Tecniche di laboratorio utilizzate per mantenere e differenziare i biotipi di * These authors contributed equally

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Questo manoscritto descrive le appropriate tecniche di manutenzione Vibrio cholerae oltre ad una serie di dosaggi biochimici, utilizzati collettivamente per una differenziazione rapida e affidabile tra la clinica e l'ambiente V. Biotipi di colera in un ambiente di laboratorio.

Cite this Article

Copy Citation | Download Citations

Brumfield, K. D., Carignan, B. M., Ray, J. N., Jumpre, P. E., Son, M. S. Laboratory Techniques Used to Maintain and Differentiate Biotypes of Vibrio cholerae Clinical and Environmental Isolates. J. Vis. Exp. (123), e55760, doi:10.3791/55760 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Il batterio Gram-negativo acquatico Vibrio cholerae è l'agente etiologico del colera della malattia gastrointestinale infettiva. A causa della prevalenza e gravità globali di questa malattia, V. Il colera è stato ampiamente studiato sia in ambito ambientale che in laboratorio, che richiede una corretta manutenzione e tecniche di coltura. Classici e El Tor sono due biotipi principali che compongono il V. Colerae O1, ognuno dei quali presenta caratteristiche uniche genotipiche e fenotipiche che forniscono meccanismi affidabili per la caratterizzazione del biotipo e richiedono condizioni distintive di coltura che inducono la virulenza. Indipendentemente dal biotipo del ceppo causale per qualsiasi infezione o focolaio, il trattamento standard per la malattia comprende terapia di reidratazione integrata con un regime di antibiotici. Tuttavia, la classificazione di biotipo può essere necessaria per studi di laboratorio e può avere impatti più ampi nel campo biomedico.Nei primi anni 2000 sono stati identificati isolati clinici che presentano tratti genotipici e fenotipici sia dai biotipi classici che da El Tor. Gli ibridi di nuova identificazione, chiamati El Tor, hanno causato l'identificazione clinica e ambientale del biotipo di isolamento a diventare più complessi rispetto ai precedenti protocolli tradizionali di identificazione singola. Oltre a descrivere V. Le tecniche di mantenimento e tecniche di coltura del colerae, questo manoscritto descrive una serie di schermati genetici basati su PCR basati su gene ( ctxB e tcpA ) e saggi fenotipici (resistenza alla polimicina B, metabolismo citrato, attività proteolitica, attività emolitica, motilità e metabolismo del glucosio tramite Voges- Proskauer) utilizzati collettivamente per caratterizzare e / o distinguere tra biotipi classici e El Tor. Insieme, questi dosaggi forniscono un approccio sistematico efficiente da utilizzare come alternativa o, in aggiunta, a costosi esercizi di intensità lavorativa nella caratterizzazioneDi V. Cholerae isolati clinici (e ambientali).

Introduction

Il colera è una malattia dell'intestino tenue distale causata dal consumo di alimenti contaminati o di acqua contenente il batterio Gram-negativo acquatico Vibrio cholerae . I sintomi del colera includono vomito e diarrea acquosa incontrollabile, portando ad una grave disidratazione che, se non trattata correttamente, provocherà la morte. V. Il colerae può essere diviso in oltre 200 serogruppi basati sulla struttura del lipopolysaccharide O-antigene della superficie cellulare. Tuttavia, solo 2 serogruppi, O1 e O139, hanno mostrato potenziale epidemico o pandemico 1 , 2 . Inoltre, il serogroup O139 è stato principalmente isolato per l'Asia sud-orientale 3 , 4 , mentre il sierogruppo O1 è distribuito in tutto il mondo. Inoltre, il serogroupo O1 può essere diviso in 2 biotipi principali: classici e El Tor. Il biotipo classico era responsabile delle prime 6 pandemie del coleraTra il 1817 e il 1923. La peggiorata settima pandemia è il risultato del biotipo El Tor, che ha spostato globalmente il biotipo classico nell'ambiente 5 , 6 , 7 . Sono stati recentemente presentati ceppi che contengono caratteristiche distintive di biotipi classici e El Tor 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 e da allora sono stati denominati varianti El Tor 13 , 17 . Alcune varianti di El Tor hanno dimostrato elevate capacità di virulenza con una progressione più rapida e grave della malattia rispetto a quanto precedentemente osservato, sottolineandoLa necessità di un approccio più completo all'identificazione degli agenti e alla prevenzione e trattamento delle malattie 8 , 9 , 18 . Mentre l'identificazione del biotipo non impone immediatamente il trattamento, ulteriori progressi nello sviluppo del vaccino e nei futuri agenti terapeutici possono beneficiare della distinzione tra biotipo.

La prima serie di protocolli elencati qui consentirà agli investigatori di mantenere correttamente V. Ceppi di colera in un ambiente di laboratorio. La coerenza e l'analisi successiva richiedono la preparazione e la crescita degli stock di isolati, che non dipendono dal biotipo. Tuttavia, per indurre in modo ottimale l'espressione genica di virulenza, sono necessarie tecniche indipendenti di coltura biotipo 19 . Inoltre, la preparazione per diversi dosaggi genetici e biochimici è descritta in questo manoscritto.

Tossina del colera (CT) e la tossina co-re(TCP) sono due principali fattori di virulenza controllati dal regolatore master ToxT in entrambi i biotipi del V. Il colerae O1 sierogruppo 20 . CT è una tossina bipartita composta da cinque CtxB Subunità che circondano una singola subunità CtxA ed è responsabile della rapida perdita di elettroliti associata al colera. Il TCP è un pilone di tipo IV codificato dal tcp operon ( tcpABQCRDSTEF ) ed è coinvolto nell'attaccamento e nella colonizzazione dell'intestino tenue distale. TcpA è il primo gene dell'operone tcp che codifica le singole subunità piline essenziali per la costruzione del pilus 8 . La sequenza genica per ctxA è completamente conservata tra biotipi classici e El Tor, mentre ctxB e tcpA si differenziano tra i due biotipi ma sono conservati all'interno di ciascun biotipo 8 . CtxB è completamente conservato tra i biotipi ad eccezione di due posi base(115 e 203). Nel biotipo El Tor, la timina risiede nelle posizioni base 115 e 203, mentre il biotipo classico contiene citosina a queste basi. TcpA è completamente conservato all'interno di ogni biotipo, ma differisce da molteplici basi tra biotipi. Queste distinzioni genetiche servono come marcatori di identificazione biotipo primari, e dopo la sequenza del prodotto di amplificazione della reazione di polimerasi (PCR), inclusi questi siti, le sequenze di isolamento possono essere confrontate con il classico O395 o WT El Tor N16961 di tipo wild (WT) per determinare lo sfondo del biotipo Di CT e TCP rispettivamente, in un dato isolamento di V. cholerae .

Numerosi protocolli sono stati sviluppati per caratterizzare le distinzioni fenotipiche tra i biotipi classici e El Tor 21 , 22 , 23 . Polimicina B è un antibiotico peptidico che compromette l'integrità della membrana cellulare esterna in bacTeria e la resistenza alla polimicina B possono essere visualizzati attraverso il saggio di resistenza della polimigina B 21 . Il citrato è un substrato primario del ciclo di Kreb, e la capacità di metabolizzare il citrato come fonte di carbonio unica può essere determinata usando il saggio del metabolismo citrato 22 . HapR codifica un regolatore globale e il regolatore di sensori quorum master in V. cholerae, HapR, che si lega a varie regioni del promotore e regola l'espressione del gene e dell'operone 24 . Alcuni ceppi patogeni di V. cholerae hanno una mutazione in movimento naturale nel gene hapR che ha causato la perdita di questa regolazione dipendente dalla densità dell'espressione genetica di virulenza 24 , 25 . La misurazione dell'attività di proteasi regolata da HapR utilizzando il supporto agarico del latte permette al ricercatore di identificare se un particolare isolato contiene un HapR 23 funzionale. IlI test di hemolysis per una capacità del ceppo di secernere enzimi emolitici che lissano i globuli rossi; Il grado di emolisi può essere visualizzato sulle piastre di agar sangue 23 . La motilità è spesso associata alla virulenza di V. cholerae e può essere analizzata usando le piastre agarico agar 23 . Il test Voges-Proskauer esamina la capacità di uno strain di fermentare il glucosio come una sola fonte di carbonio e produrre l'acetoina sottoprodotto 21 . Con l'emergere di varianti di El Tor, è difficile prevedere i risultati di un determinato dosaggio fenotipico senza estesa screening genotipica e prima di dedurre lo sfondo biotipo di V. Isolati di colerae, si raccomanda di eseguire questo insieme di dosaggi 23 e confrontare i risultati con i ceppi di riferimento come nella tabella 2 .

In questo contesto, abbiamo avanzato una serie di protocolli, utilizzando collettivamente l'aforemeI test genotipici e fenotipici per un approccio più completo alla caratterizzazione di V. Biotipi di colera. Inoltre, abbiamo descritto le distinzioni genotipiche e fenotipiche del V noto. Varianti del colerae El Tor (MQ1795 e BAA-2163), rispetto ai ceppi di riferimento di biotipo comunemente usati (WT classico O395, WT El Tor C6706 e WT El Tor N16961, Tabella 1 ). L'emergere di varianti El Tor ha presentato sfide all'affidabilità dei protocolli di individuazione biotipo di singolo dosaggio precedentemente impiegati; Tuttavia, questo sistema di identificazione multipla consentirà una caratterizzazione più affidabile dei criteri clinici e ambientali. Isolati di colera .

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Nota: le considerazioni di tempo per ogni dosaggio devono essere effettuate poiché le singole preparazioni per i supporti richiedono tempi diversi. Ad esempio, i supporti a lastre di agarro solido devono essere abbassati e asciugati (1-2 giorni). Ulteriori considerazioni di tempo ( cioè la colonia singola e la crescita della coltura durante la notte) sono specificate in ciascun protocollo e si trovano nella tabella 2 .

1. Preparazione dei supporti

  1. 1x salina a tampone fosfato (PBS)
    1. Pesare 4,0 g NaCl, 0,1 g KCl, 0,72 g Na 2 HPO 4 e 0,12 g KH 2 PO 4 . Combinare i costituenti in un pallone Erlenmeyer da 1 L, regolare il volume a 500 mL con acqua deionizzata, regolare il pH a 7,2 utilizzando un misuratore di pH e aggiungere HCl in goccia alla soluzione e sterilizzare con autoclave o filtro usando un filtro da 0,22 μm. 1x PBS può essere conservato a temperatura ambiente a tempo indeterminato.
      ATTENZIONE: HCl è un acido concentrato e deve essere manipolato secondoAlle norme istituzionali, locali, statali e federali. Per le linee guida appropriate per la manipolazione fare riferimento alla scheda di dati di sicurezza fornita dal produttore.
  2. Luria-Bertani (LB) brodo
    1. Pesare 5,0 g di tryptone, 2,5 g di estratto di lievito e 2,5 g di NaCl. Combinare i componenti in una bottiglia da 1 L, regolare il volume a 500 mL con acqua deionizzata, autoclave e conservare a temperatura ambiente fino a 6 mesi. Per le condizioni indotte da virulenza classica biotipo, regolare il pH a 6,5 ​​con HCl prima dell'autoclavamento.
  3. AKI Medium contenente 0,03% (w / v) NaHCO 3
    1. Per il componente 1 (medium AKI): pesare 7,5 g di peptone, 2,0 g di estratto di lievito e 2,5 g di NaCl. Combinare i componenti in una bottiglia da 1 L, regolare il volume a 450 mL con acqua deionizzata e autoclave. Il mezzo AKI può essere conservato a temperatura ambiente fino a 6 mesi.
    2. Per il componente 2 (NaHCO 3 ): pesare 1,5 g di NaHCO 3 e regolare il volumeA 50 mL con acqua deionizzata in una vescicola sterile. Filtro sterilizzare NaHCO 3 utilizzando un filtro da 0,22 μm. NaHCO3 deve essere preparato immediatamente prima dell'uso.
    3. Asepticamente combinare i due componenti creando un rapporto 1:10 filtrando il componente 2 nella componente 1 prima dell'uso.
  4. Luria-Bertani (LB) piatti di agar
    1. Pesare 5,0 g di tryptone, 2,5 g di estratto di lievito, 2,5 g di NaCl e 7,5 g di agar. Combinare i componenti in un pallone Erlenmeyer da 1 L, regolare il volume a 500 mL con acqua deionizzata, autoclave e preparare in piatti standard Petri di 100 mm x 15 mm sterili. I supporti placcati possono essere immagazzinati in plastica per un massimo di 6 mesi, con coperchio fino a 4 ° C.
  5. LB Agar Piatti Supplementati con Polymyxin B
    1. Per il componente 1 (agar LB): pesare 5,0 g di tryptone, 2,5 g di estratto di lievito, 2,5 g di NaCl e 7,5 g di agar. Combinare i costituenti in un pallone Erlenmeyer da 1 L, regolare il volume a 500 mL wiL'acqua deionizzata e l'autoclave.
    2. Per il componente 2 (polimicina B): sciogliere la polimicina B in acqua deionizzata in un tubo sterile di microcentrifuga da 2 ml a una concentrazione di 50.000 UI / μl e sterilizzare con filtro utilizzando un filtro da 0,22 μm.
    3. Una volta che il componente 1 è fresco al tocco, ma non ancora solidificato, aggiungere asetticamente 500 μL di componente 2 al componente 1 creando una concentrazione finale di 50 UI / μL e mescolare accuratamente. Preparare piatti standard Petri di 100 mm x 15 mm versando agar mischiati nei piatti di Petri. I supporti placcati possono essere immagazzinati in plastica per un massimo di 3 mesi, con coperchio fino a 4 ° C.
  6. Piatti minimi di agar di citrato
    1. Per il componente 1 (agar con blu bromotimolo): pesare 7,5 g di agar e 0,02 g di bromotimolo blu. Combinare i costituenti in un pallone Erlenmeyer da 1 L, regolare il volume a 450 mL con acqua deionizzata e autoclave la miscela.
    2. Per il componente 2 (10x VBMM): pesare 10,1 g di MgSO 4 7H 2 O, 10,0 g di acido citrico acido H 2 O, 50,0 g di K 2 HPO 4 anidro e 17,5 g di NaNH 4 HPO 4 4 H 2 O. Combinare i costituenti in un pallone Erlenmeyer da 1 L, regolare il volume a 500 ml Con acqua deionizzata e sterilizzazione autoclave o filtro usando un filtro da 0,22 μm. 10x VBMM può essere conservato a temperatura ambiente fino a 6 mesi.
    3. Aggiungere 50 ml di componente 2 al componente 1 e preparare in piatti standard Petri da 100 mm x 15 mm versando agar mischiati nei piatti di Petri. I supporti placcati possono essere immagazzinati in plastica per un massimo di 6 mesi, con coperchio fino a 4 ° C.
  7. Piatti di Agar Milk
    1. Per il componente 1 (latte): pesare 8,0 g di latte secco non grasso istantaneo in un pallone Erlenmeyer da 1 L, regolare il volume a 200 ml con acqua deionizzata e autoclave.
    2. Per il componente 2 (agar con infusione cerebrale-cuore): pesare 3,68 g di infusione cerebrale-cuore e 6,0 g di agar. Combina il conIn un pallone Erlenmeyer da 500 mL, regolare il volume a 200 mL con acqua deionizzata e autoclave.
    3. Combinate i due componenti versando il componente 2 nella componente 1, dopo aver autoclavato e mescolato accuratamente. Preparare in piatti di Petri sterili da 150 mm x 15 mm. Le piastre di latte possono essere conservate fino a una settimana avvolte in plastica, con coperchio verso il basso a 4 ° C. Preparare in piatti di Petri sterili da 150 mm x 15 mm versando agar mischiati nei piatti di Petri.
  8. Piastre di agaricità
    1. Per il componente 1 (LB agar): pesare 5,0 g di tryptone, 2,5 g di estratto di lievito, 2,5 g di NaCl e 2,0 g di agar. Combinare i costituenti in un pallone Erlenmeyer da 1 L, regolare il volume a 500 mL con acqua deionizzata e autoclave.
    2. Per il componente 2 (1% (w / v) cloruro di trifeniltetrazolium; TTC): pesare 0,25 g di TTC. Regolare il volume a 25 ml con acqua deionizzata in una vescicola sterile e sterilizzare con filtro utilizzando un filtro da 0,22 μm. Conservare fino a 6 mesi a temperatura ambiente avvoltoIn foglio per minimizzare l'esposizione alla luce.
    3. Aggiungere 2,5 ml di 1% (w / v) TTC sterile ai supporti autoclavati.
    4. Versare il mezzo più spesso possibile (≥50 mL / piastra) in grandi piatti di Petri sterili 150 mm x 15 mm. I supporti placcati possono essere immagazzinati in plastica fino a una settimana, con coperchio fino a 4 ° C. Preparare in piatti di Petri sterili da 150 mm x 15 mm versando agar mischiati nei piatti di Petri.
  9. Voges-Proskauer (VP)
    1. Per il componente 1 (Methyl Red-Voges-Proskauer broth; MR-VP): pesare 1,7 g di supporto MR-VP in un pallone Erlenmeyer da 500 ml, regolare il volume a 100 ml con acqua deionizzata e autoclave. Il brodo sterile MR-VP può essere conservato a temperatura ambiente fino a 6 mesi.
    2. Per il componente 2 (5% (w / v) alfa (α) naphtolo): pesare 1,0 g di α-naftolo in una vescicola sterile e regolare il volume a 20 ml con 95% etanolo. L'α-naftolo può essere conservato a temperatura ambiente fino a 1 settimana avvolto in fogli per ridurre al minimo la luceosure.
    3. Per il componente 3 (40% (w / v) idrossido di potassio; KOH): pesare 20,0 g di KOH in una vescicola sterile, regolare il volume a 50 ml con acqua sterile deionizzata. KOH può essere conservato fino a 6 mesi a temperatura ambiente in un recipiente di plastica.

2. Manutenzione e crescita di V. Ceppi di colera

  1. Preparazione e utilizzo di colture congelate
    1. Pellet 1.8 ml di coltura di notte per 2 min per centrifugazione (≥8.600 xg) in un tubo sterile di microcentrifuga da 2 ml, rimuovere il surnatante e riposizionare il pellet cellulare in 900 μL di brodo fresco di LB pipettando.
    2. Aggiungere 900 μL di glicerolo sterile al 60% (v / v) alla coltura e mescolare mediante vortexing.
    3. Trasferire la miscela in un tubo criogenico sterile da 2 ml e conservare a tempo indeterminato a -80 ° C.
    4. Per utilizzare, rimuovere una piccola quantità di stock congelata usando un ciclo inoculatore sterile e una striscia per singole colonie su LB agAr. Immediatamente rimettere a magazzino congelato a -80 ° C dopo l'uso per evitare che le culture si scongiurino completamente. Incubare le piastre con il coperchio lungo il basso per 12 a 16 ore a 37 ° C.
  2. Crescita di culture di overnight in liquido medio
    1. Striature per colonie singole (secondo la sezione 2.1.4) da scorte surgelate su piastre LB agar. Incubare le piastre con il coperchio laterale per 12 a 16 ore a 37 ° C.
    2. Inoculare 4 ml di liquido LB liquido in un tubo di coltura sterile da 10 ml con una singola colonia toccando la superficie della singola colonia con un bastone applicatore sterile e trasferendo la colonia nel brodo liquido.
    3. Incubare con aerazione in un incubatore a scuotitore a 225 giri / min per 12 a 16 h a 37 ° C.
  3. Curva di crescita
    1. Preparare la coltura durante la notte in brodo LB liquido come precedentemente indicato nel protocollo 2.2.
    2. Fai una diluizione 1: 100 di coltura durante la notte trasferendo 250 μL di coltura overnight a 25 ml di brodo fresco di LB in un pallone Erlenmeyer da 250 ml sterile.
    3. Misurare la densità ottica delle colture liquide a 600 nm (OD 600 ) ogni ora a partire dall'inoculazione (T 0 ).
    4. Incubare una diluizione 1: 100 di coltura durante la notte con aerazione in un incubatore a scuotitore a 225 giri / min fino a 30 h a 37 ° C o fino a raggiungere la massima densità della coltura.
    5. Grafico OD 600 vs. tempo e utilizzare regressione lineare per determinare il tempo di raddoppio approssimativo per ogni ceppo.
  4. El Tor Biotipo Virulenza Induzione delle Condizioni
    1. Striata per singole colonie da scorta congelata su piastre LB agar. Incubare le piastre verso il basso con coperchio, per 12 a 16 ore a 37 ° C.
    2. Inoculare 10 mL di mezzo AKI contenente 0,03% (w / v) NaHCO 3 con una sola colonia.
    3. Incubare la coltura senza aerazione a 37 ° C per 3,5 ore.
    4. Rimuovere 7 mL di coltura e incubare le restanti 3 mL di cultuCon aerazione in un incubatore a scuotitore a 225 giri / min per altri 4 h.
  5. Condizioni di inducimento della virulenza di biotipo classico
    1. Striata per singole colonie da scorta congelata su piastre LB agar. Incubare le piastre con il coperchio laterale per 12 a 16 ore a 37 ° C.
    2. Inoculare 4 mL di liquido LB liquido (pH 6,5) con una singola colonia.
    3. Incubare con aerazione in un incubatore a scuotitore a 225 giri / min per 12 a 16 h a 30 ° C.
  6. Pellet cella di lavaggio in 1x PBS
    1. Pellet 1.8 ml di coltura durante la notte per 2 min per centrifugazione (≥8.600 xg) in un tubo sterile di microcentrifuga da 2 ml e rimuovere il surnatante usando una pipetta. Riposizionare il pellet di cellula in 1,8 ml di 1x PBS pipettando.
    2. Ripetere la procedura di lavaggio tre volte seguita da una resuspensione finale in 1,8 mL di 1x PBS.

3. Caratterizzazione V. Biotipi del colera

  1. PSchermate genetiche basate su CR utilizzando ctxB e tcpA
    1. Progettare un insieme di primer, che annealizzano circa 50-70 bp a monte ea valle degli start e stop di traslazione di ctxB e tcpA.
    2. Preparare la coltura durante la notte in brodo LB liquido come precedentemente indicato nel protocollo 2.2.
    3. Isolare il DNA cromosomico utilizzando un kit commercialmente disponibile per i batteri Gram-negativi. Il DNA cromosomico purificato può essere immagazzinato indefinitamente a -20 ° C. L'isolamento cromosomico del DNA usando i kit disponibili in commercio richiede generalmente circa 4 h.
    4. Utilizzare un spettrofotometro a micro-volume per assicurare che il campione del DNA cromosomico sia di alta qualità (A 260/280 > 1,8).
    5. Per ciascun isolamento cromosomico del DNA, preparare le reazioni di polimerasi (PCR) su ghiaccio nel tubo sterile di 200 μl di PCR e amplificare le regioni di ctxB e tcpA usando componenti standard PCR: Taq polimerasi e buFfer (o equivalenti), soluzione dNTP e primer avanti / indietro. Utilizzare parametri standard PCR (~ 3 h). Ad esempio, utilizzare il seguente protocollo:
      1. Denatura iniziale a 95 ° C per 120 s.
      2. Denatura a 95 ° C per 60 s.
      3. Applicare primer a 60 ° C per 45 s.
      4. Estendere a 72 ° C per 90 s.
      5. Ripetere i passaggi da 3.1.5.2 a 3.1.5.4 per 34 cicli.
      6. Estensione finale 72 ° C per 600 s.
      7. Tenuta infinita a 4 ° C.
    6. Dye 5 μL di rispettivi prodotti PCR usando un colorante di caricamento a gel di DNA standard 6x e caricare circa 10 μL di scala 1 kb e 10 μL di prodotto PCR su un gel agarosico al 1% in 1x Tris-Borato-EDTA (TBE) buffer.
    7. Eseguire l'elettroforesi a gel a 130 V finché il frontale del colorante non raggiunge la fine, ma non fuori, del gel (circa 90 minuti). Si consiglia di monitorare costantemente come tensione e tempi di funzionamento possono variare a seconda dell'apparecchiatura.
    8. Alla verifica delUna amplificazione PCR di successo alla dimensione prevista, purificare il restante 45 μl di prodotto PCR usando un kit di pulizia e concentratore del DNA disponibili in commercio.
    9. Sequenza di prodotti PCR puliti utilizzando gli stessi primer utilizzati per l'amplificazione PCR e prepararsi secondo le linee guida locali di sequenziamento.
    10. Confronta il formato FASTA di sequenze di gene da ogni isolato alla sequenza pubblicata disponibile sul sito NCBI (http://www.ncbi.nlm.nih.gov/gene/), cercando i seguenti numeri di accesso nella casella della query di ricerca.
    11. CtxB : regione (classica) tra VC0395_A1059 a VC0395_A1060 (El Tor) VC_1456
    12. TcpA : (classico) VC0395_A0353 (El Tor) VC_0828
  2. Analisi fenotipiche per la classificazione di biotipo mediante spotting
    1. Preparare la coltura durante la notte in brodo LB liquido come precedentemente indicato nel protocollo 2.2.
    2. Lavare le pellicole di cellule come specificato nel protocollo 2.6.
    3. Usare una pipetta aSpot 1 μl di coltura lavata in corrispondente mezzo. Per le specifiche di selezione e incubazione medio, fare riferimento alla Tabella 2.
  3. Analisi della carenza
    1. Preparare la coltura durante la notte in brodo LB liquido come precedentemente indicato nel protocollo 2.2.
    2. Lavare le pellicole di cellule come specificato nel protocollo 2.6.
    3. Inoculare le piastre di agarità agarico inserendo l'inoculazione dello straccio nella coltura liquida lavata e "pungere" verticalmente nei supporti. In mezzo a ogni inoculazione, sterilizzare il coltello con un bruciatore di Bunsen e, quando pigiate l'agar, assicurati che il pungo inoculato non si piega, in quanto ciò può alterare i risultati.
    4. Incubare le piastre con il coperchio verso l'alto per 14 a 24 ore a 37 ° C. Dopo 14 ore, controllare le piastre di movimento per evitare la crescita eccessiva di culture.
  4. Analisi Voges-Proskauer (VP)
    1. Preparare la coltura durante la notte in brodo LB liquido come precedentemente indicato nel protocollo 2.2.
    2. Inoculare 4Ml di Voges-Proskauer rosso o rosso di metile, o brodo MR-VP, pipettando 10 μL di coltura overnight in precedenza preparata in 4 mL di brodo MR-VP in un tubo di coltura sterile e incubato con aerazione in un incubatore a scuotitore a 225 giri / min per 12 a 16 H a 37 ° C.
    3. Aggiungere 150 μl di α-naftolo al 5% (w / v) e 50 μl 40% (w / v) KOH in 1 ml aliquote di coltura overnight di MR-VP in tubi di coltura sterile rispettivamente.
    4. Brevemente vortice e lasciate stare a temperatura ambiente fino a 4 h fino a quando non cambia colore.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Per una corretta manutenzione e l'uso di qualsiasi ceppo batterico, è consigliabile conoscere il tempo di raddoppiamento dei ceppi di interesse. Qui, i tassi di crescita variabili dei V comunemente usati. I ceppi del colerae sono stati dimostrati attraverso una curva di crescita e sono stati calcolati approssimativi tempi di raddoppio utilizzando la regressione lineare. Il WT El Tor N16961 e la variante El Tor MQ1795 hanno dimostrato tempi di raddoppio più brevi (~ 1 h e ~ 1 h rispettivamente) rispetto alla classica O395 WT (~ 2 h) ( Figura 1 , Tabella 2 ).

La manipolazione genetica del colerae V. e la successiva analisi si basano spesso sulla capacità di distinguere correttamente tra i biotipi. Gli schermi genetici basati su PCR e i dosaggi fenotipici sono stati implementati collettivamente come un sistema affidabile per distinguere tra background biotipo di V. Cholerae clinico e ambientale isolates; Per la rappresentazione sono stati inclusi i ceppi di riferimento biotipo (WT classico O395, WT El Tor C6706 e WT El Tor N16961) e rappresentative di varianti El Tor (MQ1795 e BAA-2163) ( Tabella 1 ). La classica O395 WT ha dimostrato sequenze classiche ctxB e tcpA. Al contrario, i ceppi WT El Tor N16961 e C6706 hanno dimostrato sequenze El Tor ctxB e tcpA. È interessante notare che MQ1795 e BAA-2163 contenevano la classica biotipo subunità di ctxB paragonabile a O395, tuttavia entrambe le varianti El Tor contenevano l' indicazione tcpA del background Biotipo El Tor ( Tabella 1 ). Il ceppo di biotipo classico WT O395 ha mostrato sensibilità alla polimicina B, mentre i ceppi di biotipo WT El Tor (C6706 e N16961) hanno mostrato resistenza e hanno mostrato una crescita su piastre LB agar integrate con polimicina B. I ceppi rappresentativi di El Tor (MQ1795 e BAA-2163) Resistenza simile all'antibiotico rispetto al WT El Tor biotipo straIns (C6706 e N16961) ( Figura 2 , Tabella 2 ). Il ceppo O395 classico del biotipo WT non è cresciuto sui media di citrato minima, mentre i ceppi di WT El Tor (C6706 e N16961) sono stati in grado di utilizzare citrato come fonte di carbonio e mostrano crescita su minime citrate. I ceppi di biotipo del variatore El Tor (MQ1795 e BAA-2163) hanno dimostrato una crescita comparabile a quella dei ceppi di biotipo WT El Tor (C6706 e N16961) ( Figura 3 , Tabella 2 ). Il ceppo classico di WT O395 e il ceppo WT El Tor N16961 possiede un HapR non funzionale e, quindi, non ha dimostrato l'attività proteica regolata da HapR; WT El Tor C6706 e varianti rappresentative di El Tor (MQ1795 e BAA-2163) sono posizionate positivamente come zona di clearance che emana dal punto di inoculazione ( Figura 4 , Tabella 2 ). Il ceppo O395 classico del WT non secernera gli enzimi emolitici ed è stato per questoMentre i ceppi di biotipo WT El Tor (C6706 e N16961) e i ceppi rappresentativi di El Tor (MQ1795 e BAA-2163) secernono gli enzimi emolitici che completamente liscano i globuli rossi che circondano il punto di inoculazione e hanno dimostrato la β-emolisi ( Figura 5 ; Tabella 2 ). La motilità varia tra i ceppi di biotipo e all'interno; Tuttavia, la variante WT El Tor N16961 e El Tor (MQ1795 e BAA-2163) ha dimostrato l'iper-motilità rispetto al ceppo classico WT O395 e WT El Tor C6106 ( Figura 6 , Tabella 2 ). Il ceppo classico del WT O395 e le varianti El Tor non hanno metabolizzato il glucosio per produrre acetoina, mentre i ceppi di biotipo WT El Tor hanno prodotto acetoina come sottoprodotto di fermentazione di glucosio, come indicato dallo sviluppo di un colore rosso intenso durante il saggio Voges-Proskauer ( Figura 7 Tabella 2 ).

Sforzo CtxB Gene TCPA Riferimento
Base 115 Base 203 biotipo biotipo
O395 C C classico classico 8
C6706 T T El Tor El Tor 8
N16961 T T El Tor El Tor 8
MQ1795 C C classico El Tor 13
BAA-2163 C C classico El Tor 8

Tabella 1: Distinzioni genetiche dipendenti dal biotipo dei ceppi di riferimento di Vibrio cholerae . In questa tabella sono riportati i cambiamenti di base del DNA e le relative posizioni nei geni ctxB e tcpA . I ceppi WT classici O395 e WT El Tor N16961 e C6706 sono comunemente usati ceppi di riferimento di biotipo. MQ1795 e BAA-2163 sono note varianti El Tor.

saggio Applicazione Selezione media incubazione risultati aspettati
O395 C6706 N16961 MQ1795 BAA-2163
2.3) Curva di crescita 27 Determina i tempi di raddoppio dei vari ceppi di V. cholerae 1.2) Brodo liquido liquido Fino a 30 h (37 ° C con aerazione) ~ 2 h ND * ~ 1 h ~ 1 h ND *
3.1) Schermata genetica basata su PCR usando ctxB e tcpA 8 Diversi tra gli sfondi biotipici classici e El Tor di ctxB N / A N / A classico El Tor El Tor classico classico
Differenze tra gli ambiti di biotipia classici e El Tor di tcpA N / A N / A classico El Tor El Tor El Tor El Tor
3.2) Resistenza polimicina B 21 Sensibilità alla polimicina antibiotica B 1.5) LB agar piastre integrate con polimicina B 18 h (37 ° C) - + + + +
3.2) Metabolismo del citrato 22 Possibilità di metabolizzare citrato come fonte di carbonio unica 1.6) Piastre di agar medio minime citrate 24 h (37 ° C) - + + + +
3.2) Idrolisi di caseina 23 Attività proteasi regolata da HapR 1.7) Piastre di agar di latte 18 h (37 ° C) - - + + +
3.2) Emolisi 23 Misura l'attività emolitica Piastre di agar sangue 48 h (37 ° C) Gamma Beta Beta Beta Beta
3.3) Motilità 23 Misura il grado di motilità 1.8) Piastre di agaricità 14-24 h (37 ° C) 10 mm 15 mm 21 mm 25 mm 29 mm
3.4) Voges-Proskauer 21 Misura la capacità di fermentare il glocose e produrre l'acetoina come sottoprodotto 1.9) Liquido Voges-Proskauer medium Fino a 4 ore (temperatura ambiente) - + + - -
Nota: "ND *" indica non determinato; "+" Indica un risultato positivo; "-" indica un risultato negativo

Tabella 2: Sommario dei dosaggi genetici e fenotipici utilizzati per Vibrio colerae Distinzione di biotipo. Questa tabella riassume i vari esiti genetici e fenotipici, le applicazioni ei risultati attesi utilizzati collettivamente per differenziare tra biotipi classici e El Tor utilizzati in questo studio. I numeri di protocollo e riferimenti a specifici protocolli sono indicati nella colonna Assay. "ND *" indica non determinato; "+" Indica un risultato positivo; "-" indica un risultato negativo.

Figura 1
Figura 1: V. Curva di Crescita Colerae del WT Classico O395, WT El Tor N16961 e El Tor Variant MQ1795. I tassi di crescita dei ceppi di riferimento biotipo (WT classico O395 e WT El Tor N16961) e rappresentante El Tor Variant MQ1795, coltivati ​​in brodo LB con aerazione a 37 ° C, sono stati analizzati misurando l'OD 600 eMolto ore a partire da T 0 . Le curve di crescita sono state eseguite su 8 repliche sperimentali indipendenti, con ogni replica che rappresenta un evento di coltura indipendente per ogni prova. Il ceppo WT El Tor N16961 e la variante El Tor MQ1795 hanno dimostrato tempi di raddoppio più brevi (~ 1 h e ~ 1 h rispettivamente) rispetto al ceppo classico O395 (~ 2 h), come osservato da un più lungo tempo di raddoppiamento. Clicca qui per visualizzare una versione più grande di questa figura.

figura 2
Figura 2: Determinazione della resistenza polimicina B usando LB agar integrata con Polymyxin B. La resistenza alla polimicina B del peptide antibiotico è stata determinata dalla capacità di coltivare su LB agar integrato con polimyxina B. 50 UI / μL. Il ceppo classico WT O395 non mostrava alcuna crescita su agar supplEmentato con polimicina B ed è stato considerato sensibile all'antibiotico. Mentre i ceppi WT El Tor (C6706 e N16961) e le varianti El Tor (MQ1795 e BAA-2163) rappresentavano la crescita in presenza dell'antibiotico e sono stati considerati resistenti alla polimicina B. Le piastre sono state incubate a 37 ° C per 18 ore. Clicca qui per visualizzare una versione più grande di questa figura.

Figura 3
Figura 3: Misurare il metabolismo del citrato utilizzando il supporto di minimi citrato. La capacità di utilizzare citrato come una sola fonte di carbonio è stata determinata dalla capacità dell'isolato di crescere sui media minima di citrato. Il ceppo O395 classico di WT non è cresciuto sui media minima di citrato (negativo). La crescita è stata evidente da tutti i ceppi di WT El Tor (C6706 e N16961) e rappresentante ElVarianti di Tor (MQ1795 e BAA-2163), che hanno dimostrato la capacità di utilizzare citrato come fonte di carbonio unica (positivo). Le piastre sono state incubate a 37 ° C per 18 ore. Clicca qui per visualizzare una versione più grande di questa figura.

Figura 4
Figura 4: Misurazione dell'idrolisi di caseina proteolitica regolata con HapR. L'idrolisi della casiina attraverso l'attività proteasi regolata da HapR è stata determinata da una zona visiva di clearance che circonda il punto di inoculazione sull'agar di latte. I ceppi contenenti un HapR non funzionale, come il ceppo classico WT O395 e il ceppo WT El Tor N16961, non hanno prodotto una zona di spazio che circonda il punto di inoculazione ( hapR- negative). WT El Tor C6706 e varianti El Tor (MQ1795 e BAA-2163) contengono un HapR funzionale, che può essere visualizzato come zone di variazione di spazio di clearance ( hapR -positive). Le piastre sono state incubate a 37 ° C per 18 ore. Clicca qui per visualizzare una versione più grande di questa figura.

Figura 5
Figura 5: Misurazione dell'attività emolitica mediante l'uso di agar medi di sangue. L'attività emolitica è stata misurata utilizzando piastre agar integrate con sangue di pecora. Il ceppo classico del WT O395 non secernera gli enzimi che lissano le cellule del sangue (γ-emolitico). I ceppi WT El Tor (N16961 e C6706) e le varianti El Tor (MQ1795 e BAA-2163) secernono gli enzimi emolitici, che hanno determinato una zona traslucida di spazio che circonda il punto di inoculazione (β-emolitico). Le piastre sono state incubate a 37 ° C° C per 48 ore. Clicca qui per visualizzare una versione più grande di questa figura.

Figura 6
Figura 6: Determinazione della motilità usando le piastre agariche di agilità. La zona di motilità è stata indicata da un cambiamento visivo di colore del sale TTC che si trasforma da un chiaro al rosso quando metabolizzato, indicando dove si sono mossi i batteri. La deformazione classica del WT O395 (10 mm) e WT El Tor C6706 (15 mm) hanno dimostrato una minima motilità, mentre il ceppo N16961 El Tor (21 mm) e le varianti El Tor (MQ1795 (25 mm) e BAA-2163 (29 mm) ) Ha mostrato iper-motilità rispetto a O395 e C6706. Le piastre sono state incubate a 37 ° C per 18 ore. Fare clic suQui per visualizzare una versione più grande di questa figura.

Figura 7
Figura 7: Analisi di Voges-Proskauer. La produzione di acetotina mediante fermentazione di glucosio è stata determinata usando il saggio Voges-Proskauer. Il ceppo O395 classico WT e le varianti El Tor (MQ1795 e BAA-2163) non hanno prodotto acetoina a causa della fermentazione di glucosio (negativo). I ceppi WT El Tor (N16961 e C6706) hanno prodotto l'acetoina sottoprodotto e possono essere visualizzati con un cambiamento di colore rosso intenso (positivo). I tubi sono stati incubati a temperatura ambiente per 4 ore. Clicca qui per visualizzare una versione più grande di questa figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Dei oltre 200 identificati V. Colerae, solo O1 e O139 hanno un potenziale epidemico. Il serogroup di O1 può essere suddiviso in due biotipi: classici e El Tor. Tuttavia, sono emersi i ceppi ibridi, denominati varianti El Tor 13 , 17 , che possiedono il background Biotipo El Tor e le caratteristiche classiche del porto 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 . I protocolli descritti in questo manoscritto sono progettati per fornire agli investigatori interessati a caratterizzare e / o distinguere vari isolati clinici e non clinici di V. cholerae , con un affidabileSistema di identificazione multi-assay. L'uso di un sistema di identificazione multi-assay affidabile come alternativa è un miglioramento rispetto ai sistemi di identificazione singoli di analisi precedentemente stabiliti e agli schermi genetici ad alta intensità di lavoro. Tutti i test genotipici e fenotipici dovrebbero includere i ceppi classici del ceppo O395 e WT El Tor C6706 e N16961 per il confronto ( Tabella 1 ). Mentre i ceppi di biotipo classico e El Tor sono inclusi per riferimento, gli isolati, come MQ1795 e BAA-2163 inclusi nei nostri studi, possono visualizzare i profili fenotipici da entrambi i biotipi ( Figura 2 , Figura 3 , Figura 4 , Figura 5 , Figura 6 , Figura 7 , Tabella 2 ), illustrando la necessità di analizzare i tratti genotipici e fenotipici multipli per una caratterizzazione affidabile. Tutti i protocolli devono essere eseguiti asettici26 a temperatura ambiente a meno che non sia specificato diversamente. V. Il colera è un agente patogeno di livello 2 di biosicurezza (BSL-2) che è l'agente etiologico del colera della malattia gastrointestinale potenzialmente fatale; La corretta manipolazione e lo smaltimento di tutti i materiali e dei rifiuti devono essere rispettati per normative istituzionali, locali, statali e federali.

La preparazione di tutti i supporti e reagenti deve essere effettuata utilizzando reagenti a livello analitico e acqua ultrapure deionizzata ad una sensibilità minima di 18 MΩ-cm. Prima dell'elaborazione, i supporti devono essere preparati e lasciati sufficientemente asciutti (1-2 giorni); Le piastre sono considerate sufficientemente secche quando non è presente alcun liquido residuo sulla superficie dell'agar. A causa della gamma motile e delle zone di distensione che circondano la crescita batterica, motilità e piastre di latte devono essere preparate in grandi piatti di Petri (150 mm x 15 mm) fino a 50 ml per piastra e possono essere conservati fino a 1 settimana avvolti in plastica , LiRivolta verso il basso a 4 ° C. Inoltre, la concentrazione agar delle piastre motilità può essere regolata per rallentare la motilità; Tuttavia, non si consiglia di superare 3 g di agar per 500 ml di soluzione, in quanto ciò ridurrà significativamente la motilità generale in modo che le differenze non saranno osservabili. Tutti gli altri supporti di piastre devono essere preparati a circa 25 mL per piastra in piatti Petri standard (100 mm x 15 mm) e possono essere conservati fino a sei mesi avvolti in plastica, con coperchio verso il basso a 4 ºC. Per la preparazione di piastre di polimicina B è importante lasciare raffreddare i mezzi fusi dopo l'autoclave prima di aggiungere polimicina B, in quanto un calore eccessivo può degradare gli antibiotici. Le lastre di Polymyxin B possono essere conservate fino a 3 mesi avvolte in plastica, con coperchio verso il basso a 4 ° C. I dosaggi discussi in questo manoscritto richiedono un giorno per la crescita singola colonia (12-16 h), un giorno supplementare per la crescita di colture durante la notte (12-16 h) e un terzo giorno per considerazioni genotipiche (~ 4 h per il DN cromosomicoUn isolamento e ~ 3 h per PCR) o saggi fenotipici (18-48 h, Tabella 2 ). Prima dell'analisi biochimica dei dosaggi fenotipici descritti in questo manoscritto, le colture dovrebbero essere lavate in 1x PBS per evitare che i media di coltura residui vengano prelevati dai risultati di inclinazione. Inoltre, la polimicina B, il citrato, l'attività di proteasi, l'emolisi e i test di motilità possono essere inoculati contemporaneamente usando una singola coltura lavata durante la notte. Quando si osservano supporti placcati, si possono verificare splatter di culture e possono causare contaminazioni incrociate tra i ceppi. Per evitare lo splatter, evitare di espellere completamente la cultura dalla pipetta, invece smettere di espellere la coltura alla prima sosta della pipetta. Inoltre, lasciare che le macchie assorbiscano completamente nella superficie del agar prima dell'incubazione, e fate attenzione a non forare l'agar, che può influenzare i risultati. Esami fenotipici che hanno determinato zone di clearance ( Figura 4 ; Figura 5 ; Tabella 2) E / o la motilità ( Figura 6 , Tabella 2 ) che circondano il punto di inoculazione, dovrebbero essere distanziati in modo ottimale per impedire la fusione di aree di clearance o di crescita rispettivamente su cui i rispettivi diametri possono essere misurati per l'analisi comparativa. Dopo i tempi di incubazione indicati, gli isolati possono essere esaminati e analizzati in relazione ai ceppi di riferimento di biotipo (WT classico O395, WT El Tor C6706 e WT El Tor N16961).

Le schermature genetiche basate su PCR attraverso il sequenziamento descritte in questo manoscritto possono essere utilizzate per identificare lo sfondo del biotipo dell'isolato rispetto a ctxB e tcpA , a seguito dell'amplificazione iniziale di PCR. Le linee guida di sequenziamento standard richiedono una quantità specifica di prodotto PCR a seconda della dimensione della regione amplificata (580 bp per ctxB e 1420 bp per tcpA ) e per impostare le reazioni è possibile seguire protocolli stabiliti. Brevemente, individuale avanti e rEverse reazioni di sequenziamento devono essere realizzate con 3-5 pmol di primer / reazione, e il volume deve essere regolato a 20 ml con acqua ultrapura sterile in una provetta da microcentrifuga da 1,5. Per l'aiuto nella progettazione di primer per l'amplificazione sia PCR e sequenziamento, lo strumento di progettazione di primer NCBI http://www.ncbi.nlm.nih.gov/tools/primer-blast/ può essere utilizzato. L'amplificazione e sequenziamento di successo di ctxB e TCPA è stato realizzato utilizzando i seguenti primer (5 '→ 3'): ctxB- avanti GGGAATGCTCCAAGATCATCGATGAGTAATAC, ctxB CATCATCGAACCACAAAAAAGCTTACTGAGG -reverse, TCPA -Forward CCGCACCAGATCCACGTAGGTGGG, TCPA GTCGGTACATCACCTGCTGTGGGGGCAG -reverse. Va notato che l'intera regione codificante di ctxB è conservata su entrambi biotipi tranne per la base di posizioni 115 e 203 (entrambi citosina e timina in classica in El Tor). Inoltre, in TCPA, più modifiche di base sono conservati tra i biotipi che DIffer attraverso i due biotipi ( tabella 1 ), che possono essere utilizzati per aiutare a distinguere tra biotipi.

In molti studi di laboratorio che coinvolgono l'organismo modello V. Colera, le tecniche di manutenzione e di coltura adeguate sono critiche 27 . I tassi di crescita dei V comunemente usati. I ceppi di riferimento del biotipo del colerae, come il ceppo classico WT O395 e il ceppo WT El Tor N16961, possono fornire una visione utile nella caratterizzazione degli isolati di variante El Tor ( Figura 1 , Tabella 2 ). A causa dei tassi di crescita variabili in V. Isolanti di colera, è importante prendere le letture di assorbanza spettrofotometrica ogni ora fino a quando le culture non raggiungono la massima torbidità durante la fase tardiva stazionaria. La fase di morte da metà a-ritardata non può essere visualizzata a causa di un plateau in torbidità derivante da detriti cellulari in eccesso. Una diluizione 1: 4 della coltura a L sterile B dovrebbe essere eseguito per ottenere una curva di crescita completa e mantenere la precisione dello strumento, dato che le letture di assorbanza picco ad un OD 600 ≈ 1.0. Quando si eseguono curve di crescita su più ceppi, le letture di assorbanza dovrebbero essere misurate in circa 5 minuti per ogni ceppo per garantire la coerenza tra le letture. Capire V. I tassi di crescita del biotipo del colera sono fondamentali per molte indagini, tra cui studi di espressione genica di virulenza, analisi delle attività metaboliche e condizioni di coltura e conservazione adeguate. Per l'analisi successiva, le colture durante la notte dovrebbero essere elaborate nel tronco tardivo fino alla fase stazionaria iniziale di crescita (12-16 h) per massimizzare la crescita cellulare ma mantenere l'integrità cellulare.

Le condizioni di coltura per ceppi di biotipo classico e El Tor sono simili, tuttavia, all'analisi dell'espressione genica di virulenza in V. Il colerae richiede condizioni biotipo-specifiche che inducono la virulenzaRef "> 19. I due principali fattori di virulenza TC e TCP sono controllati dal regolatore master ToxT e sono espressi in condizioni ottimali in condizioni di crescita specifiche, ad esempio, in condizioni di indotta virulenza El Tor Le condizioni di ToxT possono essere analizzate trattando intero estratto cellulare WCE), o il pellet di cellule a 3,5 h, mentre l'espressione TC e TCP può essere analizzata lavorando il supernatante senza cellule e WCE a 7,5 h rispettivamente 8 , 20. I tratti genotipici e fenotipici variati mostrati in questo manoscritto indicano come Diversi biotipi di colera V possono essere e illustrare la necessità di un'alternativa alla caratterizzazione biotipale di un solo assaggio.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori non hanno niente da rivelare.

Acknowledgements

Ricerca sostenuta da New Hampshire-INBRE attraverso un Premio di Sviluppo Istituzionale (IDeA), P20GM103506, presso l'Istituto Nazionale delle Scienze Mediche Generali del NIH.

Materials

Name Company Catalog Number Comments
1 kb DNA Ladder New England Biolabs N3232S https://www.neb.com/products/n3232-1-kb-dna-ladder
60% Glycerol Calbiochem 356352 http://www.emdmillipore.com/US/en/product/Glycerol%2C-Molecular-Biology-Grade---CAS-56-81-5---Calbiochem,EMD_BIO-356352
Agar Becto, Dickinson and Co. 214030 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=214030&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D214030%26typeOfSearch%3DproductSearch
Agar with brain-heart infusion Becto, Dickinson and Co. 237500 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=237500&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D237500%26typeOfSearch%3DproductSearch
Agarose Peqlab 732-2789 https://de.vwr.com/store/catalog/product.jsp?catalog_number=732-2789&_DARGS=/store/cms/de.vwr.com/de_DE/header_2016111711383215.jsp_AF&_dynSessConf=1766917479792147141&targetURL=/store/catalog/product.jsp%3Fcatalog_number%3D732-2789&lastLanguage=en&/vwr/userprofiling/EditPersonalInfoFormHandler.updateLocale=&_D%3AcurrentLanguage=+&currentLanguage=en&_D%3AlastLanguage=+&_D%3A/vwr/userprofiling/EditPersonalInfoFormHandler.updateLocale=+
Anhydrous K2HPO4 Fisher Scientific P288-500 https://www.fishersci.com/shop/products/potassium-phosphate-dibasic-anhydrous-crystalline-powder-certified-acs-fisher-chemical-5/p288500?searchHijack=true&searchTerm=P288500&searchType=RAPID
Blood Agar Plates Remel R01200 Store at 4 °C;  http://www.remel.com/Catalog/Item.aspx?name=Blood+Agar
Boric Acid Fisher Scientific A73-500 https://www.fishersci.com/shop/products/boric-acid-crystalline-certified-acs-fisher-chemical-6/a73500?searchHijack=true&searchTerm=A73500&searchType=RAPID
Bromothymol Blue Fisher Scientific B388-10 https://www.fishersci.com/shop/products/bromothymol-blue-certified-acs-fisher-chemical/b38810?searchHijack=true&searchTerm=B38810&searchType=RAPID
Cirtric acid ·H2O Fisher Scientific S72836-3 https://www.fishersci.com/shop/products/citric-acid-monohydrate-4/s728363#?keyword=s728363
Deoxynucleotide (dNTP) Solution Kit New England Biolabs N0446S Store at -20 °C;  https://www.neb.com/products/n0446-deoxynucleotide-solutionset
Disodium EDTA Fisher Scientific S311-500 https://www.fishersci.com/shop/products/ethylenediaminetetraacetic-acid-disodium-salt-dihydrate-crystalline-certified-acs-fisher-chemical-7/s311500?searchHijack=true&searchTerm=S311500&searchType=RAPID
DNA Clean & Concentrator™ -25 Kit Zymo Research D4007 http://www.zymoresearch.com/dna/dna-clean-up/zymoclean-gel-dna-recovery-kit
GelGreen Nucleic Acid Stain Biotium 41005 https://biotium.com/product/gelgreentm-nucleic-acid-gel-stain-10,000x-in-water/
Genesys 10SUV-VIS Spectrophotometer Thermo Scientific 840-208100 https://www.thermofisher.com/order/catalog/product/840-208100?ICID=search-840-208100
Gentra Puregene Yeast/Bact. Kit Qiagen 158567 https://www.qiagen.com/us/shop/sample-technologies/dna/dna-preparation/gentra-puregene-yeastbact-kit/#orderinginformation
HCl Fisher Scientific A144-212 Corrosive;  https://www.fishersci.com/shop/products/hydrochloric-acid-certified-acs-plus-fisher-chemical-10/a144212?searchHijack=true&searchTerm=A144212&searchType=RAPID
KCl Fisher Scientific P217-500 https://www.fishersci.com/shop/products/potassium-chloride-crystalline-certified-acs-fisher-chemical-4/p217500?searchHijack=true&searchTerm=P217500&searchType=RAPID
KH2PO4 Fisher Scientific P285-500 https://www.fishersci.com/shop/products/potassium-phosphate-monobasic-crystalline-certified-acs-fisher-chemical-5/p285500?searchHijack=true&searchTerm=P285500&searchType=RAPID
KOH Fisher Scientific P250-500 https://www.fishersci.com/shop/products/potassium-hydroxide-pellets-certified-acs-fisher-chemical-5/p250500?searchHijack=true&searchTerm=P250500&searchType=RAPID
Le Loop Decon Labs Inc. MP190-25 http://deconlabs.com/products/leloop/
Le Stab Decon Labs Inc. MP186-5 http://deconlabs.com/products/lestab/
MgSO4·7H2O Fisher Scientific M63-500 https://www.fishersci.com/shop/products/magnesium-sulfate-heptahydrate-crystalline-certified-acs-fisher-chemical-3/m63500?searchHijack=true&searchTerm=M63500&searchType=RAPID
Mini-Sub Cell GT Horizontal Electrophoresis System Bio Rad Labs 1704406 http://www.bio-rad.com/en-us/product/mini-sub-cell-gt-cell?WT.srch=1&WT.mc_id=aw-cbb-NA-sub_cell_systems_brand_gold&WT.knsh_id=7eb1981f-a011-42a3-aece-1236ff453373
MR-VP Broth Difco 216300 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=216300&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3Dmr-vp%2Bmedium%26typeOfSearch%3DproductSearch
Na2HPO4 Fisher Scientific S374-500 https://www.fishersci.com/shop/products/sodium-phosphate-dibasic-anhydrous-granular-powder-certified-acs-fisher-chemical-5/s374500?searchHijack=true&searchTerm=S374500&searchType=RAPID
NaCl Fisher Scientific S271-10 https://www.fishersci.com/shop/products/sodium-chloride-crystalline-certified-acs-fisher-chemical-6/s27110?searchHijack=true&searchTerm=S27110&searchType=RAPID
NaHCO3 Fisher Scientific S233-500 https://www.fishersci.com/shop/products/sodium-bicarbonate-powder-certified-acs-fisher-chemical-5/s233500?searchHijack=true&searchTerm=S233500&searchType=RAPID
NaNH4HPO4·4H2O Fisher Scientific S218-500 https://www.fishersci.com/shop/products/sodium-ammonium-phosphate-tetrahydrate-crystalline-certified-fisher-chemical/s218500?searchHijack=true&searchTerm=S218500&searchType=RAPID
NanoDrop Lite Spectrophtometer Thermo Scientific ND-LITE-PR https://www.thermofisher.com/order/catalog/product/ND-LITE-PR?ICID=search-ND-LITE-PR
Nonfat dry milk Nestle Carnation N/A N/A
Peptone Becto, Dickinson and Co. 211677 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=211677&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D211677%26typeOfSearch%3DproductSearch
Petri Dishes (100 mm x 15 mm) Fisher Scientific FB0875712 https://www.fishersci.com/shop/products/fisherbrand-petri-dishes-clear-lid-12/fb0875712#?keyword=FB0875712
Petri Dishes (150 mm x 15 mm) Fisher Scientific FB0875714 https://www.fishersci.com/shop/products/fisherbrand-petri-dishes-clear-lid-12/fb0875714?searchHijack=true&searchTerm=FB0875714&searchType=RAPID
Polymyxin B sulfate salt Sigma-Aldrich P1004-10MU Store at 2-4 °C; http://www.sigmaaldrich.com/catalog/product/sial/p1004?lang=en&region=US
Taq DNA Polymerase New England Biolabs M0273S Store at -20 °C; https://www.neb.com/products/m0273-taq-dna-polymerase-with-standard-taq-buffer
Taq Reaction Buffer New England Biolabs M0273S Store at -20 °C;  https://www.neb.com/products/m0273-taq-dna-polymerase-with-standard-taq-buffer
Thermal Cycler Bio-Rad C1000 Touch™  Bio Rad Labs 1840148 http://www.bio-rad.com/evportal/evolutionPortal.portal?_nfpb=true&_pageLabel=search_page&sfMode=search&sfStartNumber=1&clearQR=true&js=1&searchString=1840148&database=productskus+productcategories+productdetails+abdProductDetails+msds+literatures+inserts+faqs+downloads+webpages+assays+genes+pathways+plates+promotions&tabName=DIVISIONNAME
Triphenyltetrazolium chloride Alfa Aesar A10870 https://www.alfa.com/en/catalog/A10870/
Tris Base Fisher Scientific BP152-1 https://www.fishersci.com/shop/products/tris-base-white-crystals-crystalline-powder-molecular-biology-fisher-bioreagents-7/bp1521?searchHijack=true&searchTerm=BP1521&searchType=RAPID
Tryptone Becto, Dickinson and Co. 211705 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=211705&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D211705%26typeOfSearch%3DproductSearch
Yeast Extract Becto, Dickinson and Co. 212750 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=212750&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D212750%26typeOfSearch%3DproductSearch
α-napthol MP Biomedicals 204189 http://www.mpbio.com/product.php?pid=05204189

DOWNLOAD MATERIALS LIST

References

  1. Shimada, T., et al. Extended serotyping scheme for Vibrio cholerae. Curr. Microbiol. 28, (3), 175-178 (1994).
  2. Yamai, S., Tadayuki, O., Toshio, S., Yasuji, K. Distribution of serogroups of Vibrio cholerae non-O1 non-O139 with specific reference to their ability to produce cholera toxin, and addition of novel serogroups. Jpn. J. Infect. Dis. 71, (10), 1037-1045 (1997).
  3. Karaolis, D. K., Lan, R., Reeves, P. R. The sixth and seventh cholera pandemics are due to independent clones separately derived from environmental, nontoxigenic, non-O1 Vibrio cholerae. J. Bacteriol. 177, (11), 3191-3198 (1995).
  4. Albert, M. J., et al. Large epidemic of cholera-like disease in Bangladesh caused by Vibrio cholerae O139 synonym Bengal. Lancet. 342, (8868), 387 (1993).
  5. Barua, D. History of Cholera. Cholera. Barua, D., Greenough III, W. B. Plenum Publishing Corporation. 1-36 (1992).
  6. Morales, R., Delgado, G., Cravioto, A. Population Genetics of Vibrio cholerae. Vibrio cholerae-Genomics and Molecular Biology. Faruque, S. M., Nair, G. B. Caister Academic Press. 29-47 (2008).
  7. Samadi, A. R., Chowdhury, M. K., Huq, M. K., Khan, M. U. Seasonality of classical and El Tor cholera in Dhaka, Bangladesh: 17-year trends. Trans. R. Soc. Trop. Med. Hyg. 77, (6), 853-856 (1983).
  8. Son, M. S., Megli, C. J., Kovacikova, G., Qadri, F., Taylor, R. K. Characterization of Vibrio cholerae O1 El Tor biotype variant clinical isolates from Bangladesh and Haiti, including a molecular genetic analysis of virulence genes. J. Clin. Microbiol. 49, (11), 3739-3749 (2011).
  9. Ghosh-Banerjee, J., et al. Cholera toxin production by the El Tor variant of Vibrio cholerae O1 compared to prototype El Tor and classical biotypes. J. Clin. Microbiol. 48, (11), 4283-4286 (2010).
  10. Ansaruzzaman, M., et al. The Mozambique cholera vaccine demonstration project coordination group. Cholera in Mozambique, variant of Vibrio cholerae. Emerg. Infect. Dis. 10, (11), 2057-2059 (2004).
  11. Ansaruzzaman, M., et al. Genetic diversity of El Tor strains of Vibrio cholerae O1 with hybrid traits isolated from Bangladesh and Mozambique. Int. J. Med. Microbiol. 297, (6), 443-449 (2007).
  12. Lan, R., Reeves, P. R. Pandemic spread of cholera: genetic diversity and relationships within the seventh pandemic clone of Vibrio cholerae determined by amplified fragment length polymorphism. J. Clin. Microbiol. 40, (1), 172-181 (2002).
  13. Nair, G. B., Faruque, S. M., Bhuiyan, N. A., Kamruzzaman, M., Siddique, A. K., Sack, D. A. New variants of Vibrio cholerae O1 biotype El Tor with attributes of the classical biotype from hospitalized patients with acute diarrhea in Bangladesh. J. Clin. Microbiol. 40, (9), 3296-3299 (2002).
  14. Nair, G. B., et al. Isolation of Vibrio cholerae O1 strains similar to pre-seventh pandemic El Tor strains during an outbreak of gastrointestinal disease in an island resort in Fiji. J. Med. Microbiol. 55, (11), 1559-1562 (2006).
  15. Nair, G. B., Mukhopadhyay, A. K., Safa, A., Takeda, Y. Emerging hybrid variants of Vibrio cholerae O1. Vibrio cholerae—Genomics and Molecular Biology. Faruque, S. M., Nair, G. B. Horizon Scientific Press. 179-190 (2008).
  16. Safa, A., et al. Genetic characteristics of Matlab variants of Vibrio cholerae O1 that are hybrids between classical and El Tor biotypes. J. Med. Microbiol. 55, (11), 1563-1569 (2006).
  17. Nusrin, S., et al. Diverse CTX phages among toxigenic Vibrio cholerae O1 and O139 strains isolated between 1994 and 2002 in an area where cholera is endemic. J. Clin. Microbiol. 42, (12), 5854-5856 (2004).
  18. Carignan, B. M., Brumfield, K. D., Son, M. S. Single nucleotide polymorphisms in regulator-encoding genes have an additive effect on virulence gene expression in a Vibrio cholerae clinical isolate. mSphere. 1, (5), e00253 (2016).
  19. Iwanaga, M., Yamamoto, K., Higa, N., Ichinose, Y., Nakasone, N., Tanabe, M. Culture conditions for stimulating cholera toxin production by Vibrio cholerae O1 El Tor. Microbiol. Immunol. 30, (11), 1075-1083 (1986).
  20. DiRita, V. J., Claude, P., Georg, J., Mekalanos, J. J. Regulatory cascade controls virulence in Vibrio cholerae. Proc. Natl. Acad. Sci. USA. 88, (12), 5403-5407 (1991).
  21. Kovacikova, G., Lin, W., Skorupski, K. Duel regulation of genes involved in acetoin biosynthesis and motility/biofilm formation by the virulence activator AphA and the acetate-responsive Lys-R type regulator AlsR in Vibrio cholerae. Mol. Microbiol. 57, (2), 420-433 (2005).
  22. Vogel, H. J., Bonner, D. M. Acetylornithinase of Escherechia coli: partial purification and some properties. J. Biol. Chem. 218, (1), 97-106 (1956).
  23. Son, M. S., Taylor, R. K. Genetic screens and biochemical assays to characterize Vibrio cholerae O1 biotypes: classical and El Tor. Curr. Protoc. Microbiol. 6A.2.1-6A.2.17 (2011).
  24. Kovacikova, G., Skorupski, K. Regulation of virulence gene expression in Vibrio cholerae by quorum sensing: HapR functions at the aphA promoter. Mol. Microbiol. 46, (4), 1135-1147 (2002).
  25. Wang, Y., et al. The prevalence of functional quorum-sensing systems in recently emerged Vibrio cholerae toxigenic strains. Environ. Microbiol. Rep. 3, (2), 218-222 (2011).
  26. Sanders, E. R. Aseptic laboratory techniques. J. Vis. Exp. (63), e3064 (2012).
  27. Martinez, R. M., Megli, C. J., Taylor, R. K. Growth and laboratory maintenance of Vibrio cholerae. Curr. Protoc. 6A.1.1-6A.1.6 (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics