.com/shop/products/potassium-phosphate-monobasic-crystalline-certified-acs-fisher-chemical-5/p285500?searchHijack=true&searchTerm=P285500&searchType=RAPID
KOH Fisher Scientific P250-500 https://www.fishersci.com/shop/products/potassium-hydroxide-pellets-certified-acs-fisher-chemical-5/p250500?searchHijack=true&searchTerm=P250500&searchType=RAPID
Le Loop Decon Labs Inc. MP190-25 http://deconlabs.com/products/leloop/
Le Stab Decon Labs Inc. MP186-5 http://deconlabs.com/products/lestab/
MgSO4·7H2O Fisher Scientific M63-500 https://www.fishersci.com/shop/products/magnesium-sulfate-heptahydrate-crystalline-certified-acs-fisher-chemical-3/m63500?searchHijack=true&searchTerm=M63500&searchType=RAPID
Mini-Sub Cell GT Horizontal Electrophoresis System Bio Rad Labs 1704406 http://www.bio-rad.com/en-us/product/mini-sub-cell-gt-cell?WT.srch=1&WT.mc_id=aw-cbb-NA-sub_cell_systems_brand_gold&WT.knsh_id=7eb1981f-a011-42a3-aece-1236ff453373
MR-VP Broth Difco 216300 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=216300&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3Dmr-vp%2Bmedium%26typeOfSearch%3DproductSearch
Na2HPO4 Fisher Scientific S374-500 https://www.fishersci.com/shop/products/sodium-phosphate-dibasic-anhydrous-granular-powder-certified-acs-fisher-chemical-5/s374500?searchHijack=true&searchTerm=S374500&searchType=RAPID
NaCl Fisher Scientific S271-10 https://www.fishersci.com/shop/products/sodium-chloride-crystalline-certified-acs-fisher-chemical-6/s27110?searchHijack=true&searchTerm=S27110&searchType=RAPID
NaHCO3 Fisher Scientific S233-500 https://www.fishersci.com/shop/products/sodium-bicarbonate-powder-certified-acs-fisher-chemical-5/s233500?searchHijack=true&searchTerm=S233500&searchType=RAPID
NaNH4HPO4·4H2O Fisher Scientific S218-500 https://www.fishersci.com/shop/products/sodium-ammonium-phosphate-tetrahydrate-crystalline-certified-fisher-chemical/s218500?searchHijack=true&searchTerm=S218500&searchType=RAPID
NanoDrop Lite Spectrophtometer Thermo Scientific ND-LITE-PR https://www.thermofisher.com/order/catalog/product/ND-LITE-PR?ICID=search-ND-LITE-PR
Nonfat dry milk Nestle Carnation N/A N/A
Peptone Becto, Dickinson and Co. 211677 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=211677&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D211677%26typeOfSearch%3DproductSearch
Petri Dishes (100 mm x 15 mm) Fisher Scientific FB0875712 https://www.fishersci.com/shop/products/fisherbrand-petri-dishes-clear-lid-12/fb0875712#?keyword=FB0875712
Petri Dishes (150 mm x 15 mm) Fisher Scientific FB0875714 https://www.fishersci.com/shop/products/fisherbrand-petri-dishes-clear-lid-12/fb0875714?searchHijack=true&searchTerm=FB0875714&searchType=RAPID
Polymyxin B sulfate salt Sigma-Aldrich P1004-10MU Store at 2-4 °C; http://www.sigmaaldrich.com/catalog/product/sial/p1004?lang=en&region=US
Taq DNA Polymerase New England Biolabs M0273S Store at -20 °C; https://www.neb.com/products/m0273-taq-dna-polymerase-with-standard-taq-buffer
Taq Reaction Buffer New England Biolabs M0273S Store at -20 °C;  https://www.neb.com/products/m0273-taq-dna-polymerase-with-standard-taq-buffer
Thermal Cycler Bio-Rad C1000 Touch™  Bio Rad Labs 1840148 http://www.bio-rad.com/evportal/evolutionPortal.portal?_nfpb=true&_pageLabel=search_page&sfMode=search&sfStartNumber=1&clearQR=true&js=1&searchString=1840148&database=productskus+productcategories+productdetails+abdProductDetails+msds+literatures+inserts+faqs+downloads+webpages+assays+genes+pathways+plates+promotions&tabName=DIVISIONNAME
Triphenyltetrazolium chloride Alfa Aesar A10870 https://www.alfa.com/en/catalog/A10870/
Tris Base Fisher Scientific BP152-1 https://www.fishersci.com/shop/products/tris-base-white-crystals-crystalline-powder-molecular-biology-fisher-bioreagents-7/bp1521?searchHijack=true&searchTerm=BP1521&searchType=RAPID
Tryptone Becto, Dickinson and Co. 211705 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=211705&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D211705%26typeOfSearch%3DproductSearch
Yeast Extract Becto, Dickinson and Co. 212750 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=212750&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D212750%26typeOfSearch%3DproductSearch
α-napthol MP Biomedicals 204189 http://www.mpbio.com/product.php?pid=05204189

DOWNLOAD MATERIALS LIST

References

  1. Shimada, T., et al. Extended serotyping scheme for Vibrio cholerae. Curr. Microbiol. 28, (3), 175-178 (1994).
  2. Yamai, S., Tadayuki, O., Toshio, S., Yasuji, K. Distribution of serogroups of Vibrio cholerae non-O1 non-O139 with specific reference to their ability to produce cholera toxin, and addition of novel serogroups. Jpn. J. Infect. Dis. 71, (10), 1037-1045 (1997).
  3. Karaolis, D. K., Lan, R., Reeves, P. R. The sixth and seventh cholera pandemics are due to independent clones separately derived from environmental, nontoxigenic, non-O1 Vibrio cholerae. J. Bacteriol. 177, (11), 3191-3198 (1995).
  4. Albert, M. J., et al. Large epidemic of cholera-like disease in Bangladesh caused by Vibrio cholerae O139 synonym Bengal. Lancet. 342, (8868), 387 (1993).
  5. Barua, D. History of Cholera. Cholera. Barua, D., Greenough III, W. B. Plenum Publishing Corporation. 1-36 (1992).
  6. Morales, R., Delgado, G., Cravioto, A. Population Genetics of Vibrio cholerae. Vibrio cholerae-Genomics and Molecular Biology. Faruque, S. M., Nair, G. B. Caister Academic Press. 29-47 (2008).
  7. Samadi, A. R., Chowdhury, M. K., Huq, M. K., Khan, M. U. Seasonality of classical and El Tor cholera in Dhaka, Bangladesh: 17-year trends. Trans. R. Soc. Trop. Med. Hyg. 77, (6), 853-856 (1983).
  8. Son, M. S., Megli, C. J., Kovacikova, G., Qadri, F., Taylor, R. K. Characterization of Vibrio cholerae O1 El Tor biotype variant clinical isolates from Bangladesh and Haiti, including a molecular genetic analysis of virulence genes. J. Clin. Microbiol. 49, (11), 3739-3749 (2011).
  9. Ghosh-Banerjee, J., et al. Cholera toxin production by the El Tor variant of Vibrio cholerae O1 compared to prototype El Tor and classical biotypes. J. Clin. Microbiol. 48, (11), 4283-4286 (2010).
  10. Ansaruzzaman, M., et al. The Mozambique cholera vaccine demonstration project coordination group. Cholera in Mozambique, variant of Vibrio cholerae. Emerg. Infect. Dis. 10, (11), 2057-2059 (2004).
  11. Ansaruzzaman, M., et al. Genetic diversity of El Tor strains of Vibrio cholerae O1 with hybrid traits isolated from Bangladesh and Mozambique. Int. J. Med. Microbiol. 297, (6), 443-449 (2007).
  12. Lan, R., Reeves, P. R. Pandemic spread of cholera: genetic diversity and relationships within the seventh pandemic clone of Vibrio cholerae determined by amplified fragment length polymorphism. J. Clin. Microbiol. 40, (1), 172-181 (2002).
  13. Nair, G. B., Faruque, S. M., Bhuiyan, N. A., Kamruzzaman, M., Siddique, A. K., Sack, D. A. New variants of Vibrio cholerae O1 biotype El Tor with attributes of the classical biotype from hospitalized patients with acute diarrhea in Bangladesh. J. Clin. Microbiol. 40, (9), 3296-3299 (2002).
  14. Nair, G. B., et al. Isolation of Vibrio cholerae O1 strains similar to pre-seventh pandemic El Tor strains during an outbreak of gastrointestinal disease in an island resort in Fiji. J. Med. Microbiol. 55, (11), 1559-1562 (2006).
  15. Nair, G. B., Mukhopadhyay, A. K., Safa, A., Takeda, Y. Emerging hybrid variants of Vibrio cholerae O1. Vibrio cholerae—Genomics and Molecular Biology. Faruque, S. M., Nair, G. B. Horizon Scientific Press. 179-190 (2008).
  16. Safa, A., et al. Genetic characteristics of Matlab variants of Vibrio cholerae O1 that are hybrids between classical and El Tor biotypes. J. Med. Microbiol. 55, (11), 1563-1569 (2006).
  17. Nusrin, S., et al. Diverse CTX phages among toxigenic Vibrio cholerae O1 and O139 strains isolated between 1994 and 2002 in an area where cholera is endemic. J. Clin. Microbiol. 42, (12), 5854-5856 (2004).
  18. Carignan, B. M., Brumfield, K. D., Son, M. S. Single nucleotide polymorphisms in regulator-encoding genes have an additive effect on virulence gene expression in a Vibrio cholerae clinical isolate. mSphere. 1, (5), e00253 (2016).
  19. Iwanaga, M., Yamamoto, K., Higa, N., Ichinose, Y., Nakasone, N., Tanabe, M. Culture conditions for stimulating cholera toxin production by Vibrio cholerae O1 El Tor. Microbiol. Immunol. 30, (11), 1075-1083 (1986).
  20. DiRita, V. J., Claude, P., Georg, J., Mekalanos, J. J. Regulatory cascade controls virulence in Vibrio cholerae. Proc. Natl. Acad. Sci. USA. 88, (12), 5403-5407 (1991).
  21. Kovacikova, G., Lin, W., Skorupski, K. Duel regulation of genes involved in acetoin biosynthesis and motility/biofilm formation by the virulence activator AphA and the acetate-responsive Lys-R type regulator AlsR in Vibrio cholerae. Mol. Microbiol. 57, (2), 420-433 (2005).
  22. Vogel, H. J., Bonner, D. M. Acetylornithinase of Escherechia coli: partial purification and some properties. J. Biol. Chem. 218, (1), 97-106 (1956).
  23. Son, M. S., Taylor, R. K. Genetic screens and biochemical assays to characterize Vibrio cholerae O1 biotypes: classical and El Tor. Curr. Protoc. Microbiol. 6A.2.1-6A.2.17 (2011).
  24. Kovacikova, G., Skorupski, K. Regulation of virulence gene expression in Vibrio cholerae by quorum sensing: HapR functions at the aphA promoter. Mol. Microbiol. 46, (4), 1135-1147 (2002).
  25. Wang, Y., et al. The prevalence of functional quorum-sensing systems in recently emerged Vibrio cholerae toxigenic strains. Environ. Microbiol. Rep. 3, (2), 218-222 (2011).
  26. Sanders, E. R. Aseptic laboratory techniques. J. Vis. Exp. (63), e3064 (2012).
  27. Martinez, R. M., Megli, C. J., Taylor, R. K. Growth and laboratory maintenance of Vibrio cholerae. Curr. Protoc. 6A.1.1-6A.1.6 (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics