جيل من الفئران المعدلة وراثيا من خلال ميكروينجكتيون من البويضات

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

يستخدم حقن ميكروينجكتيون من البويضات الماوس لكل من ترانسجينيسيس الكلاسيكية ( أي التكامل العشوائي للجينات المحورة وراثيا) و كريسبر بوساطة استهداف الجينات. هذا البروتوكول يستعرض أحدث التطورات في ميكروينجكتيون، مع التركيز بشكل خاص على مراقبة الجودة واستراتيجيات التنميط الجيني.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Delerue, F., Ittner, L. M. Generation of Genetically Modified Mice through the Microinjection of Oocytes. J. Vis. Exp. (124), e55765, doi:10.3791/55765 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

وقد ساهم استخدام الفئران المعدلة وراثيا بشكل كبير في الدراسات على كل من الفسيولوجية والمرضية في عمليات الجسم الحي . حقن برونوكلار من التعبير الحمض النووي يبني في البويضات المخصبة لا يزال الأسلوب الأكثر شيوعا لتوليد الفئران المعدلة وراثيا ل أوفيركسريسيون. مع إدخال تكنولوجيا كريسبر لاستهداف الجينات، وقد تم تمديد حقن برونوكلار في البويضات المخصبة لتوليد كل من خروج المغلوب والفئران نوكين. ويصف هذا العمل إعداد الحمض النووي للحقن وتوليد أدلة كريسبر لاستهداف الجينات، مع التركيز بشكل خاص على مراقبة الجودة. إجراءات التنميط الجيني المطلوبة لتحديد المؤسسين المحتملين أمر بالغ الأهمية. وترد في هذا التقرير استراتيجيات مبتكرة للتنميط الجيني تستفيد من قدرات "تعدد الإرسال" في نظام كريسبر. كما يتم تحديد الإجراءات الجراحية. معا، فإن خطوات البروتوكول تسمح لتوليد جينالفئران المعدلة إيكاليا ولإنشاء لاحق من مستعمرات الماوس لمجموعة كبيرة من مجالات البحث، بما في ذلك علم المناعة، علم الأعصاب، والسرطان، وعلم وظائف الأعضاء، والتنمية، وغيرها.

Introduction

وكانت النماذج الحيوانية، سواء في الفقاريات واللافقاريات، مفيدة لفحص الفيزيولوجيا المرضية للظروف البشرية مثل مرض الزهايمر 1 ، 2 . وهي أيضا أدوات لا تقدر بثمن للبحث عن معدلات المرض وتطوير استراتيجيات العلاج الجديدة في نهاية المطاف على أمل العلاج. على الرغم من أن كل نموذج له قيود جوهرية، واستخدام الحيوانات والنماذج النظامية بأكملها أمر حيوي للبحوث الطبية الحيوية. وذلك لأن البيئة الفسيولوجية الأيضية والمعقدة لا يمكن محاكاة تماما في زراعة الأنسجة.

حتى الآن، لا يزال الفأر أنواع الثدييات الأكثر شيوعا المستخدمة في التلاعب الجيني لأنه يتميز العديد من المزايا. يتم حفظ العمليات الفسيولوجية والجينات المرتبطة بالأمراض بشكل كبير بين الفئران والبشر. كان الفأر أول حيوان ثديي له تسلسله الكامل للجينوم (2002)، قبل سنة واحدة من الجين البشريلي (2003). وبصرف النظر عن هذه الثروة من المعلومات الوراثية، والفأر لديه قدرات تربية جيدة، دورة تنمية سريعة (6 أسابيع من الإخصاب إلى الفطام)، وحجم معقول. كل هذه المزايا، إلى جانب المؤشرات الفسيولوجية، مثل الألوان معطف متميزة (المطلوبة لاستراتيجيات عبور)، وجعل الماوس نموذجا جذابا للتلاعب الجيني. ومن الجدير بالذكر أنه في سن مبكرة جدا من علم الوراثة الحديثة، بدأ جريجور مندل العمل على الفئران قبل الانتقال إلى النباتات 3 .

وأسفرت تقنيات نقل الجينات عن توليد الفأرة المعدلة وراثيا الأولى على مدى ثلاثة عقود مضت 4 ، التي تم إنشاؤها في البداية باستخدام الولادة الفيروسية. ومع ذلك، سرعان ما أدرك الباحثون أن واحدة من التحديات الرئيسية للالترانزجينيس الماوس هو عدم القدرة على السيطرة على مصير الحمض النووي خارجي. لأن التسليم الفيروسي من الجينات المحورة في البويضات الماوس أدى إلى نسخ متعددة متكاملة بشكل عشوائي في الجينوم، و بوسيبيليتذ من إنشاء خطوط المعدلة وراثيا اللاحقة كان محدودا.

تم التغلب على أحد هذه القيود عندما غوردون وآخرون. ولدت أول خط الماوس المعدلة وراثيا بواسطة ميكروينجكتيون 5 ، 6 . بدأ هذا عصر تكنولوجيا الحمض النووي المؤتلف، والمعلمات التي تؤثر على نتائج جلسة ميكروينجكتيون وقد درست على نطاق واسع 7 . على الرغم من أن ميكروينجكتيون لا يسمح للسيطرة على موقع التكامل من التحوير (الذي يؤدي في نهاية المطاف إلى مستويات التعبير محددة لكل مؤسس الماوس)، والميزة الرئيسية لل ميكروينجكتيون برونوكلار يبقى تشكيل المحاور ( أي صفائف من نسخ متعددة من التحوير، مرتبطة في سلسلة) قبل التكامل الجيني 5 . وقد استخدمت هذه الخاصية على مر السنين لإنشاء الآلاف من خطوط الماوس المعدلة وراثيا التي أوفيركسريس الجين من الفائدة. ومنذ ذلك الحين، ترانسجينيسيس، والتعديل الجيني لجينوم الكائن الحي، وقد استخدم على نطاق واسع لتحديد دور الجينات واحدة في حدوث الأمراض.

تم تحقيق إنجاز رئيسي آخر في التلاعب الجينوم الماوس عندما ماريو كابيتشي تعطل بنجاح الجين واحد في الماوس، وفتح عصر الجينات استهداف 8 . ومع ذلك، ظهرت العيوب الرئيسية بسرعة من الخلايا الجذعية المستندة إلى الخلايا الجذعية المستقرة، بما في ذلك تحديات زراعة الخلايا الجذعية السرطانية، ودرجة متغير نوعا ما من الخيمرية، وطول العملية ( أي 12-18 شهرا، والحد الأدنى، للحصول على الماوس) .

في الآونة الأخيرة، ظهرت أوجه التقدم في التكنولوجيات الجديدة، مثل إندونوكليسيس المهندسة (على سبيل المثال، نوكليسيس الإصبع الزنك (زفن)، النسخ المنشط مثل نوكليسيس المستجيب (تالين)، وتجمعات منتظمة متداخلة قصيرة متداخلة قصيرة (كريسبر / Cas9)) كطرق بديلة ل وتسريع عملية استهداف الجينات في هيئة التصنيع العسكريe 9 ، 10 . يمكن حقن هذه إندونوكليس بسهولة في البويضات الماوس عن طريق ميكروينجكتيون، مما يسمح لتوليد الفئران المستهدفة الجينات في اقل من 6 أسابيع.

منذ التقرير الأول عن استخدام كريسبر لتحرير الجينوم 11 ، هذا الجهاز المناعي التكتيكي الجرثومي قد حل محل زفن و تالين بسبب العديد من المزايا، بما في ذلك سهولة التوليف والقدرة على استهداف موقع متعدد في وقت واحد (المشار إليها باسم "تعدد الإرسال "). تم استخدام كريسبر لأول مرة لاستهداف الجينات في الفئران 12 ومنذ ذلك الحين تم تطبيقها على عدد لا يحصى من الأنواع، من النباتات إلى البشر 13 ، 14 . وحتى الآن، لا يوجد تقرير عن نوع واحد مقاوم لتحرير الجينوم كريسبر.

اثنين من الخطوات الرئيسية المحددة لتوليد الفئران المعدلة وراثيا هي حقن البويضات وإعادة زرعمن هذه البويضات في الإناث الحوامل الزائفة. على الرغم من أن هذه التقنية قد وصفها لنا 15 وآخرون 16 ، والتحسينات التقنية الأخيرة في علم الأجنة الماوس وتقنيات نقل الجينات ثورة في عملية توليد الفئران المعدلة وراثيا. وسيتم وصف هذه التحسينات هنا.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

وقد تمت الموافقة على جميع الإجراءات من قبل جامعة نيو ساوث ويلز رعاية الحيوانات والأخلاقيات اللجنة.

1. إعداد التحوير (التكامل العشوائي)

  1. تحليلي أغاروس هلام الكهربائي.
    1. هضم البلازميد لاستخراج التحوير باستخدام الانزيمات المناسبة (1 ساعة حضانة) أو سريع الهضم الإنزيمات (15 إلى 30 دقيقة الحضانة) في ثيرمويكلر بعد توصيات الشركة الصانعة (انظر الشكل 2A وأسطوره).
    2. يلقي حمض 1٪ تريس أسيتات-إثيلينديامينيتتراسيتيك حمض (إدتا) (تي) أغاروس هلام، ملطخة 0.5-1.0 ميكروغرام / مل إيثيديوم بروميد (إتبر).
      ملاحظة: توخي الحذر عند استخدام إيتبر؛ بل هو طفرات قوية. يرجى استخدام معدات الوقاية الشخصية المناسبة (راجع ورقة بيانات سلامة المواد).
    3. تحميل 1 كيلوبايت علامة الوزن الجزيئي.
    4. تحميل شظايا الخطية ( أي التحوير والعمود الفقري). تشغيل الكهربائي في 100 V لمدة 45 دقيقة.
    5. تصور هلام على الأشعة فوق البنفسجية ترانسيلوميناتور للتحقق من أن عملية الهضم كاملة وتأكيد الحجم الصحيح للتحوير ( أي 7،338 نقطة أساس، انظر الشكل 2A ).
  2. استعداد أغاروس هلام الكهربائي.
    1. يلقي هلام الاغاروز تاي 1٪ ملطخة مع انخفاض سمية هلام وصمة عار. تحميل 8 أليكوتس (1 ميكروغرام لكل منهما) من التحوير الخطي دون علامة الوزن الجزيئي وتشغيل الكهربائي في 100 V لمدة 45 دقيقة. استخدام مشرط لاستئصال جميع 8 نطاقات المقابلة للتحوير الخطي.
    2. استخراج الحمض النووي باستخدام مجموعة استخراج هلام باتباع توصيات الشركة المصنعة (انظر جدول المواد ).
      1. تذوب شظايا هلام في 50 درجة مئوية في أنابيب 1.5 مل لمدة 15 دقيقة على الأقل. يعجل ذلك مع الأيزوبروبانول ومن ثم إضافة العازلة ملزمة.
      2. الجمع بين كامل Dنا بواسطة بيبتينغ كل ذلك في عمود واحد. أزل في نوكليس خالية من العازلة ميكروينجكتيون (8 ملي تريس-حمض الهيدروكلوريك و 0.15 ملي إدتا). تصفية من خلال مرشح ميكروسنتريفوج 0.22 ميكرون وأجهزة الطرد المركزي لمدة 60 ثانية في 12000 x ز.
    3. قياس تركيز ونوعية الحمض النووي باستخدام الطيفي. تحقق من أن نسبة A260 / A280 حوالي 1.8 ( أي عدم وجود تلوث بالبروتينات) ونسبة A260 / A230 هي 2.0 على الأقل ( أي لا تلوث بالمذيبات العضوية). تمييع وصولا الى 3 نانوغرام / ميكرولتر في المخزن ميكروينجكتيون خالية من نوكليس، قسامة (20-50 ميكرولتر)، وتجميد في -20 درجة مئوية.

2. توليف مكونات كريسبر (استهداف الجينات)

  1. Cas9 مرنا.
    1. تمييع مرنا Cas9 (تم الحصول عليها من مصدر تجاري، انظر جدول المواد ) إلى تركيز 1 ميكروغرام / ميكرولتر في المخزن المؤقت ميكروينجكتيون خالية من نوكليس.
    2. قسامة في 2 ميكرولتر وخالية زي في -80 درجة مئوية.
  2. دليل واحد رنا (سغرنا).
    1. تحديد تسلسل الجينوم المطلوب (الهدفين) المطلوبين باستخدام أداة تصميم حسابية تسمح الحد الأدنى من النشاط المحتمل خارج الهدف 17 .
      1. ل خروج المغلوب الجيني، واختيار منهجي اثنين دليل يقع بضع مئات من أزواج قاعدة (بب) وبصرف النظر، في اتجاهات متعاكسة، وتشمل كودون بدء الجين من الفائدة. للحصول على التماثل إصلاح مباشر، حدد اثنين من أدلة متداخلة (كلما كان ذلك ممكنا)، في اتجاهات متعاكسة.
        ملاحظة: كمثال على ذلك، وقد تم مؤخرا بنجاح شارك في حقن أدلة التالية لتعطيل أول اكسون الجين TPM4.2 :
        الدليل 1: 5 'سغكاتسكاغتكغتك 3'؛
        الدليل 2: 5 'كاغاسغتاغكاتغك 3'
    2. طلب مجموعة من الاشعال كما هو موضح في الجدول 1 .
    3. توليف قالب الحمض النووي الخطي.
      1. تمييع px330ريف "> 12 البلازميد إلى 10 نانوغرام / ميكرولتر في المياه خالية من نوكليس.
      2. إعداد مزيج الرئيسي كما هو مبين في الجدول 1 . إضافة البلمرة في نهاية والحفاظ على مزيج الرئيسي على الجليد.
      3. مزيج وتقسيم هذا إلى 8 أنابيب ير (19 ميكرولتر / أنبوب). إضافة 1 ميكرولتر من px330 لكل أنبوب وتشغيل ير في ظل الظروف التالية: 1 دقيقة في 98 درجة مئوية. 40 دورة من 98 درجة مئوية لمدة 10 ثانية، 64 درجة مئوية لمدة 30 ثانية، و 72 درجة مئوية لمدة 15 ثانية. واستطالة النهائية عند 72 درجة مئوية لمدة 5 دقائق. عقد في 4 درجات مئوية.
      4. تنقية المنتجات ير باستخدام عدة تنقية ير (انظر جدول المواد )، مشعب، ومصدر فراغ (لمعالجة أسرع). تطبيق أقصى قوة فراغ ( أي 8 ميغا بار).
        1. إضافة 5 مجلدات (100 ميكرولتر) من العازلة ملزمة إلى 1 حجم عينة ير والمزيج.
        2. وضع (المقدمة) غشاء السيليكا تدور العمود في (المقدمة) 2-مل أنبوب جمع الطرد المركزي، أو على مشعب لعملية فراغجي. لربط الحمض النووي، على التوالي تطبيق جميع العينات 8 إلى العمود والفراغ أو أجهزة الطرد المركزي لمدة 60 ثانية في 12000 x ج لكل حمولة.
        3. لغسل، إضافة 0.75 مل من غسل العازلة (العازلة بي) إلى العمود والفراغ أو أجهزة الطرد المركزي لمدة 60 ثانية في 12000 x ز. الطرد المركزي العمود لمدة 60 ثانية في 12000 x ج للقضاء على الإيثانول المتبقية.
        4. وضع العمود في أنبوب ميكروسنتريفوج 1.5 مل نظيفة. أزل الحمض النووي، إضافة 30 ميكرولتر من نوكليس خالية من المياه إلى مركز الغشاء، والسماح للعمود الوقوف لمدة 1 دقيقة، وأجهزة الطرد المركزي لمدة 60 ثانية في 12،000 ز.
      5. قياس تركيز باستخدام الطيف. عادة، ينبغي أن يكون تركيز 100 نانوغرام / ميكرولتر أو أعلى. تحقق من أن نسبة A260 / A280 حوالي 1.8 ( أي عدم وجود تلوث بالبروتينات) ونسبة A260 / A230 هي 2.0 على الأقل ( أي لا تلوث بالمذيبات العضوية).
    4. في المختبر النسخ باستخدام T7 رنا عدة التوليف.
      1. إعداد tانه مزيج الرئيسي، كما هو مبين في الجدول 1 ، واحتضان لمدة 3 ساعات عند 37 درجة مئوية في ثيرمويكلر. إضافة 28 ميكرولتر من نوكليس خالية من المياه و 2 ميكرولتر من الدناز الأول واحتضان لمدة 15 دقيقة أخرى عند 37 درجة مئوية في ثيرمويكلر.
    5. تنقية الحمض النووي الريبي باستخدام الأعمدة تدور.
      1. حل مسحوق الواردة في العمود تدور المقدمة في 650 ميكرولتر من العازلة ميكروينجكتيون خالية من نوكليس، إزالة بعناية جميع فقاعات الهواء. كاب الأنبوب والهيدرات لمدة 5 - 15 دقيقة في درجة حرارة الغرفة.
      2. إزالة الغطاء الأزرق في الجزء السفلي ووضع العمود في أنبوب 2 مل. أجهزة الطرد المركزي لمدة 2 دقيقة في 750 x ج ودرجة حرارة الغرفة. وضع العمود في أنبوب 1.5 مل الطازجة وتطبيق 50 ميكرولتر من الحمض النووي الريبي حل قطرة قطرة إلى المركز، دون لمس جدار العمود. تدور العمود لمدة 2 دقيقة في 750 × ز.
      3. قياس تركيز الحمض النووي الريبي باستخدام مطياف (العائد النموذجي من رد فعل واحد هو 30 - 50 ميكروغرام). تحقق من أن نسبة A260 / A280 هي a( أي أي تلوث بالبروتينات) ونسبة A260 / A230 هي 2.0 على الأقل ( أي عدم وجود تلوث بالمذيبات العضوية). تخزين سغرناس في -80 درجة مئوية حتى الاستخدام.
      4. تقييم نوعية الحمض النووي الريبي باستخدام المواد الهلامية تاي 1٪ تستخدم بشكل روتيني لالدنا الكهربائي. تشغيل 200-400 نانوغرام من قالب الحمض النووي و سغرنا المقابلة بالتوازي. يجب أن تكون الفرقة رنا (≈ 100 بب) أكبر قليلا من الفرقة دنا (انظر الشكل 3A ).

3. نموذج المانح

  1. ترتيب أوليغونوكلأوتيدس تقطعت بهم السبل تجاريا (سوليغوس، انظر جدول المواد ) لطفرات نقطة أو لدمج متواليات صغيرة تصل إلى 50 نقطة أساس. وعادة ما تكون الأسلحة التماثل 60-90 بي بي طويلة.
  2. لإدخال أكبر، استخدام البلازميد المانحة كقالب. توليد البلازميد المناسبة إما باستخدام أسلوب الاستنساخ الكلاسيكي أو توليف دي نوفو من أمصدر تجاري.
    ملاحظة: يوصى بحد أدنى 800 بيب لذراع التماثل. حجم العمود الفقري ليس له تأثير على كفاءة إصلاح التشابه المباشر (هر).

4. حقن ميكس

  1. تمييع مرنا Cas9 إلى 50 نانوغرام / ميكرولتر و سغرناس إلى 12.5 نانوغرام / ميكرولتر (25 نانوغرام / ميكرولتر في المجموع) باستخدام نوكلياز خالية من ميكروينجكتيون العازلة للتجارب خروج المغلوب الجينات. إضافة قالب المانحة (سوليغو أو البلازميد) بتركيز 200 نانوغرام / ميكرولتر لتجارب التحرير الجينوم على أساس التماثل إصلاح مباشر.
    ملاحظة: يمكن تحديد أحجام التخفيف بسهولة باستخدام أدوات الإنترنت، مثل آلة حاسبة ريسوسبنسيون 18 .
  2. الحفاظ على كل قسامة على الجليد خلال جلسة ميكروينجكتيون وتجاهل بعد ذلك (لا إعادة تجميد مزيج الحقن).

5. كيس الصفن

ملاحظة: يتم تنفيذ نوعين من استئصال الأسهر عادة في الفئران: البطن والصفن. الأخيرهو أقل الغازية وقد سبق وصفها 15 .

  1. الأوتوكلاف جميع الأدوات الجراحية الفولاذ المقاوم للصدأ.
  2. تحديد وزن الماوس باستخدام مقياس وزن وتخدير الذكور عن طريق الحقن داخل الصفاق (إب) مع التخدير عن طريق الحقن (الكيتامين 100 ملغ / كغ، زيلازين 10 ملغ / كلغ).
  3. رصد فقدان اصبع القدم منعكس قرصة ومرة ​​واحدة هو مكان مسكن الماوس على رأس وسادة التدفئة.
  4. تطهير الجلد حول الخصيتين مع المناديل بالتناوب من مطهر موضعي مثل الكلورهيكسيدين و 70٪ من الإيثانول.
  5. دفع الخصيتين في كيس كيس الصفن وجعل شق الجلد مع مشرط.
  6. تصور الخصية، ذئبة البربخ، والأسهر.
  7. الاستيلاء على الأسهر مع ملقط، عقده، ويكوى على كل جانب من ملقط لإزالة 3 ملم من الأسهر.
  8. إجراء نفس الإجراء على الخصية الثانية.
  9. إغلاق شقوق الجلد مع مقاطع الجرح ومراقبةالماوس عن كثب حتى الانتعاش الكامل.

6. سوبيروفولاتيون (البويضات المانحين) والتزاوج الوقت (الزائفة الحوامل الإناث)

ملاحظة: تم وصف تقنية لتوليد عدد مناسب من البويضات المخصبة وتوصيل الإناث الحاضنة لإعادة زرع في مكان آخر 15 .

  1. حقن 10 الإناث الملكية الفكرية مع 5 وحدة دولية من الحوامل الغدد التناسلية المصل فرس (بمسغ؛ في 100 ميكرولتر) في حوالي 12 مساء في يوم 1.
  2. حقن الإناث إب مع 5 وحدة دولية من موجهة الغدد التناسلية المشيمية البشرية (قوات حرس السواحل الهايتية؛ في 100 ميكرولتر) 46-48 ساعة في وقت لاحق (حوالي 11 صباحا في اليوم 3).
  3. تزاوج على الفور الإناث مع الذكور واحد مبيت بين عشية وضحاها.

7. برونوكلار (التكامل العشوائي) والحقن (استهداف جين) الحقن

  1. يفرز الفئران سوبيروفولاتد عن طريق خلع عنق الرحم، وفضح البطن، والوصول إلى المبيض وقنوات البيض، كما هو موضح سابقا 15 . تشريح سفيدوكتس وحصاد المركب البويضة المجمعات (كوك) تحت ستيريوميكورسكوب 15 . وضعها في قطرة من البوتاسيوم البسيط الأمثل المتوسطة تستكمل مع الأحماض الأمينية (كسوما) اتباع الطريقة التقليدية 15 .
  2. تنقية البويضات عن طريق إضافة تقريبا 1 ميكرولتر من هيالورونيداز (10 ملغ / مل) إلى قطرة كسوما المتوسطة باستخدام قطعة الفم الشافطة ووضع الطبق في 37 درجة مئوية / 5٪ كو 2 حاضنة لمدة 30 ثانية إلى 1 دقيقة.
  3. غسل البويضات مع 4 قطرات جديدة من كسوما المتوسطة باستخدام قطعة الفم الشافطة ونقلها إلى الانخفاض النهائي من كسوما المتوسطة مضافين مع الزيوت المعدنية (حوالي 2 مل). وضع الطبق في 37 درجة مئوية / 5٪ كو 2 حاضنة حتى البويضات جاهزة للحقن.
  4. حقن برونوكلار (التكامل العشوائي).
    1. تصور البيض تحت المجهر مجسمة ونقل ما يقرب من 50 بيضة إلى غرفة الحقن (دروص من M2 المتوسطة مضافا مع الزيوت المعدنية) باستخدام قطعة الفم الشافطة.
    2. نقل غرفة الحقن إلى المجهر مقلوب وحقن البويضات المخصبة (اثنين نواة مرئية) مع عدد قليل من بيكوليترز من مزيج الحقن، واستهداف نواة (أي من نواة يمكن استهداف). تصور حقن ناجحة من خلال مراقبة تورم في النواة.
  5. الحقن السيتوبلازمية (استهداف الجينات).
    1. نقل ما يقرب من 50 بيضة إلى قطرة من كسوما تحتوي على 5 ميكروغرام / مل سيتوشالاسين B باستخدام قطعة الفم واحتضان لمدة 5 دقائق في 37 درجة مئوية / 5٪ كو 2 حاضنة.
    2. نقل البيض إلى غرفة الحقن باستخدام قطعة الفم.
    3. حقن عدد قليل من بيكوليترز من مزيج الحقن في السيتوبلازم في ضغط منخفض جدا (50-100 هبا)، وذلك باستخدام ضغط التعويض من ميكروينجيكتور الآلي حيثما كان ذلك ممكنا.
    4. بعد الحقن، ونقل البويضات مرة أخرى إلى قطرة من كسوما (باستخدام قطعة الفم) والاحتفاظ بها في 37 درجة مئوية / 5٪ كو 2 حاضنة، حتى تحميل لإعادة زرع في قناة البيض من الإناث الزائفة الحوامل.

8. إعادة زرع

  1. الأوتوكلاف جميع الأدوات الجراحية الفولاذ المقاوم للصدأ.
  2. تحديد وزن الماوس باستخدام مقياس وزن وتخدير الإناث عن طريق الحقن داخل الصفاق (إب) مع التخدير عن طريق الحقن (الكيتامين 100 ملغ / كغ، زيلازين 10 ملغ / كلغ).
  3. رصد فقدان اصبع القدم منعكس قرصة ومرة ​​واحدة هو مكان مسكن الماوس على رأس وسادة التدفئة.
  4. مقطع مساحة كبيرة من الفراء حول خط الوسط الظهرية من الماوس الإناث.
  5. تطهير الجلد المكشوفة مع المناديل بالتناوب من مطهر موضعي مثل الكلورهيكسيدين و 70٪ من الإيثانول.
  6. فضح الجهاز التناسلي التالية الطريقة التقليدية 15 . جعل 1 سم شق الجلد طويلة موازية لخط الوسط الظهرية، وقطع العضلات والاستيلاء على لوحة الدهون وايث ملقط، ثم سحب بلطف المبيض خارج حتى قناة البيض المرفقة والرحم واضحة للعيان.
  7. إصلاح لوحة الدهون مع المشبك السفينة. تصور قناة البيض تحت المجهر مجسمة واستخدام زوج من مقص الصغير جعل شق في جدار قناة البيض بضعة مليمتر المنبع من أمبولة.
  8. تحت المجهر مجسمة، تحميل 25 ميكروينجكتد البيض في الزجاج الشعرية متصلة قطعة الفم (القطر الداخلي للشعيرات الدموية يجب أن يكون حوالي 120 ميكرون واسعة). إدخال الزجاجية الشعرية في قناة البيض وطرد حتى فقاعة الهواء مرئية داخل أمبولة.
  9. إزالة بلطف الشعرية الزجاجية ووضع الجهاز التناسلي مرة أخرى في البطن. خياطة شق مع 3-0 غير قابلة للامتصاص الجراحية الجراحية، ثم إغلاق مع مقاطع الجرح. مراقبة الماوس عن كثب حتى الانتعاش الكامل.

9. استراتيجيات التنميط الجيني / التسلسل

ملاحظة: عزل الجينوميةالحمض النووي من خزعات ذيل 2mm أو الأذن، وفقا لقواعد الأخلاق الحيوانية ذات الصلة.

  1. سريع استخراج الحمض النووي الجيني (التكامل العشوائي).
    1. ليس عينات الأنسجة (~ 2 مم) في 95 درجة مئوية لمدة 1 ساعة في 100 ميكرولتر من كاشف تحلل القلوية (25 ملي هيدروكسيد الصوديوم و 0.2 ملي إدتا، ودرجة الحموضة = 12).
    2. إضافة 100 ميكرولتر من كاشف تحييد (40 ملي تريس، حمض الهيدروكلوريك، ودرجة الحموضة = 5).
    3. أجهزة الطرد المركزي لمدة 5 دقائق في 12،000 ز و 4 درجات مئوية.
  2. عالية الجودة استخراج الحمض النووي الجيني (استهداف الجينات).
    1. إضافة 500 ميكرولتر من العازلة الذيل (50 ملي تريس، ودرجة الحموضة = 8؛ 100 ملي إدتا، ودرجة الحموضة = 8، 100 ملي كلوريد الصوديوم، 1٪ سدز، و 0.5 ملغ / مل بروتين K، الطازجة).
    2. احتضان بين عشية وضحاها في 55 درجة مئوية.
    3. مزيج لمدة 5 دقائق عن طريق عكس (لا دوامة).
    4. إضافة 250 ميكرولتر من كلوريد الصوديوم المشبعة (6 M) وتخلط لمدة 5 دقائق عن طريق عكس (لا الدوامة).
    5. تدور لمدة 5-10 دقيقة في 12000 x ج و 4 درجة مئوية وتصب طاف في أنبوب جديد. إضافة 500 ميكرولتر من الأيزوبروبانول وتخلط لمدة 5 دقائق عن طريق عكس (لا دوامة).
    6. تدور لمدة 10 دقيقة في 12000 زغ ودرجة حرارة الغرفة.
    7. صب طاف (بيليه غير مرئية والعصي على أنبوب).
    8. يغسل مع 1 مل من الايثانول 70٪.
    9. تدور لمدة 5-10 دقيقة في 12000 زغ ودرجة حرارة الغرفة. إزالة طاف مع الرعاية، كما بيليه بيضاء ليست لزجة بعد الآن ويمكن أن تضيع.
    10. الهواء الجاف هذا ~ 1 ساعة.
    11. إضافة 400 ميكرولتر من العازلة تي (10 ملي تريس و 1 ملي إدتا، ودرجة الحموضة = 8).
    12. حل الحمض النووي في 55-60 درجة مئوية لمدة 2 ساعة.
  3. تصميم التمهيدي.
    1. تصميم الاشعال لا يقل عن 20 نقطة أساس طويلة باستخدام أداة حسابية 19 .
      ملاحظة: من أجل التكامل العشوائي، يجب أن التهجين تهجين مع التحوير، وتوليد جزء متميز من 200-800 نقطة أساس. لاستهداف الجينات، تصميم الاشعال بحيث تهجين مع الحمض النووي الجيني، وتوليد و واضحرجمنت بضع مئات من نقاط القوة حول مواقع قطع. بالنسبة للإدخالات الكبيرة، يمكن للبوادر أن تجلس على التحوير، ولكن يجب أن يتم تأكيد التكامل المستهدف بعد ذلك باستخدام التمهيدي المشي أو تقنية مماثلة.
  4. ير التنميط الجيني.
    1. لكل تعديل الجينومية، تصميم بروتوكول ير الجديد واختباره تجريبيا. النظر في طول جزء ولدت ودرجة حرارة انصهار (تم) من كل زوج من الاشعال.
  5. التسلسل.
    1. لاستهداف الجينات، وإرسال المنتجات ير إلى سانجر مزود خدمة التسلسل.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

أدناه، يتم وصف سير العمل ل ميكروينجكتيون في حالة التكامل العشوائي و كريسبر بوساطة استهداف الجينات ( الشكل 1 ).

شكل 1
الشكل 1: سير العمل النموذجي لتوليد الفئران المعدلة وراثيا. للتكامل العشوائي، يتم حقن التحوير المنقى في نواة البويضات المخصبة قبل نقل قناة البيض إلى الإناث الحاضنة موصول. ويتم تحليل النسل عن طريق ير بعد استخراج الحمض النووي الجيني السريع. لاستهداف الجينات كريسبر، يتم تصنيعها سغرناس باستخدام طريقة غير استنساخ وصفها هنا، واثنين من المرشدين وشارك في حقن (جنبا إلى جنب مع مرنا Cas9) في السيتوبلازم من البويضات المخصبة. يتم استخدام هذه الاستراتيجية لتحليل ير القائم على ذرية النسل، الأمر الذي يتطلب تنقية عالية g الحمض النووي. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

على الرغم من أن ميكروينجكتيون من البويضات وإعادة زرع هذه بيض حقن هي اثنين من الخطوات الرئيسية التي تتطلب الحد من المهارات التقنية والتدريب، ونوعية من مزيج الحقن هو من أهمية قصوى لتوليد بنجاح الفئران المعدلة وراثيا. يجب أن تكون نوعية تنقية التحوير ( الشكل 2A ) والتوليف سغرناس ( الشكل 3A ) تقييم منهجي على المواد الهلامية أغاروس التحليلية. وينبغي أيضا فحص الملوثات المحتملة للمزيج عند قياس التركيزات باستخدام مقياس الطيف، حيث تعتمد قيم الاستيعاب المختلفة بشكل مباشر على درجة نقاء المحلول (انظر الخطوات 1.2.3 و 2.2.3.5 و 2.2.5.3).

فو: كيب-together.within-بادج = "1"> وبالمثل، فإن تحديد الفئران المؤسس المحتمل يعتمد اعتمادا كبيرا على استراتيجيات التنميط الجيني المبتكرة. يوضح هذا العمل قراءات نموذجية من جلسة ميكروينجكتيون، سواء للتكامل عشوائي ( الشكل 2B ) واستهداف الجينات ( الشكل 3B ). بروتوكولات استخراج الحمض النووي هي أيضا مختلفة اعتمادا على نوع من التجارب. فإن تقاریر إنجاز المشروعات اللاحقة تعتمد علی الاشعال التي تھجن إما علی التحویلات أو علی الحمض النووي الجیني، علی التوالي. الاستراتيجيات المعروضة هنا تسمح لسهولة استكشاف الأخطاء وإصلاحها وتبسيط كل خطوة المطلوبة لإنتاج الفئران المعدلة وراثيا.

على الرغم من أن النتيجة الكمية للدورة ميكروينجكتيون يختلف اعتمادا على تجربة المجرب، مرة واحدة في كل خطوة من البروتوكول هو الأمثل، يجب أن نسبة الجراء المعدلة وراثيا التي تم الحصول عليها عادة تصل 10-25٪الحصص التموينية، كما هو موضح في الشكل 2B (4 مؤسسين من أصل 15 الجراء ولد = 26.6٪). هذه الكفاءة "منخفضة" إلى حد ما تتناقض مع قدرة موثوقة من مكونات كريسبر لتحرير الجينوم الماوس. في الواقع، فإن عدد المؤسسين المولودين أعلى عموما عند استخدام كريسبر لاستهداف الجينات ويتراوح بين 25-100٪ (انظر الشكل 3B ؛ 3 مؤسسين من أصل 13 الجراء = 23٪). ليس من غير المألوف الحصول على سلالة بأكملها التي هي متماثلة متماثلة بنجاح عندما يتم تحريرها باستخدام كريسبر.

الشكل 2
الشكل 2: مراقبة الجودة واستراتيجية التنميط الجيني للنجاح إنتاج الفئران المعدلة وراثيا ل أوفيركسريسيون. ( A ) يتم هضم البلازميد لمدة 1 ساعة مع بوي و نوتي. هضم كامل والأحجام الصحيحة ( أي التحوير = 7،338 بب، العمود الفقري = 1،440+ 896 بب) على هلام تحليلي (1). استخراج العديد من المنتجات الهضم من هلام التحضير (2) يولد زيادة تركيز التحوير. وينبغي تجنب التعرض لفترات طويلة للأشعة فوق البنفسجية، ويوصى باستخدام الضوء الأزرق بدلا من ترانزيلوميناتور الأشعة فوق البنفسجية. (ب) استراتيجية التنميط الجيني (1): يجب الاشعال الجلوس على التحوير، وينبغي أن تكون مصممة لتوليد جزء من 200-800 بي بي. عندما يتم تنفيذ التنميط الجيني (2)، فمن المستحسن لتشمل السيطرة الإيجابية ( أي مزيج الحقن المستخدمة ل ميكروينجكتيون) والسيطرة السلبية ( أي الحمض النووي الجيني من الماوس وت). الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الشكل 3
الشكل 3: مراقبة الجودة والنمط الجيني ستراتيغي للإنتاج الناجح للجينات المستهدفة (كو) الفئران. ( A ) يتم تقييم جودة سغرناس التي تنتجها في المختبر النسخ عن طريق تشغيل قالب الحمض النووي و الحمض النووي الريبي ولدت في موازاة لكل دليل. حجم الحمض النووي الريبي أكبر قليلا من الحمض النووي. إذا كانت نوعية مرضية ( أي لا فرق تشويه) يتم قياس تركيزات. ( B ) (1) تصميم الدليلين (الاتجاهات المعاكسة) التي تشمل كودون البداية في اكسون 1. يتم اختيار الاشعال لتهجين مع الحمض النووي الجيني خارج المنطقة في نهاية المطاف استئصال من قبل اثنين من الأدلة. عادة، تسمح هذه الاستراتيجية لتحديد المباشر من متخالف (# 5 و 9) ومتماثلي كو متماثل (# 3) كو باستخدام ير (2). منتجات ير من الحيوانات متماثلة لا تعرض أي فرقة وت. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

رد فعل المكونات الصوت ملحوظة توليف قالب الحمض النووي الخطي
(2.5) نوكليس المياه مجانا 97.2 ميكرولتر 5X هف العازلة 36 ميكرولتر MgCl2 9 ميكرولتر 10 مل دنتبس 9 ميكرولتر 10 ميكرومتر فود التمهيدي 9 ميكرولتر 5'TATAATACGACTCACTATAGN 20
gttttagagctagaaatagcaagttaaaata
أغكتاغتس 3 ' 10 ميكرومتر التمهيدي ريف 9 ميكرولتر 5 'آاغاكغغتكغتغك 3' العلاقات العامةأوف-ريادينغ البلمرة 1.8 ميكرولتر إيفت باستخدام T7 رنا عدة التوليف
(2.6) نوكليس المياه مجانا X ميكرولتر تشكل ما يصل إلى 20 ميكرولتر الحجم الكلي نتب العازلة مزيج 10 ميكرولتر قالب الحمض النووي ≈ 300 نغ T7 رنا بوليميراز 2 ميكرولتر

الجدول 1: تكوين المزيج الرئيسي المختلف المستخدم في هذه الدراسة. توليف قالب الحمض النووي الخطي: تسلسل T7 المروج الحد الأدنى (تتاتاسغاكتكتاتاغ) هو المنبع من تسلسل 20 بب (دليل؛ N 20 التي تم تحديدها باستخدام أداة تصميم كريسبر) وتسلسل مكمل لناقل التعبير (غتاغاغتاكتاغاجاغتاغاتاغكتاغتك). في المختبرالنسخ (إيفت): اعتمادا على تركيز قالب الحمض النووي، يجب تعديل حجم النهائي إلى 20 ميكرولتر مع نوكليس خالية من المياه.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

خطوات حاسمة داخل البروتوكول

ومن المعروف أن توليد الفئران المعدلة وراثيا أن يكون تحديا من الناحية الفنية. ومع ذلك، فإن بروتوكول المقدمة هنا هو الأسلوب الأمثل والمبسط الذي يسمح لإتقان واستكشاف هذه التقنية في وقت قياسي. هناك خطوتان ضروريتان لإنجاز هذه التقنية بنجاح. أولا، يمكن أن يتم تركيب قوالب الحمض النووي الخطي (لتوليف سغرناس) دون كلوريد المغنيسيوم (مغكل 2 ). ومع ذلك، فمن المستحسن أن تضيف بانتظام مغكل 2 إلى مزيج الرئيسي لأن التهجين الجزئي من التمهيدي إلى الأمام غالبا ما تمنع في غياب مغكل 2 . وبالإضافة إلى ذلك، فمن الأهمية بمكان لتسلسل الجينومية المستهدفة لا تكون موجودة في أي جزء من نموذج المانحة (في حالة التكامل المستهدفة)، وإلا فإن نوكلياز Cas9 قطع عليه، ومنع حدوث تقرير التنمية البشرية.

التعديلاتواستكشاف الأخطاء وإصلاحها

على الرغم من أن هذا البروتوكول لتوليد الفئران المعدلة وراثيا وقد تم تحسين وتبسيط على مر السنين، وهناك بعض الاعتبارات المتعلقة العائد من البويضات ذات نوعية جيدة ل ميكروينجكتيون ومعدل توصيل الإناث الحاضنة. اختيار سلالة الخلفية أمر بالغ الأهمية فيما يتعلق بعدد الجراء الحية الناتجة عن جلسة حقن ميكروينجكتيون. C57BL / 6 هو الخلفية الأكثر شيوعا لنماذج الماوس من الأمراض. ومع ذلك، بل هو أيضا واحدة من الخلفيات أقل كفاءة من حيث المقاومة ل ميكروينجكتيون 20 . وعلاوة على ذلك، فإن عمر الأنثى هو أيضا حاسم لإنتاج عدد كبير من البويضات. فمن المستحسن لتجنب الفئران 5-8 أسابيع من العمر، بغض النظر عن الخلفية، وهذا هو أقل فترة مواتية من الاستجابة للتحفيز الهرموني 21 . في تجربتنا، 3 إلى 4 أسابيع من العمر C57BL / 6 الفئران موثوق ينتج 20-30 بيضة لكل أنثى. من المهم لاحظ أن تقنية جديدة (المشار إليها فائقة الترابية) أنتجت ما يصل إلى 100 بيضة لكل أنثى، وقد استخدمت مؤخرا لتوليد البويضات ل ميكروينجكتيون 22 . ومع ذلك، فإن استخدام فائقة الإباضة ل ميكروينجكتيون يعوق عموما من قبل الحاجة إلى تسميد مصطنع ( في التخصيب المختبر ) مثل عدد كبير من البيض.

للحصول على توصيل الإناث تعزيز مناسبة لإعادة زرع، وتزاوج الفئران الإناث مع الذكور فاسكتوميزد (خلفية هذه الفئران ليست حرجة). لزيادة عدد من المتلقين توصيل، يمكن إجراء فحص دقيق لمرحلة من شبق واختيار الإناث مناسبة 23 . ويمكن أيضا أن تحدث تزامن دورات الإناث عن طريق تعريض الإناث إلى الذكور فاسكوميزد قبل يومين من التزاوج (ما يسمى "تأثير ويتن") 24 .

قيود التقنية

أس = "jove_content"> مرة واحدة الأمثل، الإجراء يجب أن تسمح بشكل موثوق واحد لتوليد الفئران المعدلة وراثيا بشكل منهجي خلال كل جلسة حقن مكروي. ومع ذلك، هناك اثنين من القيود الرئيسية على الإجراء الذي يرتبط مع حجم محاولة تعديل الجينومية.

التعديلات الجينية صغيرة جدا، مثل الطفرات نقطة، هي سهلة نسبيا لتوليد، ولكن من الصعب تحديدها. عندما يتم تنفيذ التنميط الجيني، يتم تسلسل المنتجات ير مباشرة التسلسل سانجر. ومع ذلك، فإن ميكروينجكتيون المباشر من مكونات كريسبر في البويضات الماوس غالبا ما يولد الحيوانات الفسيفساء لأن Cas9 لا تزال نشطة لبعض الوقت ويمكن أن تحدث تعديلات الجينومية مختلفة بعد التقسيم الأول للبويضة. ويؤدي هذا التأثير المربك إلى تعقيد التعرف على الطفرات المنفصلة بين الأليلات المختلفة، ويمكن أن يساعد تسلسل الجيل التالي (نغس) في تحدي القراءات. تقنيات حساسة، مثل التيترا التمهيديأرمز-ير، 25 يمكن أن تساعد أيضا مع التنميط الجيني للمستعمرة بعد تحديد المؤسسين عن طريق التسلسل.

وعلى العكس من ذلك، لا يزال إدخال أجزاء كبيرة من الحمض النووي بطريقة مستهدفة أمرا صعبا. أكبر الحمض النووي خارجي، وأقل كفاءة هر. ونتيجة لذلك، يجري حاليا وضع استراتيجيات جديدة، مثل استخدام المانحين الطويلين من سوليغوس (بدلا من البلازميدات) ( 26 ) أو التكامل المستهدف المستقل في مجال التنمية البشرية ( 27) .

أهمية البروتوكول

هذا البروتوكول يقدم تقدما كبيرا لأن الخطوات الرئيسية الأربع ( أي إعداد مكونات التحوير أو كريسبر، ميكروينجكتيون، إعادة زرع، والتوليف الجيني) تم الأمثل، واختبارها، والتحقق من صحتها في مختبرنا.

يتم استخدام التكامل العشوائي من الجينات المحورة على نطاق واسع لدراسات أوفيركسريسيون لسببين رئيسيين. أولا، لتجنبإد "" تأثير الموضع "المحتمل"، لا يزال التكامل المستهدف للتحوير باستخدام كريسبر في موقع "الملاذ الآمن"، مثل روزا 26 و Col1a 29 لوكي، تحديا كبيرا، لأن كفاءة تقرير التنمية البشرية منخفضة. استراتيجيات للتغلب على هذه المشكلة واردة 26 ، 27 ، ولكن التكامل العشوائي حتى الآن أثبتت أكثر كفاءة. الى جانب ذلك، فإن توليد العديد من خطوط المعدلة وراثيا أوفيركسريسينغ نفس التحوير مع مستويات مختلفة من التعبير هو من الفائدة في الدراسات التي تنطوي على استراتيجيات العلاج لعكس النمط الظاهري 30 . وتنتج الجينات المحورة المستندة إلى البلازميد عن طريق الاستنساخ، وذلك باستخدام الإنزيمات تقييد مخصصة لتجميع شظايا أساسية للتعبير عن بروتين من الفائدة. عموما، يتم إجراء التحوير من ثلاثة عناصر على الأقل: المروج المناسب (يتم إضافة مناطق محسن في بعض الأحيان)؛ الترميزتسلسل ([كدنا])، مع أو بدون إنترونيك مناطق؛ وذيل بوليا لتحقيق الاستقرار في التعبير مرنا 31 .

مرة واحدة تجميعها، يتم إدخال التحوير في البلازميد التي تحتوي على عناصر التكاثر البكتيري وتوسيعها في الثقافة بعد التحول (عادة الحرارة الصدمة على أساس). طريقة تنقية الجينات المحورة ل ميكروينجكتيون أمر بالغ الأهمية. هذا العمل يصف استخدام جيل جديد (منخفض السمية) البقع الدنا لتصور أكثر دقة من جزء من الفائدة على هلام (بالمقارنة مع البنفسجي الكريستال التقليدي) والتعرض الطفرات منخفضة (مقارنة بروميد إثيديوم).

طريقة غير الاستنساخ وصفها هنا لاستهداف الجينات هو سريع جدا ويسمح لتوليف العديد من سغرناس في 5-6 ح فقط. مطلوب أربع خطوات فقط: تحديد تسلسل المستهدفة، وتوليف قالب الحمض النووي الخطي الذي يحتوي على المروج T7 وتسلسل الهدف المختار، والتوليف سو سغرنا التي كتبها في المختبر النسخ (إيفت)، وتنقية سغرنا باستخدام الأعمدة تدور.

في سن مبكرة من كريسبر الماوس تحرير الجينوم، تم تقييم تأثير خارج الهدف المحتملة بشكل منهجي، على الرغم من أنه قد تبين أن تكون محدودة جدا في أجنة الفئران 32 ويمكن بسهولة أن تضعف من قبل يعني من نظام تربية حيث الفئران مختارة تحمل فقط تعديل الجينوم المطلوب. كما تم تقييم النشاط المستهدف على نحو منتظم بانتظام في المختبر ، وذلك باستخدام أدلة مختلفة واختيار واحد أكثر نشاطا (ق) 12 . وهذه الممارسة أصبحت الآن أقل شيوعا، لعدة أسباب. أولا، يتم تقييم النشاط على الهدف باستخدام ترنسفكأيشن من الخلايا الخلوية الماوس الخلد (عادة N2A أو NIH3T3) مع البلازميدات ترميز كريسبر. هذا هو طريقة مختلفة من حقن مكونات الحمض النووي الريبي كريسبر في البويضات الماوس. ولذلك، فإن النتائج الموجودة في المختبر لا تترجم دائما على قدم المساواةإلى البويضات. وعلاوة على ذلك، أظهرت التجارب الإنتاجية العالية أن معظم أدلة نشطة 33 . وبالتالي، لا يتم تقييم النشاط على الهدف، وحتى الآن، لم يكن هناك دليل على دليل لا تظهر أي نشاط في البويضات الماوس. جنبا إلى جنب مع طريقة غير استنساخ لتجميع سغرناس، المقدمة هنا، وهذا يبسط إلى حد كبير ويوضح سير العمل، ويمكن بسهولة أن تكون توليفها أدلة متعددة نشطة في يوم واحد.

ويعتبر كريسبر "تكنولوجيا التخريبية"، وهو الابتكار الذي يغير الطريقة التي يتم بها تنفيذ التقنيات. عندما تم تأسيس ميكروينجكتيون، برينستر وآخرون. أظهرت أن ترانزجينيسيس السيتوبلازمية، على الرغم من أن تحقيقها، ظلت في الغالب غير فعالة 7 . ونتيجة لذلك، ميكروينجكتيون برونوكلار ظلت الممارسة الشائعة الوحيدة منذ ما يقرب من 30 عاما، حتى أول مظاهرة من الجينات كريسبر الناجحة تستهدف في الفئران. وأظهرت هذه الدراسة أن ميكروينجيك السيتوبلازم أيون يمكن أن تولد نتيجة مماثلة أو متفوقة مقارنة مع تسليم برونوكلار 12 . من الواضح، لأن مكونات كريسبر مصنوعة عادة من الحمض النووي الريبي، فمن الواضح أن يتم استهداف السيتوبلازم. ومع ذلك، حتى عندما حقن في السيتوبلازم، يمكن أن القوالب المانحة أيضا تحفيز بنجاح هر. تركيز سيتوبلازمي عالية من القوالب تمكن انتشارها في النواة. وعلاوة على ذلك، فإن استخدام ميكروينجكتيون السيتوبلازمية يحركها بيزو 16 ليست شرطا. وهناك حضانة قصيرة من البويضات مع مثبط الهيكل الخلوي، مثل سيتوشالاسين B، يزيد من البقاء على قيد الحياة من البويضات 34 ، 35 ، مما يجعلها كافية لأداء الحقن السيتوبلازمية دون نظام محرك تأثير بيزو. وبالمثل، فإن استخدام وسط ثقافة محسن، مثل كسوما، يقلل من انسداد في مرحلة اثنين من الخلايا ويحسن القدرات التنموية للأجنة مقارنة مع M16 المتوسطةكريف "> 36.

خلية واحدة أو اثنين من الخلايا (عندما المزروعة بين عشية وضحاها) الأجنة يمكن نقلها إلى قناة البيض. الإجراء التقليدي هو الغازية تماما، لأنه يتطلب تمزيق الجراب الذي يحمي المبيض. بل هو أيضا تحديا تقنيا، لأن الزجاج الشعرية يحتاج إلى إدراجها في القمع 15 . الطريقة المعروضة هنا هو أسهل بكثير للتعلم، لا تحفز النزيف المحتمل، ويحافظ على سلامة المبيض. وهو يقوم على العمل الذي تم تطويره في جامعة كوماموتو 37 .

استراتيجيات التنميط الجيني وتقنيات التسلسل حاسمة لتحديد المؤسسين المحتملين. من أجل التكامل العشوائي، ويستند استخراج الحمض النووي الجيني على طريقة بسيطة تكييفها من ترويت وآخرون. 38 . مثل هذه الطريقة سريعة استخراج كافية لتحديد المؤسسين المحتملين، منذ الاشعال تهدف إلى التهجين مع التحوير (غالبا ما تكاملكما هو موضح في نسخ متعددة). على العكس من ذلك، يتطلب استهداف الجينات الحمض النووي الجيني تنقيته للغاية، لأن المنتج ير يشمل المنطقة الجينومية المعدلة.

ل خروج المغلوب الجيني، والطريقة التقليدية لحقن سغرنا واحد يولد الحذف الصغيرة (إندلس) أو الإدراج، في نهاية المطاف يطرق الجين من الفائدة 12 . هذه التعديلات الصغيرة من الصعب تحديد وغالبا ما تتطلب وقتا طويلا، واستنساخ ليغاز مستقلة والتسلسل لتأكيد طبيعة هذه الطفرات.

في هذا البروتوكول، اتخذنا الاستفادة من كريسبر تعدد الإرسال لتطوير منهجي شارك في حقن اثنين من سغرناس تشمل كودون بدء الجين من الفائدة. هذا ليس فقط يزيد من الرغبة في خروج المغلوب الجينات، ولكن أيضا استئصال قطعة من الحمض النووي الجيني من حجم محدد مسبقا (100-300 بي بي)، مما يسمح لسهولة تحديد المؤسسين عن طريق ير بسيط. من الجدير بالذكر، الجراء التي لا تحمل الجينوم المتوقع هلا يزال يمكن تحليل زسيسيون لطفرات فرامشيفت صغيرة، عندما أثبتت واحدة فقط سغرنا نشطة. وبالمثل، في حالة التحرير الجيني، والحقن المشترك المنهجي اثنين من سغرناس متداخلة في اتجاهات المعاكس يجب أن تزيد من كفاءة تقرير التنمية البشرية، منذ آليات إصلاح خلية استخدام تفضيلي واحد من اثنين من فروع 39 .

التطبيقات المستقبلية

هذا البروتوكول يستفيد من أحدث التطورات في علم الأجنة الماوس والجينات التي تستهدف 40 لتبسيط وتبسيط عملية توليد مختلف نماذج الماوس متطورة من الظروف البشرية. هذه النماذج تلعب دورا محوريا في المساعدة على تطوير فهمنا للمسببات، مما يساعد في نهاية المطاف في وضع استراتيجيات علاجية 2 . تحسين وتبسيط الكواشف المطلوبة لاستهداف الجينات أو التكامل العشوائي على نطاق واسع وسهولة أبليكابلي أي أنواع الثدييات الأخرى، مثل الفئران والأرانب، وحتى إلى الحيوانات الكبيرة مثل الماشية.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

يوفر المؤلفون خدمات ترانزجينيسيس الأكاديمية في الفئران عبر جامعة نيو ساوث ويلز مركز مارك وينوريت التحليلية.

Acknowledgments

ويشكر المؤلفون موظفي مرفق الحيوانات (برك) على دعمهم المستمر. وقد تم تمويل هذا العمل من قبل المجلس الوطني للصحة والبحوث الطبية ومجلس البحوث الأسترالي.

Materials

Name Company Catalog Number Comments
Micropipette 0.1-2.5 μL Eppendorf 4920000016
Micropipette 2 - 20 μL Eppendorf 4920000040
Micropipette 20 - 200 μL Eppendorf 4920000067
Micropipette 100 - 1,000 μL Eppendorf 4920000083
Molecular weight marker  Bioline BIO-33025 HyperLadder 1 kb
Molecular weight marker  Bioline BIO-33056 HyperLadder 100 bp
Agarose Bioline BIO-41025
EDTA buffer Sigma-Aldrich 93296 10x - Dilute to 1x
Ethidium bromide Thermo Fisher Scientific 15585011
SYBR Safe gel stain Invitrogen S33102
Gel extraction kit Qiagen 28706
PCR purification kit (Qiaquick) Qiagen 28106
Vacuum system (Manifold) Promega A7231
Nuclease-free microinjection buffer  Millipore MR-095-10F
Ultrafree-MC microcentrifuge filter  Millipore UFC30GV00
Cas9 mRNA Sigma-Aldrich CAS9MRNA
CRISPR expressing plasmid (px330) Addgene 42230
Nuclease free water Sigma-Aldrich W4502
Phusion polymerase New England Biolabs M0530L
T7 Quick High Yield RNA kit New England Biolabs E2050S
RNA purification spin columns (NucAway) Thermo Fisher Scientific AM10070
ssOligos Sigma-Aldrich OLIGO STANDARD
Donor plasmid Thermo Fisher Scientific GeneArt
Hyaluronidase Sigma-Aldrich H3884
KSOMaa embryo culture medium Zenith Biotech  ZEKS-100
Mineral oil Zenith Biotech  ZSCO-100
M2 Medium Sigma-Aldrich M7167
Cytochalasin B Sigma-Aldrich C6762
Mouthpiece Sigma-Aldrich A5177
Glass microcapillaries Sutter Instrument BF100-78-10
Proteinase K Applichem A3830.0100
Dumont #5 forceps Fine Science Tools  91150-20
Iris scissors Fine Science Tools  91460-11
Vessel clamp Fine Science Tools  18374-43
Wound clips  Fine Science Tools  12040-01
Clips applier  Fine Science Tools  12018-12
Micro-scissors  Fine Science Tools  15000-03
Cauterizer Fine Science Tools  18000-00
Non-absorbable surgical sutures (Ethilon 3-0) Ethicon 1691H
5% CO2 incubator MG Scientific Galaxy 14S
Spectrophotometer Thermo Fisher Scientific Nanodrop 2000c
Thermocycler Eppendorf 6321 000.515
Electrophoresis set up BioRad 1640300
UV Transilluminator BioRad 1708110EDU
Thermocycler Eppendorf 6334000069
Stereoscopic microscope Olympus SZX7
Inverted microscope Olympus IX71
2x Micromanipulators Eppendorf 5188000.012
Oocytes manipulator Eppendorf 5176000.025
Microinjector (Femtojet) Eppendorf 5247000.013
Mice C57BL/6J strain Australian BioResources C57BL/6JAusb 

DOWNLOAD MATERIALS LIST

References

  1. Ittner, L. M. Dendritic function of tau mediates amyloid-beta toxicity in Alzheimer's disease mouse models. Cell. 142, (3), 387-397 (2010).
  2. Ittner, A. Site-specific phosphorylation of tau inhibits amyloid-beta toxicity in Alzheimer's mice. Science. 354, (6314), 904-908 (2016).
  3. Marantz Henig, R. The Monk in the Garden. Mariner books. (2000).
  4. Jaenisch, R., Mintz, B. Simian virus 40 DNA sequences in DNA of healthy adult mice derived from preimplantation blastocysts injected with viral DNA. Proc Natl Acad Sci U S A. 71, (4), 1250-1254 (1974).
  5. Gordon, J. W., Ruddle, F. H. Integration and stable germ line transmission of genes injected into mouse pronuclei. Science. 214, (4526), 1244-1246 (1981).
  6. Gordon, J. W., Scangos, G. A., Plotkin, D. J., Barbosa, J. A., Ruddle, F. H. Genetic transformation of mouse embryos by microinjection of purified DNA. Proc Natl Acad Sci U S A. 77, (12), 7380-7384 (1980).
  7. Brinster, R. L., Chen, H. Y., Trumbauer, M. E., Yagle, M. K., Palmiter, R. D. Factors affecting the efficiency of introducing foreign DNA into mice by microinjecting eggs. Proc Natl Acad Sci U S A. 82, (13), 4438-4442 (1985).
  8. Capecchi, M. R. Gene targeting in mice: functional analysis of the mammalian genome for the twenty-first century. Nat Rev Genet. 6, (6), 507-512 (2005).
  9. Carbery, I. D. Targeted genome modification in mice using zinc-finger nucleases. Genetics. 186, (2), 451-459 (2010).
  10. Sung, Y. H. Knockout mice created by TALEN-mediated gene targeting. Nat Biotechnol. 31, (1), 23-24 (2013).
  11. Jinek, M. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337, (6096), 816-821 (2012).
  12. Wang, H. One-step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering. Cell. 153, (4), 910-918 (2013).
  13. Kang, X. Introducing precise genetic modifications into human 3PN embryos by CRISPR/Cas-mediated genome editing. J Assist Reprod Genet. 33, (5), 581-588 (2016).
  14. Liang, P. CRISPR/Cas9-mediated gene editing in human tripronuclear zygotes. Protein Cell. 6, (5), 363-372 (2015).
  15. Ittner, L. M., Götz, J. Pronuclear injection for the production of transgenic mice. Nat Protoc. 2, (5), 1206-1215 (2007).
  16. Yang, H., Wang, H., Jaenisch, R. Generating genetically modified mice using CRISPR/Cas-mediated genome engineering. Nat Protoc. 9, (8), 1956-1968 (2014).
  17. CRISPR DESIGN. Available from: http://crispr.mit.edu (2017).
  18. Integrated DNA Technologies. Resuspension Calculator. Available from: https://sg.idtdna.com/calc/resuspension/ (2017).
  19. BioTools at UMass Medical School. Primer3: WWW primer tool. Available from: http://biotools.umassmed.edu/bioapps/primer3_www.cgi (2017).
  20. Auerbach, A. B. Strain-dependent differences in the efficiency of transgenic mouse production. Transgenic Res. 12, (1), 59-69 (2003).
  21. Merriman, J. A., Jennings, P. C., McLaughlin, E. A., Jones, K. T. Effect of aging on superovulation efficiency, aneuploidy rates, and sister chromatid cohesion in mice aged up to 15 months. Biol Reprod. 86, (2), 49 (2012).
  22. Nakagawa, Y., et al. Ultra-superovulation for the CRISPR-Cas9-mediated production of gene-knockout, single-amino-acid-substituted, and floxed mice. Biol Open. 5, (8), 1142-1148 (2016).
  23. Byers, S. L., Wiles, M. V., Dunn, S. L., Taft, R. A. Mouse estrous cycle identification tool and images. PLoS One. 7, (4), e35538 (2012).
  24. Whitten, W. K. Modification of the oestrous cycle of the mouse by external stimuli associated with the male. J Endocrinol. 13, (4), 399-404 (1956).
  25. Ye, S., Dhillon, S., Ke, X., Collins, A. R., Day, I. N. An efficient procedure for genotyping single nucleotide polymorphisms. Nucleic Acids Res. 29, (17), E88 (2001).
  26. Yoshimi, K., et al. ssODN-mediated knock-in with CRISPR-Cas for large genomic regions in zygotes. Nat Commun. 7, 10431 (2016).
  27. Suzuki, K., et al. In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration. Nature. (2016).
  28. Soriano, P. Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat Genet. 21, 70-71 (1999).
  29. Liu, X., et al. A targeted mutation at the known collagenase cleavage site in mouse type I collagen impairs tissue remodeling. J Cell Biol. 130, (1), 227-237 (1995).
  30. Ke, Y. D. Short-term suppression of A315T mutant human TDP-43 expression improves functional deficits in a novel inducible transgenic mouse model of FTLD-TDP and ALS. Acta Neuropathol. 130, (5), 661-678 (2015).
  31. Auerbach, A. B. Production of functional transgenic mice by DNA pronuclear microinjection. Acta Biochim Pol. 51, (1), 9-31 (2004).
  32. Iyer, V., et al. Off-target mutations are rare in Cas9-modified mice. Nat Methods. 12, (6), 479 (2015).
  33. Zhou, Y. High-throughput screening of a CRISPR/Cas9 library for functional genomics in human cells. Nature. 509, (7501), 487-491 (2014).
  34. Brinster, R. L., Chen, H. Y., Trumbauer, M. E., Avarbock, M. R. Translation of globin messenger RNA by the mouse ovum. Nature. 283, (5746), 499-501 (1980).
  35. Pinkert, C. A., Irwin, M. H., Johnson, L. W., Moffatt, R. J. Mitochondria transfer into mouse ova by microinjection. Transgenic Res. 6, (6), 379-383 (1997).
  36. Biggers, J. D., Summers, M. C. Choosing a culture medium: making informed choices. Fertil Steril. 90, (3), 473-483 (2008).
  37. Nakagata, N. Embryo transfer through the wall of the fallopian tube in mice. Jikken Dobutsu. 41, (3), 387-388 (1992).
  38. Truett, G. E. Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris (HotSHOT). Biotechniques. 29, (1), 52-54 (2000).
  39. Richardson, C. D., Ray, G., DeWitt, M. A., Curie, G. L., Corn, J. E. Enhancing homology-directed genome editing by catalytically active and inactive CRISPR-Cas9 using asymmetric donor DNA. Nat Biotechnol. 34, (3), 339-344 (2016).
  40. Delerue, F., Ittner, L. M. Genome Editing in Mice Using CRISPR/Cas9: Achievements and Prospects. Clon. Transgen. 4, (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics