Generering av genetisk modifiserte mus gjennom mikroinjeksjon av oocytter

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Mikroinjeksjonen av mus-oocytter blir ofte brukt for både klassisk transgenese ( dvs. tilfeldig integrasjon av transgene) og CRISPR-mediert genmålretting. Denne protokollen vurderer de siste utviklingene i mikroinjeksjon, med særlig vekt på kvalitetskontroll og genotyping-strategier.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Delerue, F., Ittner, L. M. Generation of Genetically Modified Mice through the Microinjection of Oocytes. J. Vis. Exp. (124), e55765, doi:10.3791/55765 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Bruken av genetisk modifiserte mus har vesentlig bidratt til studier på både fysiologiske og patologiske in vivo prosesser. Den pronukleære injeksjonen av DNA-ekspresjonskonstruksjoner i befruktede oocytter forblir den mest brukte teknikken for å generere transgene mus for overekspresjon. Med introduksjonen av CRISPR-teknologi for genmålretting, har pronukleær injeksjon i befruktede oocytter blitt utvidet til generering av både knockout- og knock-mus. Dette arbeidet beskriver fremstillingen av DNA til injeksjon og generering av CRISPR-guider for genmålretting, med særlig vekt på kvalitetskontroll. Genotypingsprosedyrene som kreves for identifisering av potensielle grunnleggere er kritiske. Innovative genotyping strategier som utnytter "Multiplexing" evner CRISPR er presentert her. Kirurgiske prosedyrer er også skissert. Sammen vil trinnene i protokollen tillate generering av genEtisk modifiserte mus og for påfølgende etablering av musekolonier for en overflod av forskningsfelt, inkludert immunologi, nevrovitenskap, kreft, fysiologi, utvikling og andre.

Introduction

Dyremodeller, både hos vertebrater og vertebrater, har vært med på å undersøke patofysiologien av menneskelige tilstander som Alzheimers sykdom 1 , 2 . De er også uvurderlige verktøy for å søke etter sykdomsmodifikatorer og til slutt utvikle nye behandlingsstrategier i håp om å kurere. Selv om hver modell har inneboende begrensninger, er bruk av dyr som hele systemiske modeller avgjørende for biomedisinsk forskning. Dette skyldes at det metabolske og komplekse fysiologiske miljøet ikke helt kan simuleres i vevskultur.

Hittil er musen den vanligste pattedyrsarten som brukes til genetisk manipulering fordi den har flere fordeler. De fysiologiske prosesser og gener forbundet med sykdommer er sterkt konserverte mellom mus og mennesker. Musen var det første pattedyret som hadde sitt fulle genom sekvensert (2002), ett år før det menneskelige genoMeg (2003). Bortsett fra denne mengden genetisk informasjon, har musen god avlskapacitet, en rask utviklingssyklus (6 uker fra befruktning til avvenning), og en rimelig størrelse. Alle disse fordelene, kombinert med fysiologiske indikatorer, som forskjellige farger (nødvendig for kryssstrategier), gjorde musen til en attraktiv modell for genetisk manipulasjon. Spesielt, i den tidlige alderen av moderne genetikk, begynte Gregor Mendel å jobbe med mus før han flyttet til planter 3 .

Gene overføringsteknikker resulterte i generasjonen av den første transgene musen over tre tiår siden 4 , opprinnelig opprettet ved hjelp av viral levering. Imidlertid innså forskere snart at en av hovedutfordringene ved mus transgenese var manglende evne til å kontrollere skjebnen til det eksogene DNA. Fordi den virale tilførsel av transgener i musoocytter resulterte i flere kopier integrert tilfeldig inn i genomet, kunne mulighetenY for å etablere etterfølgende transgene linjer var begrenset.

En slik begrensning ble overvunnet da Gordon et al. Genererte den første transgene muselinjen ved mikroinjeksjon 5 , 6 . Dette begynte epoken med rekombinant DNA-teknologi, og parametrene som påvirker utfallet av en mikroinjeksjonssesjon har blitt studert mye 7 . Selv om mikroinjeksjon ikke tillater kontroll over integrasjonsstedet for transgenet (som til slutt resulterer i spesifikke uttrykksnivåer for hver grunnmus), forblir den viktigste fordelen av pronuklear mikroinjeksjon dannelsen av konkatemere ( dvs. arrays av flere kopier av transgenet, Koblet i serie) før genomisk integrasjon 5 . Denne egenskapen har blitt brukt over årene for å etablere tusenvis av transgene muselinjer som overexpresser et gen av interesse. Siden da har transgenese, aRasjonell modifikasjon av et organismers genom, har blitt mye brukt til å identifisere rollen som enkeltgener i forekomsten av sykdommer.

En ytterligere nøkkeloppnåelse i manipulering av musegenometet ble nådd da Mario Capecchi forstyrret et enkelt gen i musen, og åpnet epoken med genmålretting 8 . Imidlertid oppstod store ulemper raskt fra ES-cellebasert genmålretting, inkludert utfordringene ved å dyrke ES-celler, den noe variable graden av chimerisme og lengden av prosessen ( dvs. 12-18 måneder, minimum, for å oppnå musen) .

Nylig har fremskritt i ny teknologi, slik som konstruerte endonukleaser ( f.eks. Sinkfingernukleaser (ZFN), transkripsjonsaktivator-lignende effektorukleaser (TALEN) og klyngede regelmessige interspaced korte palindromiske gjentakelser (CRISPR / Cas9)) oppstått som alternative metoder for å Akselerere prosessen med genmålretting i mikrofonE 9 , 10 . Disse endonukleaser kan lett injiseres i musoocytter ved mikroinjeksjon, noe som tillater generering av genmålrettede mus på så lite som 6 uker.

Siden den første rapporten om bruk av CRISPR for genomredigering 11 , har dette bakterielle adaptive immunsystemet erstattet ZFN og TALEN på grunn av dets mange fordeler, inkludert enkel syntese og evnen til å målrette flere loki på en gang (referert til som "multipleksering "). CRISPR ble først brukt til genmålretting i mus 12 og har siden blitt anvendt på utallige arter, fra planter til mennesker 13 , 14 . Til nå er det ingen rapport om en enkelt art som er resistent mot CRISPR genom redigering.

De to hovedbegrensende trinnene i generasjonen av transgene mus er injeksjonen av oocytter og reimplantasjonenAv disse oocytene til pseudo-gravide kvinner. Selv om denne teknikken har blitt beskrevet av oss 15 og andre 16 , har nyere tekniske forbedringer i musembryologi og genoverføringsteknikker revolusjonert prosessen med å generere genetisk modifiserte mus. Disse forbedringene vil bli beskrevet her.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle prosedyrer er godkjent av University of New South Wales Dyrpleie og etikkutvalg.

1. Fremstilling av transgenet (tilfeldig integrasjon)

  1. Analytisk agarosegelelektroforese.
    1. Fordel plasmidet for å aksessere transgenet ved bruk av passende enzymer (1 time inkubering) eller rask fordøyelsesenzymer (15 til 30 minutter inkubering) i en termocykler som følger produsentens anbefalinger (se figur 2A og dens legende).
    2. Kast en 1% tris-acetat-etylendiamintetraeddiksyre (EDTA) (TEA) agarosegel, farget med 0,5-1,0 μg / ml etidiumbromid (EtBr).
      MERK: Vær forsiktig når du bruker EtBr; Det er en potent mutagen. Bruk egnet personlig verneutstyr (se materialets sikkerhetsdatablad).
    3. Legg en 1 kb molekylvektmarkør.
    4. Last de lineære fragmentene ( dvs. transgen og ryggraden). Kjør elektroforese ved 100 V i 45 min.
    5. Visualiser gelen på en ultrafiolett (UV) transilluminator for å kontrollere at fordøyelsen er fullført og for å bekrefte transgenes korrekte størrelse ( dvs. 7.333 bp, se figur 2A ).
  2. Preparativ agarosegelelektroforese.
    1. Kast en 1% TAE agarosegel farget med en lavtoksisitetsgel flekk. Legg 8 alikvoter (1 ug hver) av linearisert transgen uten en molekylvektmarkør og kjør elektroforeseen ved 100 V i 45 min. Bruk en skalpell til å aksessere alle 8 bånd som tilsvarer det lineære transgenet.
    2. Trekk ut DNA-en ved hjelp av et gelekstraksjonssett ved å følge produsentens anbefalinger (se tabell over materialer ).
      1. Smelt gelfragmentene ved 50 ° C i 1,5 ml rør i minst 15 minutter. Nedfell det med isopropanol og tilsett deretter bindingsbufferen.
      2. Kombiner hele DNA ved å pipettere alt sammen i en kolonne. Utløp i nukleasefri mikroinjeksjonsbuffer (8 mM Tris-HCl og 0,15 mM EDTA). Filtrer gjennom et 0,22 μm mikrocentrifugfilter og sentrifuger i 60 s ved 12 000 x g.
    3. Mål konsentrasjonen og kvaliteten på DNA'et ved hjelp av et spektrofotometer. Sjekk at A260 / A280-forholdet er rundt 1,8 ( dvs. ingen forurensning av proteiner) og A260 / A230-forholdet er minst 2,0 ( dvs. ingen forurensning av organiske løsningsmidler). Fortynn ned til 3 ng / μL i nukleasefri mikroinjeksjonsbuffer, alikvot (20-50 μl) og frys ved -20 ° C.

2. Syntese av CRISPR-komponenter (genmålretting)

  1. Cas9 mRNA.
    1. Fortynn Cas9 mRNA (oppnådd fra en kommersiell kilde, se Materialetabell ) til en konsentrasjon på 1 μg / μl i nukleasefri mikroinjeksjonsbuffer.
    2. Aliquot i 2 μL og gratis De ved -80 ° C.
  2. Single-guide RNA (SgRNA).
    1. Identifiser de ønskede to-mål-genomiske sekvensene (guider) ved hjelp av et beregningsverktøy som tillater minimal potensiell off-target-aktivitet 17 .
      1. For genutkobling, velg systematisk to guider som ligger noen få hundre basepar (bp) fra hverandre, i motsatt retning, og inkludere startkodon av genet av interesse. For homologi direkte reparasjon, velg to overlappende guider (når det er mulig), i motsatt retning.
        MERK: Som et eksempel har følgende guider nylig blitt injisert for å forstyrre den første exonen til TPM4.2- genet:
        Guide 1: 5 'CGCCATCCAGTTCGCGCTGC 3';
        Guide 2: 5 'CAGAACGATTGAGCTATGGC 3'
    2. Bestil et sett med primere som beskrevet i tabell 1 .
    3. Syntese en lineær DNA-mal.
      1. Fortynn px330Ref "> 12 plasmid til 10 ng / μl i nukleasefritt vann.
      2. Forbered masterblandingen som angitt i tabell 1 . Legg til polymerasen på slutten og hold masterblandingen på is.
      3. Bland og del dette inn i 8 PCR-rør (19 μL / rør). Tilsett 1 μL px330 per rør og kjør PCR under følgende betingelser: 1 min ved 98 ° C; 40 sykluser på 98 ° C i 10 s, 64 ° C i 30 s og 72 ° C i 15 s; Og en endelig forlengelse ved 72 ° C i 5 minutter. Hold ved 4 ° C.
      4. Rens PCR-produktene ved hjelp av et PCR-rensingssett (se Materialebordet ), en manifold og en vakuumkilde (for raskere behandling). Påfør maksimal vakuumstyrke ( dvs. 8 mbar).
        1. Tilsett 5 volumer (100 μl) bindingsbuffer til 1 volum av PCR-prøven og bland.
        2. Plasser en (forsynt) silikamembran-spinnkolonne i et (forsynt) 2 ml oppsamlingsrør for sentrifugering, eller på manifoldet for vakuumprosessing. For å binde DNA, påfør alle 8 prøver til kolonnen og vakuum eller sentrifuge i 60 s ved 12 000 xg for hver belastning.
        3. For å vaske, tilsett 0,75 ml vaskebuffer (buffer PE) til kolonnen og vakuum eller sentrifuge i 60 s ved 12 000 x g. Sentrifuger kolonnen i 60 s ved 12 000 xg for å eliminere resterende etanol.
        4. Plasser kolonnen i et rent 1,5 ml mikrocentrifugerør. For å eluere DNA, tilsett 30 μL nukleasefritt vann til midten av membranen, la kolonnen stå i 1 min og sentrifuge i 60 s ved 12 000 g.
      5. Mål konsentrasjonen ved hjelp av et spektrofotometer; Vanligvis bør konsentrasjonen være 100 ng / μl eller høyere. Sjekk at A260 / A280-forholdet er rundt 1,8 ( dvs. ingen forurensning av proteiner) og A260 / A230-forholdet er minst 2,0 ( dvs. ingen forurensning av organiske løsningsmidler).
    4. In vitro transkripsjon ved bruk av et T7 RNA syntese kit.
      1. Forbered tHan mesterblandingen, som angitt i tabell 1 , og inkuberer i 3 timer ved 37 ° C i en termocykler. Tilsett 28 μl nukleasefritt vann og 2 μl DNase I og inkuber i ytterligere 15 minutter ved 37 ° C i en termocykler.
    5. RNA rensing ved hjelp av spin kolonner.
      1. Oppløs pulveret i den angitte rotasjonskolonnen i 650 μL nukleasefri mikroinjeksjonsbuffer, fjern forsiktig alle luftbobler. Hett røret og hydrat i 5 - 15 min ved romtemperatur.
      2. Fjern den blå hetten nederst og plasser kolonnen i et 2 ml rør. Sentrifuger i 2 minutter ved 750 xg og romtemperatur. Plasser kolonnen i et nytt 1,5 ml rør og påfør 50 μL RNA-oppløsningen dråpevis til midten, uten å berøre kolonnveggen. Spinn kolonnen i 2 minutter ved 750 x g.
      3. Mål RNA-konsentrasjonen ved hjelp av et spektrofotometer (typisk utbytte av en reaksjon er 30-50 μg). Kontroller at A260 / A280-forholdet er aRunde 2,0 ( dvs. ingen forurensning av proteiner) og A260 / A230-forholdet er minst 2,0 ( dvs. ingen forurensning av organiske løsningsmidler). Oppbevar sgRNAene ved -80 ° C til bruk.
      4. Vurder kvaliteten på RNA ved hjelp av 1% TAE-gelene som rutinemessig brukes til DNA-elektroforese. Kjør 200-400 ng av DNA-malen og det tilsvarende sgRNA i parallell. RNA-båndet (≈ 100 bp) skal være litt større enn DNA-båndet (se figur 3A ).

3. Donor Mal

  1. Bestil kommersielt syntetiserte enkeltstrengede oligonukleotider (ssOligos, se Materialetabell ) for punktmutasjoner eller for integrering av små sekvenser opptil 50 bp; Homologi armer er vanligvis 60-90 bp lange.
  2. For større innsettinger, bruk et donorplasmid som en mal. Generer et passende plasmid ved å bruke enten den klassiske kloningsmetoden eller de novo- syntese fra aKommersiell kilde.
    MERK: Det anbefales minst 800 bp per homologiarm. Størrelsen på ryggraden har ingen innflytelse på effektiviteten av homologi direkte reparasjon (HDR).

4. Injeksjonsblanding

  1. Fortynn Cas9 mRNA til 50 ng / μl og sgRNAene til 12,5 ng / μl (25 ng / μl totalt) ved bruk av nukleasefri mikroinjeksjonsbuffer for gen-knockout-eksperimenter. Tilføy donormalen (ssOligo eller plasmidet) ved en konsentrasjon på 200 ng / μl for genomredigering eksperimenter basert på homologi direkte reparasjon.
    MERK: Fortynningsvolumer kan enkelt bestemmes ved hjelp av elektroniske verktøy, for eksempel en resuspensjonskalkulator 18 .
  2. Hold hver alikvot på is under mikroinjeksjonssesjonen og kast bort etterpå (ikke frys inn injeksjonsblandingen).

5. Skrotal vasektomi

MERK: To typer vasektomi utføres vanligvis hos mus: abdominal og skrotal. SistnevnteEr mindre invasiv og har tidligere blitt beskrevet 15 .

  1. Autoklaver alle rustfrie stål kirurgiske instrumenter.
  2. Bestem musens vekt ved hjelp av en vektskala og bedøve hannene ved intraperitoneal (ip) injeksjon med injiserbare anestetika (ketamin 100 mg / kg, xylazin 10 mg / kg).
  3. Overvåk tapet av tå-nippelreflex og når musen er sedert, legg den på toppen av en varmepute.
  4. Desinfiser huden rundt testene med alternerende kluter av et aktuelt antiseptisk middel som klorhexidin og 70% etanol.
  5. Skyv testene inn i skrotaksene og gjør et hudinnsnitt med en skalpell.
  6. Visualiser testis, cauda epididymis og vas deferens.
  7. Ta tak i deferensene med tau, hold den, og krysse på hver side av tangen for å fjerne 3 mm av vasdeferensene.
  8. Utfør samme prosedyre på den andre testis.
  9. Lukk hudinnsnittene med sårklemmer og kontrollerMusen tett til full gjenoppretting.

6. Superovulasjon (Oocytes Donors) og Time-paring (Pseudo-pregnant Females)

MERK: Teknikken for å generere et passende antall befruktede oocytter og plugged fosterhunner for reimplantasjon er beskrevet andre steder 15 .

  1. Injiser 10 kvinner ip med 5 IE av gravid mares serumgonadotropin (PMSG, i 100 μl) rundt kl 12 på dag 1.
  2. Injiser kvinnene ip med 5 IE av human choriongonadotropin (hCG, i 100 μl) 46-48 timer senere (klokka 11.00 på dag 3).
  3. Umiddelbart parre hunnene med enslige menn over natten.

7. Pronukleær (random-integrasjon) og cytoplasmisk (Gene-targeting) injeksjoner

  1. Kast de superovulerte musene ved cervikal dislokasjon, avslør abdomen, og få tilgang til eggstokkene og ovidukter, som tidligere beskrevet 15 . Dissect oViducts og høste cumulus-oocyt-kompleksene (COCs) under en stereomicorskop 15 . Plasser dem i en dråpe kalium simplex optimaliseringsmedium suppleret med aminosyrer (KSOMaa) etter den tradisjonelle metoden 15 .
  2. Rens oocytene ved å tilsette tilnærmet 1 μl hyaluronidase (10 mg / ml) til dråpen KSOMaa-medium ved å bruke et aspiratormunnstykke og plasser fatet i en 37 ° C / 5% CO2-inkubator i 30 s til 1 min.
  3. Vask oocytene med 4 friske dråper KSOMaa medium ved hjelp av aspirator munnstykket og overfør dem til en siste dråpe KSOMaa medium overlaid med mineralolje (ca. 2 ml). Plasser parabolen i 37 ° C / 5% CO 2- inkubatoren til oocytene er klare til injeksjon.
  4. Pronukleær injeksjon (tilfeldig integrasjon).
    1. Visualiser eggene under det stereoskopiske mikroskopet og overfør ca. 50 egg til injeksjonskammeret (aP av M2 medium overlagt med mineralolje) ved hjelp av aspirator munnstykket.
    2. Overfør injeksjonskammeret til det inverterte mikroskopet og injiser de befruktede oocytene (to synlige pronuclei) med noen få picoliters av injeksjonsblandingen, rettet mot en pronucleus (noen av pronuclei kan målrettes). Visualiser en vellykket injeksjon ved å observere hevelsen av pronucleus.
  5. Cytoplasmisk injeksjon (genmålretting).
    1. Overfør ca. 50 egg til en dråpe KSOMaa som inneholder 5 μg / ml Cytochalasin B ved hjelp av munnstykket og inkuber i 5 minutter i 37 ° C / 5% CO2-inkubatoren.
    2. Overfør eggene til injeksjonskammeret ved hjelp av munnstykket.
    3. Injiser få picoliters av injeksjonsblandingen i cytoplasma ved svært lavt trykk (50-100 hPa), ved å bruke kompensasjonstrykket til den automatiserte mikroinjektoren der det er mulig.
    4. Etter injeksjon, overfør oocytene tilbake til en dråpe KSOMaa (bruk munnstykket) og hold dem i 37 ° C / 5% CO2-inkubatoren, inntil den er lastet for reimplantasjon i ovidukten av pseudo-gravide kvinner.

8. Reimplantasjon

  1. Autoklaver alle rustfrie stål kirurgiske instrumenter.
  2. Bestem musens vekt ved hjelp av veieskalaen og bedøve kvinnene ved intraperitoneal (ip) injeksjon med injiserbare anestetika (ketamin 100 mg / kg, xylazin 10 mg / kg).
  3. Overvåk tapet av tå-nippelreflex og når musen er sedert, legg den på toppen av en varmepute.
  4. Klipp et stort område av pelsen rundt den dorsale midterlinjen av den kvinnelige musen.
  5. Desinfiser den eksponerte huden med alternerende kluter av et aktuelt antiseptisk middel som klorhexidin og 70% etanol.
  6. Utsett reproduktive kanaler etter tradisjonell metode 15 . Lag en 1 cm lang hudinnsnitt parallelt med dorsal midtlinjen, klipp muskelen og ta fat i fettputenEn tang, trekk forsiktig eggstokken ut til den vedlagte ovidukt og livmor er tydelig synlig.
  7. Fest fettputen med en fartøysklemme. Visualiser ovidukten under stereoskopisk mikroskop, og bruk et par mikroskisser til å gjøre et snitt inn i oviduktveggen noen få millimeter oppstrøms for ampulla.
  8. Under det stereoskopiske mikroskopet, legg 25 mikroinjiserte egg inn i glasskapillaret som er koblet til munnstykket (den indre diameteren av kapillæren skal være rundt 120 μm bred). Sett glasskapillaret inn i ovidukten og kast ut til en luftboble er synlig inne i ampulla.
  9. Fjern forsiktig glasskapillaret og legg reproduktive kanaler tilbake i magen. Sutur snittet med 3-0 ikke-absorberbare kirurgiske suturer, så lukk med sårklemmer. Overvåk musen tett til full gjenoppretting.

9. Genotyping Strategies / Sequencing

MERK: Isoler den genomiskeDNA fra 2 mm hale eller ørebiopsier, i henhold til relevante dyreetikkforskrifter.

  1. Rask genomisk DNA-ekstraksjon (tilfeldig integrasjon).
    1. Lyse vevsprøvene (~ 2 mm) ved 95 ° C i 1 time i 100 μl alkalisk lyseringsreagens (25 mM natriumhydroksyd og 0,2 mM EDTA, pH = 12).
    2. Tilsett 100 μl nøytraliserende reagens (40 mM Tris-HCl, pH = 5).
    3. Sentrifuger i 5 minutter ved 12.000 g og 4 ° C.
  2. Høykvalitets genomisk DNA-ekstraksjon (genmålretting).
    1. Tilsett 500 μL halebuffer (50 mM Tris, pH = 8; 100 mM EDTA, pH = 8; 100 mM NaCl; 1% SDS og 0,5 mg / ml proteinase K, tilsettes fersk).
    2. Inkuber over natten ved 55 ° C.
    3. Bland i 5 min ved å invertere (ikke virvel).
    4. Tilsett 250 μL mettet NaCl (6 M) og bland i 5 minutter ved invertering (ikke vortex).
    5. Spinn i 5-10 minutter ved 12.000 xg og 4 ° C og hell supernatanten i nytt rør. Tilsett 500 μL isopropanol og bland i 5 minutter ved å invertere (ikke vortex).
    6. Spinn i 10 minutter ved 12.000 xg og romtemperatur.
    7. Dekanter supernatanten (pellet er usynlig og stikker til røret).
    8. Vask med 1 ml 70% etanol.
    9. Spinn i 5-10 minutter ved 12.000 xg og romtemperatur. Fjern supernatanten med forsiktighet, da den hvite pelleten ikke er klebrig lenger og kan gå tapt.
    10. Lufttørk dette i ~ 1 time.
    11. Tilsett 400 μl TE buffer (10 mM Tris og 1 mM EDTA, pH = 8).
    12. Oppløs DNA ved 55-60 ° C i 2 timer.
  3. Primer design.
    1. Design primere minst 20 bp lang ved hjelp av et beregningsverktøy 19 .
      MERK: For random integrasjon bør primrene hybridisere med transgenet, og generere et tydelig fragment på 200-800 bp. For genmålretting, utform primrene slik at de hybridiserer med det genomiske DNA, genererer en tydelig fRag et par hundre bp rundt kuttstedene. For store innsettinger kan primrene sitte på transgenet, men bekreftelse av målrettet integrasjon skal senere utføres ved bruk av primerpromenad eller lignende teknikk.
  4. PCR genotyping.
    1. For hver genomisk modifikasjon skal du designe en ny PCR-protokoll og teste den empirisk. Vurder lengden av det genererte fragmentet og smeltetemperaturen (Tm) for hvert par primere.
  5. Sekvensering.
    1. For genmålretting, send PCR-produkter til en Sanger-sekvenseringsleverandør.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Nedenfor er arbeidsflytene for mikroinjeksjon i tilfelle av tilfeldig integrering og CRISPR-mediert genmålretting beskrevet ( figur 1 ).

Figur 1
Figur 1: Typisk arbeidsflyt for generering av genetisk modifiserte mus. For tilfeldig integrasjon injiseres det rensede transgenet i pronucleus av befruktede oocytter før ovidukt overføring til plugged fosterhunner. Analyse av avkom er utført ved PCR etter en rask genomisk DNA-ekstraksjon. For CRISPR-genmåling syntetiseres sgRNAer ved hjelp av ikke-kloningsmetoden beskrevet her, og to guider injiseres (sammen med Cas9 mRNA) i cytoplasmaet av befruktede oocytter. Denne strategien brukes til den etterfølgende PCR-baserte analysen av avkom, som krever høyt renset gEnomisk DNA. Vennligst klikk her for å se en større versjon av denne figuren.

Selv om mikroinjeksjonen av oocytter og reimplantasjonen av disse injiserte eggene er de to hovedbegrensningstrinnene som krever tekniske ferdigheter og trening, er kvaliteten på injeksjonsblandingen av største betydning for å kunne generere genetisk modifiserte mus. Kvaliteten på transgenrensingen ( Figur 2A ) og sgRNAs-syntesen ( Figur 3A ) bør systematisk vurderes på analytiske agarosegeler. Potensielle forurensninger av blandingen bør også kontrolleres ved måling av konsentrasjonene med et spektrofotometer, da de forskjellige absorpsjonsverdiene avhenger av renhetsgradens grad (se trinn 1.2.3, 2.2.3.5 og 2.2.5.3).

figur 2B ) og for genmålretting ( figur 3B ). DNA-ekstraksjonsprotokollene er også forskjellige, avhengig av typen eksperimenter; Påfølgende PCR er avhengig av primere som hybridiserer henholdsvis på transgenet eller på det genomiske DNA. Strategiene som presenteres her, tillater enkel feilsøking og effektivisering av hvert trinn som kreves for å produsere genetisk modifiserte mus.

Selv om det kvantitative utfallet av en mikroinjeksjonssession varierer avhengig av eksperimentets erfaring, når hvert trinn i protokollen er optimalisert, skal prosentandelen transgene pupper vanligvis oppnå 10-25% for tilfeldig integrasjonRasjon, som illustrert i figur 2B (4 grunnleggere av 15 pupper født = 26,6%). Denne noe "lave" effektiviteten kontrasterer med pålitelig evne til CRISPR-komponentene til å redigere musgenomet. Faktisk er antallet generatorer som er generert generelt høyere ved bruk av CRISPR for genmålretting og varierer fra 25-100% (se figur 3B ; 3 grunnleggere av 13 pups = 23%). Det er ikke uvanlig å skaffe seg et helt avkom som er vellykket homozygot når de redigeres ved hjelp av CRISPR.

Figur 2
Figur 2: Kvalitetskontroll og genotypingstrategi for vellykket produksjon av transgene mus for overekspresjon. ( A ) Plasmidet fordøyes i 1 time med PvuI og NotI. Fullstendig fordøyelse og korrekte størrelser ( dvs. transgen = 7,338 bp, ryggrad = 1,440+ 896 bp) kontrolleres på en analytisk gel (1). Ekstraksjonen av flere fordøyelsesprodukter fra preparativ gel (2) genererer økt konsentrasjon av transgenet. Langvarig eksponering for UV bør unngås, og bruk av et blått lys i stedet for en UV-transilluminator anbefales. (B) Genotypingstrategi (1): Primrene bør sitte på transgenet og bør utformes for å generere et fragment på 200 - 800 bp. Når genotyping utføres (2), anbefales det å inkludere en positiv kontroll ( dvs. injeksjonsblandingen som brukes til mikroinjeksjon) og en negativ kontroll ( dvs. genomisk DNA fra en WT-mus). Vennligst klikk her for å se en større versjon av denne figuren.

Figur 3
Figur 3: Kvalitetskontroll og genotyping StraTegy for den vellykkede produksjonen av gen-målrettede (KO) mus. ( A ) Kvaliteten av sgRNAene produsert ved in vitro transkripsjon er vurdert ved å kjøre DNA-malen og det genererte RNA parallelt for hver guide. Størrelsen på RNA er litt større enn DNA. Skal kvaliteten være tilfredsstillende ( dvs. ingen smørebånd), måles konsentrasjonene. ( B ) (1) Design av de to guidene (motsatt retninger) som omfatter startkodonet i Exon 1. Primerne velges for å hybridisere med det genomiske DNA utenfor regionen som til slutt blir skåret ut av de to guider. Denne strategien muliggjør typisk direkte identifisering av heterozygote (# 5 og 9) og homozygote (# 3) KO-grunnstanser ved bruk av PCR (2). PCR-produkter fra homozygote dyr viser ikke noe WT-band. Vennligst klikk her for å se en større versjon av denne figuren.

Reaksjon komponenter Volum Merk Syntese av lineær DNA-mal
(2,5) Nukleasefritt vann 97,2 μl 5x HF buffer 36 μl MgCl2 9 μl 10 mM dNTPer 9 μl 10 uM fwd primer 9 μl 5'TTAATACGACTCACTATAGN 20
gttttagagctagaaatagcaagttaaaata
Aggctagtc 3 ' 10 μM rev primer 9 μl 5 'AAAAGCACCGACTCGGTGCC 3' PrO-lesepolymerase 1,8 μl IVT ved hjelp av et T7 RNA syntese kit
(2.6) Nukleasefritt vann X μL Fyll opp til 20 μL totalt volum NTP bufferblanding 10 μl Mal DNA ≈ 300 ng T7 RNA-polymerase 2 μl

Tabell 1: Sammensetning av de forskjellige masterblandingene som brukes i denne studien. Syntese av den lineære DNA-malen: T7-promotorens minimale sekvens (TTAATACGACTCACTATAG) er oppstrøms for 20-bp-sekvensen (guide; N20 identifisert ved hjelp av CRISPR-designverktøyet) og en sekvens komplementær til ekspresjonsvektoren (gttttagagctagaaatagcaagttaaaataaggctagtc). In vitroTranskripsjon (IVT): Avhengig av konsentrasjonen av DNA-malen, bør sluttvolumet justeres til 20 ul med nukleasefritt vann.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Kritiske trinn i protokollen

Genereringen av genetisk modifiserte mus er kjent for å være teknisk utfordrende. Protokollen som presenteres her er imidlertid en optimalisert og forenklet metode som gjør at man kan mestre og feilsøke teknikken i rekordtid. Det er to trinn som er nødvendige for en vellykket gjennomføring av teknikken. For det første kan syntesen av lineære DNA-maler (for syntese av sgRNAer) oppnås uten magnesiumklorid (MgCl2). Imidlertid anbefales det å systematisk legge MgCl 2 til masterblandingen fordi delvis hybridisering av den fremre primer ofte blir forhindret i fravær av MgCl 2 . I tillegg er det kritisk for den målrettede genomiske sekvensen å ikke være tilstede i noen del av donormalen (i tilfelle målrettet integrasjon), ellers vil Cas9-nukleasen kutte den og forhindre forekomsten av HDR.

modifikasjonerOg feilsøking

Selv om denne protokollen for å generere genetisk modifiserte mus har blitt optimalisert og strømlinjeformet gjennom årene, er det noen hensyn knyttet til utbyttet av god kvalitet oocytter for mikroinjeksjon og pluggfrekvensen av fosterhunner. Valg av bakgrunnsstamme er kritisk i forhold til antall levende pups som følge av en mikroinjeksjonssesjon. C57BL / 6 er den mest brukte bakgrunnen for musemodeller av sykdommer. Det er imidlertid også en av de mindre effektive bakgrunnene når det gjelder resistens mot mikroinjeksjon 20 . Videre er kvinnens alder også kritisk for å gi et stort antall oocytter; Det anbefales å unngå mus 5-8 uker, uavhengig av bakgrunnen, da dette er den minst gunstige responsperioden på hormonell stimulering 21 . I vår erfaring gir 3-4 uker gamle C57BL / 6 mus pålitelig 20-30 egg per kvinne. Det er viktig åLegg merke til at en ny teknikk (referert til som ultra-superovulasjon) har produsert opptil 100 egg per kvinne, og har nylig blitt brukt til å generere oocytter for mikroinjeksjon 22 . Imidlertid er bruken av ultra-superovulering for mikroinjeksjon generelt hindret av behovet for kunstig befruktning ( in vitro befruktning) et så stort antall egg.

For å få plugget fosterhunn som er egnet for reimplantasjon, blir kvinnelige mus parret med vasektomiserte hanner (bakgrunnen til disse musene er ikke kritisk). For å øke antall tilkoblede mottakere, kan nøye undersøkelse av estrusstadiet og valg av egnede kvinner utføres 23 . Synkronisering av kvinners sykluser kan også induseres ved å utsette kvinnene for vasektomiserte menn to dager før parring (den såkalte "Whitten effect") 24 .

Begrensninger av teknikken

Svært små genomiske modifikasjoner, som punktmutasjoner, er relativt enkle å generere, men de er vanskelige å identifisere. Når genotyping utføres, sekvenseres PCR-produktene direkte ved Sanger-sekvensering. Imidlertid genererer direkte mikroinjeksjon av CRISPR-komponenter i mus-oocytter ofte mosaikkdyr fordi Cas9 forblir aktiv i ganske lang tid, og forskjellige genomiske modifikasjoner kan oppstå etter den første delingen av oocytten. Denne konfronterende effekten kompliserer identifiseringen av diskrete mutasjoner blant forskjellige alleler, og neste generasjons sekvensering (NGS) kan hjelpe til med utfordrende utlesninger. Følsomme teknikker, som tetra-primerARMS-PCR, 25 kan også bidra til å genotypere kolonien etter identifisering av grunnleggerne ved sekvensering.

Omvendt er det fortsatt utfordrende å sette store deler av DNA på målrettet måte. Jo større eksogent DNA, jo mindre effektiviteten av HDR. Følgelig utvikles nye strategier, som for eksempel bruk av lange ssOligos-donorer (i stedet for plasmider) 26 eller HDR-uavhengig målrettet integrasjon 27 .

Betydningen av protokollen

Denne protokollen presenterer betydelige fremskritt fordi de fire hovedtrinnene ( dvs. forberedelse av transgen- eller CRISPR-komponentene, mikroinjeksjon, reimplantasjon og genotyping) er optimalisert, testet og validert i vårt laboratorium.

Den tilfeldige integrasjonen av transgene er mye brukt for overekspresjonstudier av to hovedårsaker. Først, å unngåID den potensielle "posisjonseffekten", er målrettet integrering av et transgen ved hjelp av CRISPR i "safe harbor" -steder, for eksempel Rosa26 28 og Col1a 29 loci, fortsatt notorisk utfordrende, siden effektiviteten til HDR er lav. Strategier for å overvinne dette problemet er kommende 26 , 27 , men tilfeldig integrasjon har så langt vist seg å være mer effektiv. Dessuten er genereringen av flere transgene linjer som overuttrykker det samme transgenet med forskjellige uttryksnivåer av interesse for studier som involverer behandlingsstrategier for å reversere en fenotype 30 . Plasmidbaserte transgene genereres ved hjelp av kloning, ved bruk av ad hoc- restriksjonsenzymer for å samle essensielle fragmenter for ekspresjon av et protein av interesse. Vanligvis er et transgen laget av minst tre elementer: en egnet promotor (forbedringsområder blir noen ganger lagt til); KodingenSekvens (cDNA), med eller uten introniske regioner; Og en PolyA-hale for å stabilisere mRNA-ekspresjon 31 .

Når det er satt sammen, settes transgenet inn i et plasmid inneholdende bakterielle replikasjonselementer og ekspanderes i kultur etter transformasjon (typisk varmeskokbasert). Rensemetoden for transgene for mikroinjeksjon er kritisk. Dette arbeidet beskriver bruk av DNA-flekker med ny generasjon (lavt toksisitet) for mer nøyaktig visualisering av fragmentet av interesse på gelen (sammenlignet med tradisjonell krystallviolett) og lav mutagene eksponering (sammenlignet med etidiumbromid).

Ikke-kloningsmetoden beskrevet her for genmålretting er meget rask og tillater syntese av flere sgRNAer på bare 5-6 timer. Det kreves bare fire trinn: Identifikasjonen av den målrettede sekvensen, syntesen av en lineær DNA-mal som inneholder en T7-promotor og den valgte målsekvensen, syntesen oF sgRNA ved in vitro transkripsjon (IVT) og rensing av sgRNA ved hjelp av spin-kolonner.

I den tidlige alderen av CRISPR-musgenomdannelse ble den potensielle off-target-effekten systematisk vurdert, selv om den har vist seg å være svært begrenset i musembryoer 32 og lett kan fortynnes ut ved hjelp av et avlssystem hvor utvalgte mus bærer bare Den ønskede genomiske modifikasjon. På-målaktiviteten ble også systematisk forhåndsevaluert in vitro , ved hjelp av forskjellige guider og velg de mer aktive en (e) 12 . Denne praksisen er nå mindre vanlig, av flere grunner. For det første vurderes aktivitetene på mål ved bruk av transfeksjon av immortaliserte muscellelinjer (typisk N2a eller NIH3T3) med CRISPR-kodende plasmider. Dette er en annen metode enn injeksjonen av CRISPR RNA-komponenter i mus-oocytter. Derfor oversetter resultatene som finnes in vitro ikke alltid like myeTil oocytter. Videre viste høy gjennomstrømningsforsøk at de fleste guider er aktive 33 . Følgelig er ikke-målaktivitet vurdert, og hittil har det ikke vært noe bevis på en guide som ikke viser aktivitet i mus-oocytter. Sammen med ikke-kloningsmetoden for å syntetisere sgRNAs, presentert her, forenkles og effektiviserer arbeidsflyten i stor grad, og flere aktive guider kan sømløst syntetiseres på en dag.

CRISPR anses som en "forstyrrende teknologi", som er en innovasjon som endrer måten teknikker utføres på. Når mikroinjeksjon ble etablert, Brinster et al. Viste at cytoplasmatisk transgenese, selv om oppnåelig, forblir for det meste ineffektiv 7 . Følgelig forblir pronuklear mikroinjeksjon den eneste vanlige praksis i nesten 30 år, til den første demonstrasjonen av et vellykket CRISPR-genmålretting i mus. Denne studien viste at cytoplasmisk mikroinjektjon Ion kan generere et lignende eller overlegen utfall sammenlignet med pronukleær levering 12 . Åpenbart, fordi CRISPR-komponenter vanligvis er laget av RNA, er det tydelig at cytoplasma er målrettet. Men selv når det injiseres i cytoplasma, kan donormaler også med hell fremkalle HDR. En høy cytoplasmatisk konsentrasjon av maler muliggjør diffusjon i kjernen. Videre er bruken av piezo-drevet cytoplasmisk mikroinjeksjon 16 ikke et krav. En kort inkubasjon av oocytene med en cytoskeletoninhibitor, slik som Cytochalasin B, øker overlevelsen av oocytene 34 , 35 , noe som gjør det tilstrekkelig til å utføre cytoplasmatiske injeksjoner uten et piezo-slagdriftssystem. På samme måte reduserer bruken av et forbedret kulturmedium, slik som KSOMaa, blokkering i tocelletrinnet og forbedrer embryonets utviklingsevne i forhold til M16-mediumXref "> 36.

En-celle eller to-celle (når dyrket over natten), kan embryoer overføres til ovidukten. Den konvensjonelle prosedyren er ganske invasiv, da det krever å rive bursa som beskytter eggstokken. Det er også teknisk utfordrende, fordi glasskapillaret må settes inn i infundibulum 15 . Metoden som presenteres her er mye lettere å lære, fremkaller ikke potensiell blødning og bevarer integriteten til eggstokken. Det er basert på arbeid utviklet ved Kumamoto University 37 .

Genotyping strategier og sekvensering teknikker er avgjørende for å identifisere potensielle grunnleggere. For tilfeldig integrasjon er utvinningen av genomisk DNA basert på en enkel metode tilpasset Truett et al. 38 . En slik hurtig utvinningsmetode er tilstrekkelig til å identifisere potensielle grunnleggere, siden primrene er konstruert for å hybridisere med transgenet (ofte integrertFungerte som flere kopier). Omvendt krever genmålretting høyt renset genomisk DNA, siden PCR-produktet omfatter den modifiserte genomiske regionen.

For genutkobling genererer den tradisjonelle metoden for injeksjon av et enkelt sgRNA små deletjoner (indeler) eller innsettinger, og slår ut det gen av interesse 12 til slutt. Disse små modifikasjonene er vanskelige å identifisere og krever ofte tidkrevende, ligase-uavhengig kloning og sekvensering for å bekrefte naturen til disse mutasjonene.

I denne protokollen utnyttet vi CRISPR-multipleksing for å utvikle den systematiske saminjeksjonen av to sgRNAer som omfatter startkodonet av et gen av interesse. Dette øker ikke bare sannsynligheten for et genutslag, men også utsnittet av et stykke genomisk DNA med en forhåndsdefinert størrelse (100-300 bp), noe som muliggjør enkel identifisering av grunnleggerne med enkel PCR. Uansett, hvalpe som ikke har den forventede genomiske eXcision kan fortsatt analyseres for små frameshiftmutasjoner, da bare ett sgRNA viste seg å være aktivt. På samme måte, når det gjelder genredigering, bør den systematiske saminjeksjon av to overlappende sgRNAer i motsatte retninger øke effektiviteten til HDR, siden cellereparasjonsmekanismer fortrinnsvis bruker en av de to strengene 39 .

Fremtidige applikasjoner

Den foreliggende protokollen utnytter de nyeste utviklingene i musembryologi og genmålretting 40 for å forenkle og strømline prosessen med å generere ulike sofistikerte musemodeller av menneskelige forhold. Disse modellene spiller en sentral rolle for å bidra til å utvikle vår forståelse av patomekanismer, noe som til slutt hjelper til med utvikling av terapeutiske strategier 2 . Optimalisering og strømlinjeforming av reagensene som kreves for genmålretting eller tilfeldig integrasjon er vidt og lett anvendeligLe til noen andre pattedyrarter, som rotter, kaniner og til og med til store dyr som storfe.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne gir akademiske transgenesetjenester i mus via University of New South Wales Mark Wainwright Analytical Center.

Acknowledgments

Forfatterne takker personalet på dyreanlegget (BRC) for deres løpende støtte. Dette arbeidet ble finansiert av National Health and Medical Research Council og Australian Research Council.

Materials

Name Company Catalog Number Comments
Micropipette 0.1-2.5 μL Eppendorf 4920000016
Micropipette 2 - 20 μL Eppendorf 4920000040
Micropipette 20 - 200 μL Eppendorf 4920000067
Micropipette 100 - 1,000 μL Eppendorf 4920000083
Molecular weight marker  Bioline BIO-33025 HyperLadder 1 kb
Molecular weight marker  Bioline BIO-33056 HyperLadder 100 bp
Agarose Bioline BIO-41025
EDTA buffer Sigma-Aldrich 93296 10x - Dilute to 1x
Ethidium bromide Thermo Fisher Scientific 15585011
SYBR Safe gel stain Invitrogen S33102
Gel extraction kit Qiagen 28706
PCR purification kit (Qiaquick) Qiagen 28106
Vacuum system (Manifold) Promega A7231
Nuclease-free microinjection buffer  Millipore MR-095-10F
Ultrafree-MC microcentrifuge filter  Millipore UFC30GV00
Cas9 mRNA Sigma-Aldrich CAS9MRNA
CRISPR expressing plasmid (px330) Addgene 42230
Nuclease free water Sigma-Aldrich W4502
Phusion polymerase New England Biolabs M0530L
T7 Quick High Yield RNA kit New England Biolabs E2050S
RNA purification spin columns (NucAway) Thermo Fisher Scientific AM10070
ssOligos Sigma-Aldrich OLIGO STANDARD
Donor plasmid Thermo Fisher Scientific GeneArt
Hyaluronidase Sigma-Aldrich H3884
KSOMaa embryo culture medium Zenith Biotech  ZEKS-100
Mineral oil Zenith Biotech  ZSCO-100
M2 Medium Sigma-Aldrich M7167
Cytochalasin B Sigma-Aldrich C6762
Mouthpiece Sigma-Aldrich A5177
Glass microcapillaries Sutter Instrument BF100-78-10
Proteinase K Applichem A3830.0100
Dumont #5 forceps Fine Science Tools  91150-20
Iris scissors Fine Science Tools  91460-11
Vessel clamp Fine Science Tools  18374-43
Wound clips  Fine Science Tools  12040-01
Clips applier  Fine Science Tools  12018-12
Micro-scissors  Fine Science Tools  15000-03
Cauterizer Fine Science Tools  18000-00
Non-absorbable surgical sutures (Ethilon 3-0) Ethicon 1691H
5% CO2 incubator MG Scientific Galaxy 14S
Spectrophotometer Thermo Fisher Scientific Nanodrop 2000c
Thermocycler Eppendorf 6321 000.515
Electrophoresis set up BioRad 1640300
UV Transilluminator BioRad 1708110EDU
Thermocycler Eppendorf 6334000069
Stereoscopic microscope Olympus SZX7
Inverted microscope Olympus IX71
2x Micromanipulators Eppendorf 5188000.012
Oocytes manipulator Eppendorf 5176000.025
Microinjector (Femtojet) Eppendorf 5247000.013
Mice C57BL/6J strain Australian BioResources C57BL/6JAusb 

DOWNLOAD MATERIALS LIST

References

  1. Ittner, L. M. Dendritic function of tau mediates amyloid-beta toxicity in Alzheimer's disease mouse models. Cell. 142, (3), 387-397 (2010).
  2. Ittner, A. Site-specific phosphorylation of tau inhibits amyloid-beta toxicity in Alzheimer's mice. Science. 354, (6314), 904-908 (2016).
  3. Marantz Henig, R. The Monk in the Garden. Mariner books. (2000).
  4. Jaenisch, R., Mintz, B. Simian virus 40 DNA sequences in DNA of healthy adult mice derived from preimplantation blastocysts injected with viral DNA. Proc Natl Acad Sci U S A. 71, (4), 1250-1254 (1974).
  5. Gordon, J. W., Ruddle, F. H. Integration and stable germ line transmission of genes injected into mouse pronuclei. Science. 214, (4526), 1244-1246 (1981).
  6. Gordon, J. W., Scangos, G. A., Plotkin, D. J., Barbosa, J. A., Ruddle, F. H. Genetic transformation of mouse embryos by microinjection of purified DNA. Proc Natl Acad Sci U S A. 77, (12), 7380-7384 (1980).
  7. Brinster, R. L., Chen, H. Y., Trumbauer, M. E., Yagle, M. K., Palmiter, R. D. Factors affecting the efficiency of introducing foreign DNA into mice by microinjecting eggs. Proc Natl Acad Sci U S A. 82, (13), 4438-4442 (1985).
  8. Capecchi, M. R. Gene targeting in mice: functional analysis of the mammalian genome for the twenty-first century. Nat Rev Genet. 6, (6), 507-512 (2005).
  9. Carbery, I. D. Targeted genome modification in mice using zinc-finger nucleases. Genetics. 186, (2), 451-459 (2010).
  10. Sung, Y. H. Knockout mice created by TALEN-mediated gene targeting. Nat Biotechnol. 31, (1), 23-24 (2013).
  11. Jinek, M. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337, (6096), 816-821 (2012).
  12. Wang, H. One-step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering. Cell. 153, (4), 910-918 (2013).
  13. Kang, X. Introducing precise genetic modifications into human 3PN embryos by CRISPR/Cas-mediated genome editing. J Assist Reprod Genet. 33, (5), 581-588 (2016).
  14. Liang, P. CRISPR/Cas9-mediated gene editing in human tripronuclear zygotes. Protein Cell. 6, (5), 363-372 (2015).
  15. Ittner, L. M., Götz, J. Pronuclear injection for the production of transgenic mice. Nat Protoc. 2, (5), 1206-1215 (2007).
  16. Yang, H., Wang, H., Jaenisch, R. Generating genetically modified mice using CRISPR/Cas-mediated genome engineering. Nat Protoc. 9, (8), 1956-1968 (2014).
  17. CRISPR DESIGN. Available from: http://crispr.mit.edu (2017).
  18. Integrated DNA Technologies. Resuspension Calculator. Available from: https://sg.idtdna.com/calc/resuspension/ (2017).
  19. BioTools at UMass Medical School. Primer3: WWW primer tool. Available from: http://biotools.umassmed.edu/bioapps/primer3_www.cgi (2017).
  20. Auerbach, A. B. Strain-dependent differences in the efficiency of transgenic mouse production. Transgenic Res. 12, (1), 59-69 (2003).
  21. Merriman, J. A., Jennings, P. C., McLaughlin, E. A., Jones, K. T. Effect of aging on superovulation efficiency, aneuploidy rates, and sister chromatid cohesion in mice aged up to 15 months. Biol Reprod. 86, (2), 49 (2012).
  22. Nakagawa, Y., et al. Ultra-superovulation for the CRISPR-Cas9-mediated production of gene-knockout, single-amino-acid-substituted, and floxed mice. Biol Open. 5, (8), 1142-1148 (2016).
  23. Byers, S. L., Wiles, M. V., Dunn, S. L., Taft, R. A. Mouse estrous cycle identification tool and images. PLoS One. 7, (4), e35538 (2012).
  24. Whitten, W. K. Modification of the oestrous cycle of the mouse by external stimuli associated with the male. J Endocrinol. 13, (4), 399-404 (1956).
  25. Ye, S., Dhillon, S., Ke, X., Collins, A. R., Day, I. N. An efficient procedure for genotyping single nucleotide polymorphisms. Nucleic Acids Res. 29, (17), E88 (2001).
  26. Yoshimi, K., et al. ssODN-mediated knock-in with CRISPR-Cas for large genomic regions in zygotes. Nat Commun. 7, 10431 (2016).
  27. Suzuki, K., et al. In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration. Nature. (2016).
  28. Soriano, P. Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat Genet. 21, 70-71 (1999).
  29. Liu, X., et al. A targeted mutation at the known collagenase cleavage site in mouse type I collagen impairs tissue remodeling. J Cell Biol. 130, (1), 227-237 (1995).
  30. Ke, Y. D. Short-term suppression of A315T mutant human TDP-43 expression improves functional deficits in a novel inducible transgenic mouse model of FTLD-TDP and ALS. Acta Neuropathol. 130, (5), 661-678 (2015).
  31. Auerbach, A. B. Production of functional transgenic mice by DNA pronuclear microinjection. Acta Biochim Pol. 51, (1), 9-31 (2004).
  32. Iyer, V., et al. Off-target mutations are rare in Cas9-modified mice. Nat Methods. 12, (6), 479 (2015).
  33. Zhou, Y. High-throughput screening of a CRISPR/Cas9 library for functional genomics in human cells. Nature. 509, (7501), 487-491 (2014).
  34. Brinster, R. L., Chen, H. Y., Trumbauer, M. E., Avarbock, M. R. Translation of globin messenger RNA by the mouse ovum. Nature. 283, (5746), 499-501 (1980).
  35. Pinkert, C. A., Irwin, M. H., Johnson, L. W., Moffatt, R. J. Mitochondria transfer into mouse ova by microinjection. Transgenic Res. 6, (6), 379-383 (1997).
  36. Biggers, J. D., Summers, M. C. Choosing a culture medium: making informed choices. Fertil Steril. 90, (3), 473-483 (2008).
  37. Nakagata, N. Embryo transfer through the wall of the fallopian tube in mice. Jikken Dobutsu. 41, (3), 387-388 (1992).
  38. Truett, G. E. Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris (HotSHOT). Biotechniques. 29, (1), 52-54 (2000).
  39. Richardson, C. D., Ray, G., DeWitt, M. A., Curie, G. L., Corn, J. E. Enhancing homology-directed genome editing by catalytically active and inactive CRISPR-Cas9 using asymmetric donor DNA. Nat Biotechnol. 34, (3), 339-344 (2016).
  40. Delerue, F., Ittner, L. M. Genome Editing in Mice Using CRISPR/Cas9: Achievements and Prospects. Clon. Transgen. 4, (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics