Técnicas de laboratorio utilizadas para mantener y diferenciar los biotipos de * These authors contributed equally

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Este manuscrito describe técnicas adecuadas de mantenimiento de Vibrio cholerae además de una serie de ensayos bioquímicos, utilizados colectivamente para una diferenciación rápida y confiable entre V clínico y ambiental. Cholerae biótipos en un entorno de laboratorio.

Cite this Article

Copy Citation | Download Citations

Brumfield, K. D., Carignan, B. M., Ray, J. N., Jumpre, P. E., Son, M. S. Laboratory Techniques Used to Maintain and Differentiate Biotypes of Vibrio cholerae Clinical and Environmental Isolates. J. Vis. Exp. (123), e55760, doi:10.3791/55760 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

La bacteria Gram-negativa acuática Vibrio cholerae es el agente etiológico de la enfermedad gastrointestinal infecciosa del cólera. Debido a la prevalencia global y severidad de esta enfermedad, V. Cholerae ha sido ampliamente estudiado tanto en el medio ambiente como en el laboratorio, requiriendo un mantenimiento adecuado y técnicas de cultivo. Classical y El Tor son dos biotipos principales que componen el V. Cholerae O1 serogrupo, cada uno con características genotípicas y fenotípicas únicas que proporcionan mecanismos confiables para la caracterización del biotipo y requieren condiciones de cultivo de inducción de virulencia distintas. Independientemente del biotipo de la cepa causante de cualquier infección o brote dado, el tratamiento estándar para la enfermedad incluye la terapia de rehidratación complementada con un régimen de antibióticos. Sin embargo, la clasificación del biotipo puede ser necesaria para los estudios de laboratorio y puede tener impactos más amplios en el campo biomédico.A principios de 2000 se identificaron aislamientos clínicos que muestran rasgos genotípicos y fenotípicos de los biotipos clásicos y de El Tor. Los híbridos recién identificados, denominados variantes de El Tor, han causado que la identificación del biotipo de aislamiento clínico y medioambiental se vuelva más compleja que los protocolos de identificación de ensayos únicos tradicionales anteriores. Además de describir V. Cholerae mantenimiento general y técnicas de cultivo, este manuscrito describe una serie de genes específicos ( ctxB y tcpA ) basada en la PCR pantallas genéticas y ensayos fenotípicos (polimixina B resistencia, el metabolismo de citrato, la actividad proteolítica, la actividad hemolítica, la motilidad y el metabolismo de la glucosa a través de Voges- Proskauer) usados ​​colectivamente para caracterizar y / o distinguir entre biotipos clásicos y de El Tor. En conjunto, estos ensayos proporcionan un enfoque sistemático eficiente para ser utilizado como una alternativa o, además, a costosos experimentos de trabajo intensivo en la caracterizaciónCión de V. Cholerae clínicos (y medioambientales) aislados.

Introduction

El cólera es una enfermedad del intestino delgado distal causada por el consumo de alimentos o agua contaminados que contienen la bacteria Gram-negativa acuática Vibrio cholerae . Los síntomas del cólera incluyen vómitos y diarrea acuosa incontrolable, lo que lleva a la deshidratación severa, que si no se trata adecuadamente, dará lugar a la muerte. V. Los cólera se pueden dividir en más de 200 serogrupos basados ​​en la estructura del antígeno O del lipopolisacárido de la superficie celular. Sin embargo, sólo 2 serogrupos, O1 y O139, han mostrado potencial epidémico o pandémico 1 , 2 . Además, el serogrupo O139 se ha aislado principalmente en Asia sudoriental 3 , 4 , mientras que el serogrupo O1 se distribuye en todo el mundo. Además, el serogrupo O1 puede dividirse en 2 biotipos principales: clásico y El Tor. El biotipo clásico fue responsable de la primera 6 pandemia de cóleraS entre 1817 y 1923. La séptima pandemia en curso es el resultado del biotipo El Tor, que ha desplazado globalmente al biotipo clásico en el medio ambiente 5 , 6 , 7 . Recientemente han surgido cepas que contienen características distintivas de los biotipos clásicos y de El Tor 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 y han sido denominadas variantes de El Tor 13 , 17 . Algunas variantes de El Tor han demostrado una elevada capacidad de virulencia con una progresión de la enfermedad más rápida y severa que la observada anteriormente, enfatizandoLa necesidad de un enfoque más amplio para la identificación de agentes y la prevención y el tratamiento de enfermedades 8 , 9 , 18 . Mientras que la identificación del biotipo no determina inmediatamente el tratamiento, los avances adicionales en el desarrollo de la vacuna y los futuros agentes terapéuticos pueden beneficiarse de la distinción del biotipo.

La primera serie de protocolos enumerados aquí permitirá a los investigadores mantener correctamente V. Cholerae en un laboratorio. La consistencia y el posterior análisis requieren la preparación de las poblaciones y el crecimiento de aislamientos, que no dependen del biotipo. Sin embargo, para inducir óptimamente la expresión de genes de virulencia, se requieren técnicas de cultivo específicas independientes del biotipo 19 . Además, la preparación para varios ensayos genéticos y bioquímicos se describen en este manuscrito.

La toxina del cólera (CT) y la toxina co-rePilus gulado (TCP) son dos factores de virulencia principales controlados por el regulador maestro ToxT en ambos biotipos de la V. Cholerae O1 serogrupo 20 . La TC es una toxina bipartita compuesta por cinco CtxB Subunidades que rodean una única subunidad CtxA, y es responsable de la pérdida rápida de electrolitos asociada con el cólera. El TCP es un pilus tipo IV codificado por el operón tcp ( tcpABQCRDSTEF ), y está implicado en la unión y colonización del intestino delgado distal. TcpA es el primer gen del operón tcp que codifica las subunidades de pilina individuales esenciales para la construcción del pilus 8 . La secuencia génica para ctxA se conserva completamente entre biótipos clásicos y El Tor, mientras que ctxB y tcpA difieren a través de los dos biotipos pero se conservan dentro de cada biotipo 8 . CtxB se conserva completamente entre biotipos excepto en dos bases positivas(115 y 203). En el biotipo El Tor, la timina reside en las posiciones base 115 y 203, mientras que el biotipo clásico contiene citosina en estas bases. TcpA se conserva completamente dentro de cada biotipo, pero difieren en múltiples bases entre los biotipos. Estas distinciones genéticas sirven como marcadores de identificación de biotipos primarios y después de la secuenciación del producto de amplificación de la reacción en cadena de la polimerasa (PCR) que incluye estos sitios, las secuencias aisladas pueden compararse con el O395 clásico de tipo salvaje (WT) o con el El Tor N16961 de WT para determinar el fondo del biotipo De CT y TCP, respectivamente, en un aislado de V. cholerae .

Numerosos protocolos han sido desarrollados para caracterizar las distinciones fenotípicas entre los biotipos clásicos y El Tor 21 , 22 , 23 . La polimixina B es un antibiótico peptídico que compromete la integridad de la membrana celular externa en gram negativos bacY la resistencia a la polimixina B se pueden visualizar a través del ensayo de resistencia a la polimixina B 21 . El citrato es un sustrato primario del ciclo de Kreb, y la capacidad de metabolizar el citrato como fuente única de carbono se puede determinar usando el ensayo del metabolismo del citrato [ 22] . HapR codifica un regulador global y el quórum maestro de sensores de regulación en V. cholerae, HapR, que se une a diversas regiones promotoras y regula el gen y operón expresión [ 24] . Algunas cepas patógenas de V. cholerae tienen una mutación natural de cambio de marco en el gen hapR que ha causado que esta regulación dependiente de la densidad de la expresión del gen de la virulencia se pierde [ 24 , 25] . Medir la actividad de la proteasa regulada por HapR usando medios de agar de leche permite al investigador identificar si un aislado particular contiene un HapR 23 funcional. losEnsayos de hemólisis para determinar la capacidad de una cepa de secretar enzimas hemolíticas que lisan los glóbulos rojos; El grado de hemólisis se puede visualizar en placas de agar sangre [ 23] . La motilidad se asocia a menudo con virulencia en V. cholerae y puede analizarse utilizando placas de agar de motilidad [ 23] . El ensayo de Voges-Proskauer prueba la capacidad de una cepa de fermentar la glucosa como única fuente de carbono y producir la acetoin del subproducto 21 . Con la aparición de las variantes de El Tor, es difícil predecir los resultados de cualquier ensayo fenotípico dado sin exámenes genotípicos extensivos, y antes de deducir el biotipo de fondo de V. Cholerae , se recomienda realizar este ensamblaje de los ensayos 23 y comparar los resultados con cepas de referencia como en la Tabla 2 .

Aquí, hemos avanzado una serie de protocolos, utilizando colectivamente el citadoLos ensayos genotípicos y fenotípicos para un enfoque más completo de la caracterización de V. Biótipos de cholerae . Además, hemos descrito las distinciones genotípicas y fenotípicas de la V conocida. Cholerae El Tor variantes (MQ1795 y BAA-2163), en comparación con las cepas de referencia de biótipo de uso común (WT clásico O395, WT El Tor C6706, y WT El Tor N16961, Tabla 1 ). La aparición de las variantes de El Tor ha planteado retos a la fiabilidad de los protocolos de caracterización de biotipos de ensayos únicos empleados anteriormente; Sin embargo, este sistema de identificación de múltiples ensayos permitirá una caracterización más fiable de la V clínica y ambiental. Cólera aislados.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Nota: Las consideraciones de tiempo para cada ensayo deben realizarse ya que las preparaciones individuales de los medios requieren diferentes tiempos. Por ejemplo, los medios sólidos de placa de agar deben dejarse enfriar y secar suficientemente (1-2 días). Las consideraciones de tiempo adicionales ( es decir, la colonia única y el crecimiento de la noche a la mañana) se especifican en cada protocolo y se encuentran en la Tabla 2 .

1. Preparación de los medios

  1. 1x Solución salina tamponada con fosfato (PBS)
    1. Se pesan 4,0 g de NaCl, 0,1 g de KCl, 0,72 g de Na $$ HPO $$ y 0,12 g de KH $ ₂ $ PO $ ₄ $ . Se combinan los componentes en un matraz Erlenmeyer de 1 L, se ajusta el volumen a 500 ml con agua desionizada, se ajusta el pH a 7,2 usando un pHmetro y se añade HCl gota a gota a la solución y se esteriliza en autoclave o filtro con un filtro de 0,22 μm. 1x PBS se puede almacenar a temperatura ambiente indefinidamente.
      PRECAUCIÓN: El HCl es un ácido concentrado y se debe manipular deA regulaciones institucionales, locales, estatales y federales. Para instrucciones de manipulación adecuadas, consulte la hoja de datos de seguridad proporcionada por el fabricante.
  2. Caldo Luria-Bertani (LB)
    1. Se pesan 5,0 g de triptona, 2,5 g de extracto de levadura y 2,5 g de NaCl. Combine los componentes en una botella de 1 litro, ajuste el volumen a 500 ml con agua desionizada, autoclave y guarde a temperatura ambiente por hasta 6 meses. Para las condiciones clásicas de inducción de virulencia del biotipo, ajuste el pH a 6,5 ​​usando HCl antes del autoclavado.
  3. AKI que contiene 0,03% (p / v) de NaHCO $$
    1. Para el componente 1 (medio AKI): pesar 7,5 g de peptona, 2,0 g de extracto de levadura y 2,5 g de NaCl. Combine los componentes en una botella de 1 l, ajuste el volumen a 450 ml con agua desionizada y autoclave. El medio AKI puede ser almacenado a temperatura ambiente por hasta 6 meses.
    2. Para el componente 2 (NaHCO $$ ): se pesan 1,5 g de NaHCO $$ y se ajusta el volumenA 50 ml con agua desionizada en una vesícula estéril. El filtro esteriliza NaHCO3 usando un filtro de 0,22 μm. El NaHCO 3 debe prepararse inmediatamente antes de su uso.
    3. Combine asépticamente los dos componentes creando una relación 1:10 filtrando el Componente 2 en el Componente 1 antes de usarlo.
  4. Placas de Agar Luria-Bertani (LB)
    1. Se pesan 5,0 g de triptona, 2,5 g de extracto de levadura, 2,5 g de NaCl y 7,5 g de agar. Se combinan los componentes en un matraz Erlenmeyer de 1 l, se ajusta el volumen a 500 ml con agua desionizada, se autoclave y se prepara en placas de Petri estériles de 100 mm x 15 mm estándar. Los medios plateados se pueden almacenar envueltos en plástico hasta 6 meses, con la tapa hacia arriba a 4 ° C.
  5. Placas de agar de LB suplementadas con polimixina B
    1. Para el componente 1 (agar LB): se pesan 5,0 g de triptona, 2,5 g de extracto de levadura, 2,5 g de NaCl y 7,5 g de agar. Combinar los componentes en un matraz Erlenmeyer de 1 l, ajustar el volumen a 500 ml wiAgua desionizada y autoclave.
    2. Para el componente 2 (polimixina B): disolver la polimixina B en agua desionizada en un tubo de microcentrífuga estéril de 2 ml hasta una concentración de 50.000 UI / μl y esterilizar el filtro con un filtro de 0,22 μm.
    3. Una vez que el Componente 1 se enfríe al tacto, pero no se solidifica todavía, agregue asépticamente 500 μl de Componente 2 al Componente 1 creando una concentración final de 50 UI / μl y mezcle bien. Preparar en placas de Petri estériles de tamaño estándar de 100 mm x 15 mm vertiendo medios de agar mezclados en las placas de Petri. Los medios plateados se pueden almacenar envueltos en plástico hasta 3 meses, con la tapa hacia arriba a 4 ° C.
  6. Minimal Citrate Medium Agar Plates
    1. Para el componente 1 (agar con azul de bromotimol): pesar 7,5 g de agar y 0,02 g de azul de bromotimol. Combinar los constituyentes en un matraz Erlenmeyer de 1 l, ajustar el volumen a 450 ml con agua desionizada y autoclavar la mezcla.
    2. Para el componente 2 (10x VBMM): pesa 1.0 g de MgSO $$ 7H $$ O, 10,0 g de ácido cítrico H $$ O, 50,0 g de K $$ HPO $$ anhidro y 17,5 g de NaNH $$ HPO $$ 4H $ ₂ $ O. Combinar los constituyentes en un matraz Erlenmeyer de 1 L, Con agua desionizada y autoclave o filtro esterilizar usando un filtro de 0,22 μm. 10x VBMM se puede almacenar a temperatura ambiente hasta 6 meses.
    3. Añadir 50 ml de Componente 2 al Componente 1 y preparar en placas de Petri estériles de 100 mm x 15 mm estándar vertiendo medios de agar mezclados en las placas de Petri. Los medios plateados se pueden almacenar envueltos en plástico hasta 6 meses, con la tapa hacia arriba a 4 ° C.
  7. Placas de agar de leche
    1. Para el Componente 1 (leche): pese 8,0 g de leche desnatada sin grasa instantánea en un matraz Erlenmeyer de 1 l, ajuste el volumen a 200 ml con agua desionizada y autoclave.
    2. Para el componente 2 (agar con infusión corazón-cerebro): pesan 3,68 g de infusión corazón-cerebro y 6,0 g de agar. Combinar el conEn un matraz Erlenmeyer de 500 ml, ajustar el volumen a 200 ml con agua desionizada y autoclave.
    3. Combine los dos componentes vertiendo el Componente 2 en el Componente 1, después de esterilizar en autoclave y mezcle bien. Preparar en placas de Petri estériles de 150 mm x 15 mm. Las placas de leche se pueden almacenar hasta una semana envueltas en plástico, con la tapa hacia abajo a 4 ° C. Se preparan en placas de Petri estériles de 150 mm x 15 mm vertiendo medios de agar mezclados en las placas de Petri.
  8. Placas de Agitación de Motilidad
    1. Para el componente 1 (agar LB): se pesan 5,0 g de triptona, 2,5 g de extracto de levadura, 2,5 g de NaCl y 2,0 g de agar. Combinar los componentes en un matraz Erlenmeyer de 1 L, ajustar el volumen a 500 ml con agua desionizada y autoclave.
    2. Para el componente 2 (cloruro de trifeniltetrazolio al 1% (p / v), TTC): pesar 0,25 g de TTC. Ajustar el volumen a 25 ml con agua desionizada en una vesícula estéril y esterilizar el filtro con un filtro de 0,22 μm. Almacenar hasta 6 meses a temperatura ambiente envueltoEn papel de aluminio para minimizar la exposición a la luz.
    3. Añadir 2,5 ml de TTC estéril al 1% (p / v) a medios autoclavados.
    4. Vierta medios tan gruesos como sea posible (≥50 mL / placa) en grandes placas de Petri estériles de 150 mm x 15 mm. Los medios plateados se pueden almacenar envueltos en plástico hasta por una semana, con la tapa hacia arriba a 4 ° C. Se preparan en placas de Petri estériles de 150 mm x 15 mm vertiendo medios de agar mezclados en las placas de Petri.
  9. Voges-Proskauer (VP)
    1. Para el Componente 1 (Caldo de Metil Red-Voges-Proskauer, MR-VP): pesar 1,7 g de medio MR-VP en un matraz Erlenmeyer de 500 mL, ajustar el volumen a 100 mL con agua desionizada y autoclave. El caldo estéril MR-VP se puede almacenar a temperatura ambiente durante un máximo de 6 meses.
    2. Para el componente 2 (alfa ( alpha) naftol al 5% (p / v)): pesar 1,0 g de alpha - naftol en una vesícula estéril y ajustar el volumen a 20 ml con etanol al 95%. Α-naftol se puede almacenar a temperatura ambiente por hasta 1 semana envuelto en papel de aluminio para minimizar la luz expOsure
    3. Para el componente 3 (hidróxido de potasio al 40% (p / v): KOH): pesar 20,0 g de KOH en una vesícula estéril, ajustar el volumen a 50 ml con agua desionizada estéril. KOH se puede almacenar hasta 6 meses a temperatura ambiente en un recipiente de plástico.

2. Mantenimiento y Crecimiento de V. Cepas de cholerae

  1. Preparación y Uso de Cultivos Almacenados Congelados
    1. Pellet 1,8 ml de líquido durante la noche de cultivo durante 2 min por centrifugación (≥ 8.600 xg) en un tubo de microcentrífuga estéril de 2 ml, eliminar sobrenadante y volver a suspender el sedimento celular en 900 μ l de caldo LB fresco pipeteado.
    2. Añadir 900 μl de glicerol estéril al 60% (v / v) al cultivo y mezclar por vórtex.
    3. Transferir la mezcla a un tubo criogénico estéril de 2 ml y almacenar indefinidamente a -80 ° C.
    4. Para usar, eliminar una pequeña cantidad de material congelado usando un bucle de inoculación estéril y raya para colonias individuales en LB agAr placas. Inmediatamente devuelva el material congelado a -80 ° C después del uso para evitar que las culturas se descongelen completamente. Incubar las placas con la tapa hacia abajo durante 12 a 16 h a 37 ° C.
  2. Crecimiento de cultivos durante la noche en medio líquido
    1. Streak para colonias individuales (según la sección 2.1.4) a partir de material congelado sobre placas de agar LB. Incubar las placas con la tapa hacia abajo durante 12 a 16 h a 37 ° C.
    2. Inocular 4 mL de caldo LB líquido en un tubo de cultivo estéril de 10 mL con una sola colonia tocando la superficie de la colonia única con un palillo de aplicación estéril y transfiriendo la colonia al caldo líquido.
    3. Incubar con aireación en una incubadora agitadora a 225 rpm durante 12 a 16 h a 37ºC.
  3. Curva de crecimiento
    1. Preparar el cultivo durante la noche en caldo LB líquido como se indicó anteriormente en el protocolo 2.2.
    2. Hacer una dilución 1: 100 del cultivo durante la noche transfiriendo 250 μl de cultivo durante la noche a 25 mL de caldo LB fresco en un matraz erlenmeyer de 250 mL estéril.
    3. Medir la densidad óptica de los cultivos líquidos a 600 nm (DO 600 ) cada hora comenzando en el momento de la inoculación (T 0 ).
    4. Incubar una dilución de 1: 100 del cultivo durante la noche con aireación en una incubadora agitadora a 225 rpm durante hasta 30 h a 37 ° C, o hasta que el cultivo alcance la máxima densidad.
    5. Gráfica de la DO 600 vs tiempo y el uso de regresión lineal para determinar el tiempo aproximado de duplicación de cada cepa.
  4. Condiciones de inducción de la Virulencia del Bitipo de El Tor
    1. Streak para colonias individuales de stock congelado sobre placas de agar LB. Incubar las placas con la tapa hacia abajo, durante 12 a 16 h a 37 ° C.
    2. Inocular 10 ml de medio AKI que contiene NaHCO 3 al 0,03% (p / v) con una sola colonia.
    3. Incubar el cultivo sin aireación a 37 ° C durante 3,5 h.
    4. Quitar 7 ml de cultivo e incubar los 3 ml restantes de cultuCon aireación en una incubadora agitadora a 225 rpm durante 4 h adicionales.
  5. Condiciones de inducción de virulencia del biotipo clásico
    1. Streak para colonias individuales de stock congelado sobre placas de agar LB. Incubar las placas con la tapa hacia abajo durante 12 a 16 h a 37 ° C.
    2. Inocular 4 ml de caldo LB líquido (pH 6,5) con una sola colonia.
    3. Incubar con aireación en una incubadora agitadora a 225 rpm durante 12 a 16 h a 30 ° C.
  6. Pellet de celdas de lavado en 1x PBS
    1. Pellet 1,8 mL de cultivo durante la noche durante 2 min por centrifugación (≥8,600 xg) en un tubo de microcentrífuga estéril de 2 mL y eliminar el sobrenadante utilizando una pipeta. Re-suspender el sedimento celular en 1,8 mL 1x PBS por pipeteado.
    2. Repita el procedimiento de lavado tres veces seguido de una resuspensión final en 1,8 ml 1x PBS.

3. Caracterización de V. Biótipos de cholerae

  1. PAGPantallas Genéticas basadas en CR usando ctxB y tcpA
    1. Diseñar un conjunto de cebadores, que recolectan aproximadamente 50-70 pb aguas arriba y aguas abajo de los sitios de inicio y de parada de traslación de ctxB y tcpA , respectivamente.
    2. Preparar el cultivo durante la noche en caldo LB líquido como se indicó anteriormente en el protocolo 2.2.
    3. Aísle el ADN cromosómico usando un kit disponible comercialmente diseñado para bacterias Gram-negativas. El ADN cromosómico purificado puede almacenarse indefinidamente a -20 ° C. El aislamiento de ADN cromosómico utilizando kits comercialmente disponibles tarda generalmente aproximadamente 4 h.
    4. Utilice un espectrofotómetro de micro-volumen para asegurar que la muestra de ADN cromosómico sea de alta calidad (A 260/280 > 1,8).
    5. Para cada aislamiento de ADN cromosómico, preparar la reacción en cadena de la polimerasa (PCR) en hielo en tubo (s) de PCR de 200 μl estéril y amplificar regiones de ctxB y tcpA usando componentes de PCR estándar: Taq polimerasa y buFfer (o equivalentes), solución de dNTP, y cebadores directos / inversos. Utilizar parámetros estándar de PCR (~ 3 h). Por ejemplo, utilice el siguiente protocolo:
      1. Desnaturalización inicial a 95 ° C durante 120 s.
      2. Desnaturalización a 95 ° C durante 60 s.
      3. Primers de recocido a 60 ° C durante 45 s.
      4. Extender a 72 ° C durante 90 s.
      5. Repita los pasos 3.1.5.2 a 3.1.5.4 durante 34 ciclos.
      6. Extensión final 72 ° C durante 600 s.
      7. Mantenimiento infinito a 4 ° C.
    6. Se tiñe 5 μl de producto (s) de PCR respectivo utilizando un colorante de carga de gel de ADN 6x estándar y se carga aproximadamente 10 μl de escalera de 1 kb y 10 μl de producto de PCR en un gel de agarosa al 1% en 1x Tris-Borato-EDTA buffer.
    7. Ejecutar electroforesis en gel a 130 V hasta que el colorante del frente llegue al final, pero no fuera, del gel (aproximadamente 90 minutos). Se recomienda una supervisión constante ya que el voltaje y los tiempos de funcionamiento pueden variar dependiendo del equipo.
    8. Tras la verificación deCon una amplificación de PCR exitosa en el tamaño esperado, purificar los 45 μl de producto (s) PCR restantes utilizando un kit de limpieza y concentrado de ADN comercialmente disponible.
    9. Secuencia de producto (s) de PCR limpiado utilizando los mismos cebadores utilizados para la amplificación por PCR, y preparar por directrices de instalación de secuenciación local.
    10. Compare el formato FASTA de secuencias de genes de cada uno de los aislados a la secuencia publicada disponible en el sitio web de NCBI (http://www.ncbi.nlm.nih.gov/gene/), buscando los siguientes números de acceso en el cuadro de búsqueda.
    11. CtxB : región (clásica) entre VC0395_A1059 a VC0395_A1060 (El Tor) VC_1456
    12. TcpA : (clásica) VC0395_A0353 (El Tor) VC_0828
  2. Ensayos fenotípicos para la clasificación del biotipo mediante Spotting
    1. Preparar el cultivo durante la noche en caldo LB líquido como se indicó anteriormente en el protocolo 2.2.
    2. Lave el (los) sedimento (s) de células tal como se especifica en el protocolo 2.6.
    3. Utilice una pipeta paraColocar 1 μl de cultivo lavado en el respectivo medio. Para las especificaciones de selección e incubación medianas, consulte la Tabla 2.
  3. Ensayo de Motilidad
    1. Preparar el (los) cultivo (s) durante la noche en caldo LB líquido como se indicó anteriormente en el protocolo 2.2.
    2. Lave el (los) sedimento (s) de células tal como se especifica en el protocolo 2.6.
    3. Inocular las placas de agar de motilidad insertando el punzón de inoculación en el cultivo líquido lavado y "apuñalar" verticalmente en el medio. Entre cada inoculación, esterilice la punzón de alambre con un quemador de Bunsen, y al apuñalar el agar, asegúrese de que la punzada de inoculación no se doble, ya que esto puede alterar los resultados.
    4. Incubar las placas con la tapa hacia arriba durante 14 a 24 h a 37 ° C. Después de 14 h, monitorear las placas de motilidad de cerca para evitar el crecimiento excesivo de los cultivos.
  4. Ensayo Voges-Proskauer (VP)
    1. Preparar el (los) cultivo (s) durante la noche en caldo LB líquido como se indicó anteriormente en el protocolo 2.2.
    2. Inocular 4Ml de Voges-Proskauer rojo de metilo, o caldo MR-VP, pipeteando 10 μl de cultivo de noche previamente preparado en 4 mL de caldo MR-VP en un tubo de cultivo estéril e incuba con aireación en un incubador agitador a 225 rpm durante 12 a 16 H a 37ºC.
    3. Añadir 150 μl de α-naftol al 5% (p / v) y 50 μl de KOH al 40% (p / v) a 1 ml de alícuotas de MR-VP durante la noche en tubos de cultivo estéril, respectivamente.
    4. Agitar brevemente y dejar reposar a temperatura ambiente durante un máximo de 4 h hasta que se produzca un cambio de color.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Para el mantenimiento adecuado y el uso de cualquier cepa bacteriana, se recomienda conocer el tiempo de duplicación de la cepa (s) de interés. En este caso, las tasas de crecimiento variables de V comúnmente utilizado . Cholerae se demostraron a través de una curva de crecimiento, y los tiempos aproximados de duplicación se calcularon mediante regresión lineal. WT El Tor N16961 y El Tor variante MQ1795 demostraron tiempos de duplicación más cortos (~ 1 h y ~ 1 h, respectivamente) que WT clásico O395 (~ 2 h) ( Figura 1 , Tabla 2 ).

La manipulación genética de V. cholerae y el posterior análisis a menudo dependen de la capacidad de distinguir adecuadamente entre los biotipos. Las pantallas genéticas basadas en PCR y los ensayos fenotípicos se implementaron colectivamente como un sistema fiable para distinguir entre los antecedentes biotipo de V. Cholerae clínica y ambiental iSolates; Para representación, se incluyeron cepas de referencia de biotipo (WT clásicas O395, WT El Tor C6706 y WT El Tor N16961) y variantes El Tor representativas (MQ1795 y BAA-2163) ( Tabla 1 ). WT clásica O395 demostrado ctxB clásico y tcpA secuencias. Por el contrario, WT El Tor cepas N16961 y C6706 demostrado El Tor ctxB y tcpA secuencias. Curiosamente, MQ1795 y BAA-2163 contenía el clásico biotipo ctxB subunidad comparable a O395, sin embargo, ambas variantes El Tor contenía tcpA indicativo de la El Tor biotipo fondo ( Tabla 1 ]. La cepa biotipo O395 clásica de WT mostró sensibilidad a la polimixina B, mientras que las cepas de biotipo WT El Tor (C6706 y N16961) mostraron resistencia y mostraron crecimiento en placas de agar LB suplementadas con polimixina B. Las cepas representativas del variante El Tor (MQ1795 y BAA-2163) Resistencia similar al antibiótico con respecto a la biotopo WT El TorIns (C6706 y N16961) ( Figura 2 , Tabla 2 ). La cepa O395 del biotipo clásica WT no creció con medios citrato mínimos, mientras que las cepas WT El Tor (C6706 y N16961) pudieron utilizar el citrato como una fuente de carbono y mostrar crecimiento sobre medios citrato mínimos. Las cepas de biotipo variantes El Tor representativas (MQ1795 y BAA-2163) demostraron un crecimiento comparable al de las cepas de biotipo WT El Tor (C6706 y N16961) ( Figura 3 , Tabla 2 ). La cepa WT clásica O395 y la cepa WT El Tor N16961 poseen una HapR no funcional y, por tanto, no demuestran actividad de proteasa regulada por HapR; WT El Tor C6706 y las variantes El Tor representativas (MQ1795 y BAA-2163) se visualizan con hapR como una zona de liberación que emana del punto de inoculación ( Figura 4 , Tabla 2 ). La cepa clásica O395 de WT no secreta enzimas hemolíticas y fue por lo tantoE γ-hemolítico, mientras que las cepas del biotipo WT El Tor (C6706 y N16961) y las cepas variantes El Tor representativas (MQ1795 y BAA-2163) secretan enzimas hemolíticas que lisan completamente los glóbulos rojos que rodean el punto de inoculación y muestran β-hemólisis . 5 , Tabla 2 ). La motilidad varía a través y dentro de las cepas del biotipo; Sin embargo, las variantes WT El Tor N16961 y El Tor (MQ1795 y BAA-2163) demostraron hipermotilidad en comparación con la cepa WT clásica relativamente menos móvil O395 y la cepa WT El Tor C6706 ( Figura 6 , Tabla 2 ). WT clásica O395 y el representante El Tor variantes no metabolizar la glucosa para producir acetoin, mientras que WT El Tor biotipo cepas producido acetoin como un subproducto de la fermentación de la glucosa, como lo indica el desarrollo de un color rojo oscuro durante el ensayo Voges-Proskauer ( Figura 7 Tabla 2 ).

Tensión CtxB Gene TcpA Referencia
Base 115 Base 203 Biotipo Biotipo
O395 do do clásico clásico 8
C6706 T T El Tor El Tor 8
N16961 T T El Tor El Tor 8
MQ1795 do do clásico El Tor 13
BAA-2163 do do clásico El Tor 8

Tabla 1: Distinciones genéticas dependientes de biotype de cepas de referencia de Vibrio cholerae . En esta tabla se muestran los cambios en la base del ADN y las posiciones relativas en los genes ctxB y tcpA . Las cepas WT clásicas O395 y WT El Tor N16961 y C6706 son cepas de referencia de biótipo comúnmente utilizadas. MQ1795 y BAA-2163 son variantes conocidas de El Tor.

Ensayo Solicitud Selección media Incubación Resultados previstos
O395 C6706 N16961 MQ1795 BAA-2163
2.3) Curva de crecimiento 27 Determina los tiempos de duplicación de varias cepas de V. cholerae 1.2) Caldo líquido LB Hasta 30 h (37 ° C con aireación) 2 h DAKOTA DEL NORTE* 1 h 1 h DAKOTA DEL NORTE*
3.1) Pantalla genética basada en PCR usando ctxB y tcpA 8 Diferencia entre los fondos de biotípicos clásicos y de El Tor de ctxB N / A N / A clásico El Tor El Tor clásico clásico
Diferencia entre los antecedentes biotípicos clásicos y de El Tor de tcpA N / A N / A clásico El Tor El Tor El Tor El Tor
3.2) Polimixina B Resistencia 21 Sensibilidad al antibiótico polimixina B 1,5) placas de agar LB suplementadas con polimixina B 18 h (37ºC) - + + + +
3.2) Citrato Metabolismo 22 Capacidad de metabolizar el citrato como única fuente de carbono 1.6) Placas de agar medio de citrato mínimas 24 h (37ºC) - + + + +
3.2) Hidrólisis de caseína 23 Actividad de proteasa regulada por HapR 1,7) placas de agar de leche 18 h (37ºC) - - + + +
3.2) Hemólisis 23 Mide la actividad hemolítica Placas de agar sangre 48 h (37ºC) Gama Beta Beta Beta Beta
3.3) Motilidad 23 Mide el grado de motilidad 1.8) Placas de agar de motilidad 14 - 24 h (37ºC) 10 mm 15 mm 21 mm 25 mm 29 mm
3.4) Voges-Proskauer 21 Mide la capacidad de fermentar la glucosa y producir acetoin como subproducto 1,9) Medio Voges-Proskauer líquido Hasta 4 h (temperatura ambiente) - + + - -
Nota: "ND *" denota no determinado; "+" Denota un resultado positivo; "-" denota un resultado negativo

Tabla 2: Resumen de los ensayos genéticos y fenotípicos utilizados para Vibrio cholerae Biotype Distinción. Esta tabla resume los diversos ensayos genéticos y fenotípicos, las aplicaciones y los resultados esperados colectivamente utilizados para diferenciar entre los biotipos clásicos y de El Tor utilizados en este estudio. Los números de protocolo y las referencias a protocolos específicos se indican en la columna Ensayo. "ND *" denota No Determinado; "+" Denota un resultado positivo; "-" denota un resultado negativo.

Figura 1
Figura 1: V. Cholerae Curva de crecimiento de WT Clásico O395, WT El Tor N16961, y El Tor Variante MQ1795. Las velocidades de crecimiento de cepas de referencia de biotipo (WT clásicas O395 y WT El Tor N16961) y el representante El Tor Variante MQ1795, cultivadas en caldo LB con aireación a 37 ° C, se analizaron midiendo la DO 600 eMuy hora que comienza en T 0 . Las curvas de crecimiento se realizaron en 8 repeticiones experimentales independientes, con cada repetición representando un evento de cultivo independiente para cada ensayo. WT El Tor N16961 y El Tor variante MQ1795 demostraron tiempos de duplicación más cortos (~ 1 h y ~ 1 h, respectivamente) con respecto a la cepa WT clásica O395 (~ 2 h), como se observa por un tiempo de duplicación más largo. Haga clic aquí para ver una versión más grande de esta figura.

Figura 2
Figura 2: Determinación de la resistencia a la polimixina B usando agar LB suplementado con polimixina B. La resistencia al antibiótico péptido polimixina B se determinó por la capacidad de crecer en agar LB suplementado con 50 IU / μL de polimixina B. La cepa WT clásica O395 no mostró crecimiento en agar SupplEmanado con polimixina B y se consideró sensible al antibiótico. Mientras que las cepas WT El Tor (C6706 y N16961) y las variantes El Tor representativas (MQ1795 y BAA-2163) mostraron un crecimiento en presencia del antibiótico y se consideraron resistentes a la polimixina B. Las placas se incubaron a 37ºC durante 18 h. Haga clic aquí para ver una versión más grande de esta figura.

figura 3
Figura 3: Medir el metabolismo del citrato usando medios de citrato mínimos. La capacidad de utilizar citrato como única fuente de carbono se determinó por la capacidad del aislamio para crecer en medios de citrato mínimos. La cepa clásica de WT O395 no creció en medio de citrato mínimo (negativo). El crecimiento fue evidente por todas las cepas WT El Tor (C6706 y N16961) y el representante ElTor (MQ1795 y BAA-2163), que demostraron la capacidad de utilizar el citrato como única fuente de carbono (positiva). Las placas se incubaron a 37 ° C durante 18 h. Haga clic aquí para ver una versión más grande de esta figura.

Figura 4
Figura 4: Medición de la hidrólisis de caseína proteolítica regulada por HapR usando medios de agar de leche. La hidrólisis de caseína mediante actividad de proteasa regulada por HapR se determinó mediante una zona visual de liberación que rodeaba el punto de inoculación en agar de leche. Las cepas que contenían un HapR no funcional, tal como la cepa clásica WT O395 y la cepa WT El Tor N16961, no produjeron una zona de espacio libre alrededor del punto de inoculación ( hapR- negativo). WT El Tor C6706 y variantes El Tor representativas (MQ1795 y BAA-2163) contienen un HapR funcional, que puede visualizarse como zonas de separación de tamaño variable ( hapR- positivas). Las placas se incubaron a 37 ° C durante 18 h. Haga clic aquí para ver una versión más grande de esta figura.

Figura 5
Figura 5: Medición de la actividad hemolítica usando medios de agar de sangre. La actividad hemolítica se midió utilizando placas de agar suplementadas con sangre de oveja. La cepa clásica de WT O395 no segrega enzimas que lisan los glóbulos rojos (γ-hemolíticos). Las cepas WT El Tor (N16961 y C6706) y las variantes El Tor representativas (MQ1795 y BAA-2163) secretan enzimas hemolíticas, lo que da como resultado una zona translúcida de liberación alrededor del punto de inoculación (β-hemolítico). Las placas se incubaron a 37ºC° C durante 48 h. Haga clic aquí para ver una versión más grande de esta figura.

Figura 6
Figura 6: Determinación de la motilidad usando placas de agar de motilidad. La zona de motilidad fue indicada por un cambio de color visual de la sal TTC que pasa de claro a rojo cuando se metaboliza, indicando dónde se han movido las bacterias. La cepa clásica de WT O395 (10 mm) y la cepa C6706 de WT El Tor (15 mm) demostró una motilidad mínima, mientras que la variante El Tor N16961 (21 mm) y variantes El Tor representativas (MQ1795 (25 mm) y BAA-2163 (29 mm) ) Demostró hiper-motilidad relativa a O395 y C6706. Las placas se incubaron a 37 ° C durante 18 h. Por favor haz clickAquí para ver una versión más grande de esta figura.

Figura 7
Figura 7: Ensayo de Voges-Proskauer. La producción de acetona mediante fermentación con glucosa se determinó usando el ensayo de Voges-Proskauer. La cepa clásica de WT O395 y las variantes representativas de El Tor (MQ1795 y BAA-2163) no produjeron acetoin como resultado de la fermentación de glucosa (negativa). Las cepas WT El Tor (N16961 y C6706) produjeron la acetoin del subproducto y pueden visualizarse mediante un cambio de color rojo intenso (positivo). Los tubos se incubaron a temperatura ambiente durante 4 h. Haga clic aquí para ver una versión más grande de esta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

De los más de 200 identificados V. Cholerae , sólo O1 y O139 tienen potencial epidémico. El serogrupo O1 se puede dividir en dos biotipos: clásicos y El Tor. Sin embargo, han surgido cepas híbridas, denominadas variantes El Tor 13 , 17 , que poseen el fondo del biotopo El Tor, y tienen características clásicas 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 . Los protocolos descritos en este manuscrito están diseñados para proporcionar a los investigadores, interesados ​​en caracterizar y / o distinguir varios aislados clínicos y no clínicos de V. cholerae , con un método fiableSistema de identificación multi-ensayos. El uso de un sistema de identificación multiensayo fiable como una alternativa es una mejora respecto a los sistemas de identificación de ensayo único previamente establecidos y las pantallas genéticas intensivas en mano de obra. Todos los ensayos genotípicos y fenotípicos deben incluir la cepa WT clásica O395 y las cepas WT El Tor C6706 y N16961 para comparación ( Tabla 1 ). Mientras que las cepas clásicas y El Tor biotipo se incluyen para la referencia, aislados, como MQ1795 y BAA-2163 incluidos en nuestros estudios, pueden mostrar perfiles fenotípicos de biotopos ( Figura 2 , Figura 3 , Figura 4 , Figura 5 , Figura 6 , Figura 7 , Tabla 2 ), lo que ilustra la necesidad de análisis de múltiples rasgos genotípicos y fenotípicos para la caracterización fiable. Todos los protocolos deben llevarse a cabo asépticosLy 26 a temperatura ambiente a menos que se especifique lo contrario. V. Cholerae es un patógeno de Nivel de Bioseguridad 2 (BSL-2) que es el agente etiológico de la enfermedad gastrointestinal potencialmente fatal el cólera; El manejo apropiado y la eliminación de todos los materiales y productos de desecho deben ser aplicados por regulaciones institucionales, locales, estatales y federales.

La preparación de todos los medios y reactivos debe realizarse con reactivos de calidad analítica y agua ultrapura desionizada a una sensibilidad mínima de 18 MΩ-cm. Antes del procesamiento, los medios deben prepararse y dejarse secar suficientemente (1-2 días); Las placas se consideran suficientemente secas cuando no hay líquido residual presente en la superficie del agar. Debido al rango de movilidad y las zonas de liberación que rodean el crecimiento bacteriano, la motilidad y las placas de leche deben prepararse en placas grandes de Petri (150 mm x 15 mm) hasta 50 ml por placa y pueden almacenarse hasta 1 semana envueltas en plástico LiD hacia abajo a 4 ºC. Además, la concentración de agar de las placas de motilidad puede ajustarse para ralentizar la motilidad; Sin embargo, no se recomienda que exceda de 3 g de agar por 500 mL de solución, ya que esto reducirá significativamente la motilidad total de tal manera que las diferencias no serán observables. Todos los demás medios de placa deben prepararse aproximadamente a 25 ml por placa en placas de Petri de tamaño estándar (100 mm x 15 mm) y pueden almacenarse hasta seis meses envueltos en plástico, con la tapa hacia abajo a 4 ºC. Para la preparación de placas de polimixina B, es importante permitir que los medios fundidos se enfríen después del autoclave antes de añadir polimixina B, ya que el calor excesivo puede degradar los antibióticos. Las placas de polimixina B se pueden almacenar hasta 3 meses envueltas en plástico, con la tapa hacia abajo a 4 ºC. Los ensayos discutidos en este manuscrito requieren un día para el crecimiento de una sola colonia (12-16 h), un día adicional para el crecimiento de cultivos durante la noche (12-16 h) y un tercer día para consideraciones de genotípica (~ 4 h para DN cromosómicoA aislamiento y ~ 3 h para PCR) o ensayos fenotípicos (18-48 h, Tabla 2 ). Antes del análisis bioquímico de los ensayos fenotípicos descritos en este manuscrito, los cultivos se deben lavar en 1x PBS para evitar que el remanente de los medios de cultivo residual se desvíe de los resultados. Adicionalmente, los ensayos de polimixina B, citrato, actividad de proteasa, hemólisis y motilidad pueden inocularse simultáneamente usando un solo cultivo durante la noche lavado. Cuando se manchan medios chapados, pueden producirse salpicaduras de cultivos y pueden producir una contaminación cruzada entre las cepas. Para evitar salpicaduras, evite completamente expulsar el cultivo de la pipeta, en lugar de dejar de expulsar el cultivo en la primera parada de la pipeta. Además, permita que los puntos se absorban completamente en la superficie del agar antes de la incubación, y tenga cuidado de no pinchar el agar, lo que puede afectar los resultados. Los ensayos fenotípicos que dan como resultado zonas de separación ( Figura 4 , Figura 5 , Tabla 2) Y / o motilidad ( Figura 6 , Tabla 2 ) que rodea el punto de inoculación, deben estar espaciados al máximo para evitar la fusión de áreas de separación o crecimiento, respectivamente, sobre las cuales se pueden medir los diámetros respectivos para el análisis comparativo. Después de los tiempos de incubación indicados, los aislados pueden ser visualizados y analizados en relación con las cepas de referencia del biotipo (WT clásicos O395, WT El Tor C6706 y WT El Tor N16961).

Las pantallas genéticas basadas en PCR a través de la secuenciación descritas en este manuscrito pueden usarse para identificar el fondo del biotipo del aislante con respecto a ctxB y tcpA , después de la amplificación PCR inicial. Las pautas de secuenciación estándar requieren una cantidad específica de producto de PCR dependiendo del tamaño de la región amplificada (580 pb para ctxB y 1420 pb para tcpA ), y para establecer las reacciones, se pueden seguir los protocolos establecidos. En pocas palabras, el individuo adelante y rLas reacciones de secuenciación inversa se deben preparar con 3-5 pmol de cebador / reacción y el volumen debe ajustarse a 20 μl con agua ultrapura estéril en un tubo de microcentrífuga de 1,5 ml. Para la ayuda en el diseño del cebador para la amplificación y la secuenciación de la PCR, la herramienta de diseño del cebador NCBI http://www.ncbi.nlm.nih.gov/tools/primer-blast/ se puede utilizar. La amplificación y secuenciación exitosas de ctxB y tcpA se ha llevado a cabo usando los siguientes cebadores (5 '→ 3'): ctxB - forward GGGAATGCTCCAAGATCATCGATGAGTAATAC, ctxB - reverse CATCATCGAACCACAAAAAGCTTACTGAGG, tcpA - forward CCGCACCAGATCCACGTAGGTGGG, tcpA - reverse GTCGGTACATCACCTGCTGTGGGGGCAG. Debe tenerse en cuenta que toda la región de codificación de ctxB se conserva a través de ambos biotipos excepto en las posiciones de base 115 y 203 (tanto la citosina en clásica como la timina en El Tor). Además, en tcpA , múltiples cambios de base se conservan entre los biotipos que dIffer a través de los dos biotipos ( Tabla 1 ], que puede ser utilizado para ayudar a distinguir entre los biotipos.

En muchos estudios de laboratorio que involucran al organismo modelo V. Cólera, el mantenimiento adecuado y las técnicas de cultivo son fundamentales 27 . Las tasas de crecimiento de V. Las cepas de referencia de biotipos de cólera, tales como la cepa WT clásica O395 y la cepa WT El Tor N16961, pueden proporcionar una visión útil de la caracterización de los aislados variantes de El Tor ( Figura 1 , Tabla 2 ). Debido a las tasas de crecimiento variables en V. Cholerae , es importante tomar lecturas de absorbancia del espectrofotómetro cada hora hasta que los cultivos alcancen la turbiedad máxima durante la fase estacionaria tardía. La fase de muerte intermedia a tardía puede no ser visualizada debido a una meseta en la turbidez resultante del exceso de desechos celulares. Una dilución 1: 4 de cultivo a L estéril B se debe llevar a cabo para obtener una curva de crecimiento completa y mantener la precisión del instrumento, ya que las lecturas de absorbancia alcanzan un pico a una DO $ ₆ $ ≈ 1,0. Cuando se realizan curvas de crecimiento en múltiples cepas, las lecturas de absorbancia deben ser cronometradas aproximadamente 5 minutos de separación para cada cepa para asegurar la consistencia entre las lecturas. Entendiendo V. Las tasas de crecimiento de biotipos de cólera son cruciales para muchas investigaciones incluyendo estudios de expresión de genes de virulencia, análisis de actividades metabólicas y condiciones adecuadas de cultivo y almacenamiento. Para el análisis posterior, los cultivos durante la noche se deben procesar en el registro tardío a fase estacionaria temprana de crecimiento (12-16 h) para maximizar el crecimiento celular y mantener la integridad celular.

Las condiciones de cultivo para las cepas de biotipo clásicas y de El Tor son similares, sin embargo, el análisis de la expresión génica de virulencia en V. Cholerae requiere condiciones de inducción de virulencia específicas del biotipoLos dos factores de virulencia principales CT y TCP son controlados por el regulador maestro ToxT y se expresan óptimamente bajo condiciones de crecimiento específicas, por ejemplo, bajo condiciones de inducción de virulencia de El Tor, ToxT puede analizarse procesando extracto de células enteras WCE) o el sedimento celular a 3,5 h, mientras que la expresión de CT y TCP puede analizarse procesando el sobrenadante libre de células y WCE a 7,5 h, respectivamente 8 , 20. Los rasgos genotípicos y fenotípicos variables demostrados a lo largo de este manuscrito indican cómo Diversos biotipos de V. cholerae pueden ser, e ilustran la necesidad de una alternativa a la caracterización de biotipos de ensayo único usados ​​previamente.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgements

Investigación apoyada por New Hampshire-INBRE a través de un Premio de Desarrollo Institucional (IDeA), P20GM103506, del Instituto Nacional de Ciencias Médicas Generales del NIH.

Materials

Name Company Catalog Number Comments
1 kb DNA Ladder New England Biolabs N3232S https://www.neb.com/products/n3232-1-kb-dna-ladder
60% Glycerol Calbiochem 356352 http://www.emdmillipore.com/US/en/product/Glycerol%2C-Molecular-Biology-Grade---CAS-56-81-5---Calbiochem,EMD_BIO-356352
Agar Becto, Dickinson and Co. 214030 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=214030&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D214030%26typeOfSearch%3DproductSearch
Agar with brain-heart infusion Becto, Dickinson and Co. 237500 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=237500&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D237500%26typeOfSearch%3DproductSearch
Agarose Peqlab 732-2789 https://de.vwr.com/store/catalog/product.jsp?catalog_number=732-2789&_DARGS=/store/cms/de.vwr.com/de_DE/header_2016111711383215.jsp_AF&_dynSessConf=1766917479792147141&targetURL=/store/catalog/product.jsp%3Fcatalog_number%3D732-2789&lastLanguage=en&/vwr/userprofiling/EditPersonalInfoFormHandler.updateLocale=&_D%3AcurrentLanguage=+&currentLanguage=en&_D%3AlastLanguage=+&_D%3A/vwr/userprofiling/EditPersonalInfoFormHandler.updateLocale=+
Anhydrous K2HPO4 Fisher Scientific P288-500 https://www.fishersci.com/shop/products/potassium-phosphate-dibasic-anhydrous-crystalline-powder-certified-acs-fisher-chemical-5/p288500?searchHijack=true&searchTerm=P288500&searchType=RAPID
Blood Agar Plates Remel R01200 Store at 4 °C;  http://www.remel.com/Catalog/Item.aspx?name=Blood+Agar
Boric Acid Fisher Scientific A73-500 https://www.fishersci.com/shop/products/boric-acid-crystalline-certified-acs-fisher-chemical-6/a73500?searchHijack=true&searchTerm=A73500&searchType=RAPID
Bromothymol Blue Fisher Scientific B388-10 https://www.fishersci.com/shop/products/bromothymol-blue-certified-acs-fisher-chemical/b38810?searchHijack=true&searchTerm=B38810&searchType=RAPID
Cirtric acid ·H2O Fisher Scientific S72836-3 https://www.fishersci.com/shop/products/citric-acid-monohydrate-4/s728363#?keyword=s728363
Deoxynucleotide (dNTP) Solution Kit New England Biolabs N0446S Store at -20 °C;  https://www.neb.com/products/n0446-deoxynucleotide-solutionset
Disodium EDTA Fisher Scientific S311-500 https://www.fishersci.com/shop/products/ethylenediaminetetraacetic-acid-disodium-salt-dihydrate-crystalline-certified-acs-fisher-chemical-7/s311500?searchHijack=true&searchTerm=S311500&searchType=RAPID
DNA Clean & Concentrator™ -25 Kit Zymo Research D4007 http://www.zymoresearch.com/dna/dna-clean-up/zymoclean-gel-dna-recovery-kit
GelGreen Nucleic Acid Stain Biotium 41005 https://biotium.com/product/gelgreentm-nucleic-acid-gel-stain-10,000x-in-water/
Genesys 10SUV-VIS Spectrophotometer Thermo Scientific 840-208100 https://www.thermofisher.com/order/catalog/product/840-208100?ICID=search-840-208100
Gentra Puregene Yeast/Bact. Kit Qiagen 158567 https://www.qiagen.com/us/shop/sample-technologies/dna/dna-preparation/gentra-puregene-yeastbact-kit/#orderinginformation
HCl Fisher Scientific A144-212 Corrosive;  https://www.fishersci.com/shop/products/hydrochloric-acid-certified-acs-plus-fisher-chemical-10/a144212?searchHijack=true&searchTerm=A144212&searchType=RAPID
KCl Fisher Scientific P217-500 https://www.fishersci.com/shop/products/potassium-chloride-crystalline-certified-acs-fisher-chemical-4/p217500?searchHijack=true&searchTerm=P217500&searchType=RAPID
KH2PO4 Fisher Scientific P285-500 https://www.fishersci.com/shop/products/potassium-phosphate-monobasic-crystalline-certified-acs-fisher-chemical-5/p285500?searchHijack=true&searchTerm=P285500&searchType=RAPID
KOH Fisher Scientific P250-500 https://www.fishersci.com/shop/products/potassium-hydroxide-pellets-certified-acs-fisher-chemical-5/p250500?searchHijack=true&searchTerm=P250500&searchType=RAPID
Le Loop Decon Labs Inc. MP190-25 http://deconlabs.com/products/leloop/
Le Stab Decon Labs Inc. MP186-5 http://deconlabs.com/products/lestab/
MgSO4·7H2O Fisher Scientific M63-500 https://www.fishersci.com/shop/products/magnesium-sulfate-heptahydrate-crystalline-certified-acs-fisher-chemical-3/m63500?searchHijack=true&searchTerm=M63500&searchType=RAPID
Mini-Sub Cell GT Horizontal Electrophoresis System Bio Rad Labs 1704406 http://www.bio-rad.com/en-us/product/mini-sub-cell-gt-cell?WT.srch=1&WT.mc_id=aw-cbb-NA-sub_cell_systems_brand_gold&WT.knsh_id=7eb1981f-a011-42a3-aece-1236ff453373
MR-VP Broth Difco 216300 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=216300&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3Dmr-vp%2Bmedium%26typeOfSearch%3DproductSearch
Na2HPO4 Fisher Scientific S374-500 https://www.fishersci.com/shop/products/sodium-phosphate-dibasic-anhydrous-granular-powder-certified-acs-fisher-chemical-5/s374500?searchHijack=true&searchTerm=S374500&searchType=RAPID
NaCl Fisher Scientific S271-10 https://www.fishersci.com/shop/products/sodium-chloride-crystalline-certified-acs-fisher-chemical-6/s27110?searchHijack=true&searchTerm=S27110&searchType=RAPID
NaHCO3 Fisher Scientific S233-500 https://www.fishersci.com/shop/products/sodium-bicarbonate-powder-certified-acs-fisher-chemical-5/s233500?searchHijack=true&searchTerm=S233500&searchType=RAPID
NaNH4HPO4·4H2O Fisher Scientific S218-500 https://www.fishersci.com/shop/products/sodium-ammonium-phosphate-tetrahydrate-crystalline-certified-fisher-chemical/s218500?searchHijack=true&searchTerm=S218500&searchType=RAPID
NanoDrop Lite Spectrophtometer Thermo Scientific ND-LITE-PR https://www.thermofisher.com/order/catalog/product/ND-LITE-PR?ICID=search-ND-LITE-PR
Nonfat dry milk Nestle Carnation N/A N/A
Peptone Becto, Dickinson and Co. 211677 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=211677&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D211677%26typeOfSearch%3DproductSearch
Petri Dishes (100 mm x 15 mm) Fisher Scientific FB0875712 https://www.fishersci.com/shop/products/fisherbrand-petri-dishes-clear-lid-12/fb0875712#?keyword=FB0875712
Petri Dishes (150 mm x 15 mm) Fisher Scientific FB0875714 https://www.fishersci.com/shop/products/fisherbrand-petri-dishes-clear-lid-12/fb0875714?searchHijack=true&searchTerm=FB0875714&searchType=RAPID
Polymyxin B sulfate salt Sigma-Aldrich P1004-10MU Store at 2-4 °C; http://www.sigmaaldrich.com/catalog/product/sial/p1004?lang=en&region=US
Taq DNA Polymerase New England Biolabs M0273S Store at -20 °C; https://www.neb.com/products/m0273-taq-dna-polymerase-with-standard-taq-buffer
Taq Reaction Buffer New England Biolabs M0273S Store at -20 °C;  https://www.neb.com/products/m0273-taq-dna-polymerase-with-standard-taq-buffer
Thermal Cycler Bio-Rad C1000 Touch™  Bio Rad Labs 1840148 http://www.bio-rad.com/evportal/evolutionPortal.portal?_nfpb=true&_pageLabel=search_page&sfMode=search&sfStartNumber=1&clearQR=true&js=1&searchString=1840148&database=productskus+productcategories+productdetails+abdProductDetails+msds+literatures+inserts+faqs+downloads+webpages+assays+genes+pathways+plates+promotions&tabName=DIVISIONNAME
Triphenyltetrazolium chloride Alfa Aesar A10870 https://www.alfa.com/en/catalog/A10870/
Tris Base Fisher Scientific BP152-1 https://www.fishersci.com/shop/products/tris-base-white-crystals-crystalline-powder-molecular-biology-fisher-bioreagents-7/bp1521?searchHijack=true&searchTerm=BP1521&searchType=RAPID
Tryptone Becto, Dickinson and Co. 211705 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=211705&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D211705%26typeOfSearch%3DproductSearch
Yeast Extract Becto, Dickinson and Co. 212750 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=212750&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D212750%26typeOfSearch%3DproductSearch
α-napthol MP Biomedicals 204189 http://www.mpbio.com/product.php?pid=05204189

DOWNLOAD MATERIALS LIST

References

  1. Shimada, T., et al. Extended serotyping scheme for Vibrio cholerae. Curr. Microbiol. 28, (3), 175-178 (1994).
  2. Yamai, S., Tadayuki, O., Toshio, S., Yasuji, K. Distribution of serogroups of Vibrio cholerae non-O1 non-O139 with specific reference to their ability to produce cholera toxin, and addition of novel serogroups. Jpn. J. Infect. Dis. 71, (10), 1037-1045 (1997).
  3. Karaolis, D. K., Lan, R., Reeves, P. R. The sixth and seventh cholera pandemics are due to independent clones separately derived from environmental, nontoxigenic, non-O1 Vibrio cholerae. J. Bacteriol. 177, (11), 3191-3198 (1995).
  4. Albert, M. J., et al. Large epidemic of cholera-like disease in Bangladesh caused by Vibrio cholerae O139 synonym Bengal. Lancet. 342, (8868), 387 (1993).
  5. Barua, D. History of Cholera. Cholera. Barua, D., Greenough III, W. B. Plenum Publishing Corporation. 1-36 (1992).
  6. Morales, R., Delgado, G., Cravioto, A. Population Genetics of Vibrio cholerae. Vibrio cholerae-Genomics and Molecular Biology. Faruque, S. M., Nair, G. B. Caister Academic Press. 29-47 (2008).
  7. Samadi, A. R., Chowdhury, M. K., Huq, M. K., Khan, M. U. Seasonality of classical and El Tor cholera in Dhaka, Bangladesh: 17-year trends. Trans. R. Soc. Trop. Med. Hyg. 77, (6), 853-856 (1983).
  8. Son, M. S., Megli, C. J., Kovacikova, G., Qadri, F., Taylor, R. K. Characterization of Vibrio cholerae O1 El Tor biotype variant clinical isolates from Bangladesh and Haiti, including a molecular genetic analysis of virulence genes. J. Clin. Microbiol. 49, (11), 3739-3749 (2011).
  9. Ghosh-Banerjee, J., et al. Cholera toxin production by the El Tor variant of Vibrio cholerae O1 compared to prototype El Tor and classical biotypes. J. Clin. Microbiol. 48, (11), 4283-4286 (2010).
  10. Ansaruzzaman, M., et al. The Mozambique cholera vaccine demonstration project coordination group. Cholera in Mozambique, variant of Vibrio cholerae. Emerg. Infect. Dis. 10, (11), 2057-2059 (2004).
  11. Ansaruzzaman, M., et al. Genetic diversity of El Tor strains of Vibrio cholerae O1 with hybrid traits isolated from Bangladesh and Mozambique. Int. J. Med. Microbiol. 297, (6), 443-449 (2007).
  12. Lan, R., Reeves, P. R. Pandemic spread of cholera: genetic diversity and relationships within the seventh pandemic clone of Vibrio cholerae determined by amplified fragment length polymorphism. J. Clin. Microbiol. 40, (1), 172-181 (2002).
  13. Nair, G. B., Faruque, S. M., Bhuiyan, N. A., Kamruzzaman, M., Siddique, A. K., Sack, D. A. New variants of Vibrio cholerae O1 biotype El Tor with attributes of the classical biotype from hospitalized patients with acute diarrhea in Bangladesh. J. Clin. Microbiol. 40, (9), 3296-3299 (2002).
  14. Nair, G. B., et al. Isolation of Vibrio cholerae O1 strains similar to pre-seventh pandemic El Tor strains during an outbreak of gastrointestinal disease in an island resort in Fiji. J. Med. Microbiol. 55, (11), 1559-1562 (2006).
  15. Nair, G. B., Mukhopadhyay, A. K., Safa, A., Takeda, Y. Emerging hybrid variants of Vibrio cholerae O1. Vibrio cholerae—Genomics and Molecular Biology. Faruque, S. M., Nair, G. B. Horizon Scientific Press. 179-190 (2008).
  16. Safa, A., et al. Genetic characteristics of Matlab variants of Vibrio cholerae O1 that are hybrids between classical and El Tor biotypes. J. Med. Microbiol. 55, (11), 1563-1569 (2006).
  17. Nusrin, S., et al. Diverse CTX phages among toxigenic Vibrio cholerae O1 and O139 strains isolated between 1994 and 2002 in an area where cholera is endemic. J. Clin. Microbiol. 42, (12), 5854-5856 (2004).
  18. Carignan, B. M., Brumfield, K. D., Son, M. S. Single nucleotide polymorphisms in regulator-encoding genes have an additive effect on virulence gene expression in a Vibrio cholerae clinical isolate. mSphere. 1, (5), e00253 (2016).
  19. Iwanaga, M., Yamamoto, K., Higa, N., Ichinose, Y., Nakasone, N., Tanabe, M. Culture conditions for stimulating cholera toxin production by Vibrio cholerae O1 El Tor. Microbiol. Immunol. 30, (11), 1075-1083 (1986).
  20. DiRita, V. J., Claude, P., Georg, J., Mekalanos, J. J. Regulatory cascade controls virulence in Vibrio cholerae. Proc. Natl. Acad. Sci. USA. 88, (12), 5403-5407 (1991).
  21. Kovacikova, G., Lin, W., Skorupski, K. Duel regulation of genes involved in acetoin biosynthesis and motility/biofilm formation by the virulence activator AphA and the acetate-responsive Lys-R type regulator AlsR in Vibrio cholerae. Mol. Microbiol. 57, (2), 420-433 (2005).
  22. Vogel, H. J., Bonner, D. M. Acetylornithinase of Escherechia coli: partial purification and some properties. J. Biol. Chem. 218, (1), 97-106 (1956).
  23. Son, M. S., Taylor, R. K. Genetic screens and biochemical assays to characterize Vibrio cholerae O1 biotypes: classical and El Tor. Curr. Protoc. Microbiol. 6A.2.1-6A.2.17 (2011).
  24. Kovacikova, G., Skorupski, K. Regulation of virulence gene expression in Vibrio cholerae by quorum sensing: HapR functions at the aphA promoter. Mol. Microbiol. 46, (4), 1135-1147 (2002).
  25. Wang, Y., et al. The prevalence of functional quorum-sensing systems in recently emerged Vibrio cholerae toxigenic strains. Environ. Microbiol. Rep. 3, (2), 218-222 (2011).
  26. Sanders, E. R. Aseptic laboratory techniques. J. Vis. Exp. (63), e3064 (2012).
  27. Martinez, R. M., Megli, C. J., Taylor, R. K. Growth and laboratory maintenance of Vibrio cholerae. Curr. Protoc. 6A.1.1-6A.1.6 (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics