Oositlerin Mikroenjeksiyonu ile Genetiği Değiştirilmiş Farelerin Üretilmesi

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Fare oositlerinin mikroenjeksiyonu hem klasik transgenezis ( yani, transgenlerin rastgele bütünleşmesi) hem de CRISPR aracılı gen hedeflemesi için yaygın olarak kullanılır. Bu protokol, kalite kontrolü ve genotiplendirme stratejileri üzerinde özel bir vurguyla mikroenjeksiyondaki en son gelişmeleri gözden geçiriyor.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Delerue, F., Ittner, L. M. Generation of Genetically Modified Mice through the Microinjection of Oocytes. J. Vis. Exp. (124), e55765, doi:10.3791/55765 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Genetik olarak modifiye edilmiş farelerin kullanımı hem fizyolojik hem de patolojik in vivo süreçler üzerinde çalışmalara önemli ölçüde katkıda bulunmuştur. DNA ekspresyon yapılarının fare devirde döllenen oositlere enjekte edilmesi, aşırı ekspresyon için transgenik fareler üretmek için en sık kullanılan teknik olarak kalır. Gen hedeflemesi için CRISPR teknolojisinin kullanıma girmesiyle, döllenmiş oositlere pronükleer enjeksiyon, hem nakavt hem de knockin farelerinin nesline kadar genişletildi. Bu çalışma, enjeksiyon için DNA'nın hazırlanmasını ve gen kontrolü için özel bir vurguyla gen hedeflemesi için CRISPR kılavuzlarının oluşturulmasını açıklamaktadır. Potansiyel kurucuların tespiti için gerekli genotiplendirme prosedürleri kritik öneme sahiptir. CRISPR'nin "çoğullama" yeteneklerinden yararlanan yenilikçi genotipleme stratejileri burada sunulmuştur. Cerrahi işlemler de özetlenmektedir. Birlikte, protokolün aşamaları genin üretilmesini sağlayacaktırImmünoloji, nörobilim, kanser, fizyoloji, gelişim ve diğerleri dahil olmak üzere bir çok araştırma alanı için fare kolonilerinin kurulması için kullanılmıştır.

Introduction

Omurgalılarda ve omurgasız hayvanlarda hayvan modelleri, Alzheimer hastalığı 1 , 2 gibi insan koşullarının patofizyolojisini incelemek için bir araç olmuştur. Ayrıca, hastalık düzenleyicileri aramak ve sonuçta tedaviyi umut ederek yeni tedavi stratejileri geliştirmek için paha biçilemez araçlar. Her model özünde sınırlamalara sahip olsa da, hayvanların tüm sistemik modeller olarak kullanılması, biyomedikal araştırmalar için hayati öneme sahiptir. Bunun nedeni, metabolik ve kompleks fizyolojik ortamın doku kültüründe tamamen simüle edilememesi.

Bugüne kadar, fare birçok avantaja sahip olduğu için genetik manipülasyon için kullanılan en yaygın memeli türüdür. Hastalıklarla ilişkili fizyolojik süreçler ve genler, fareler ve insanlar arasında oldukça korunmaktadır. Fare, insan genosundan bir yıl önce, tam genom dizilimine sahip ilk memeliydi (2002)Ben (2003). Bu genetik bilginin yanı sıra, fare iyi yetiştirme kapasitelerine, hızlı gelişme döngüsüne (fertilizasyondan sütten kesilmeye kadar 6 hafta) ve makul bir boyuta sahiptir. Bütün bu avantajlar, farklı kat renkleri (geçiş stratejileri için gerekli) gibi fizyolojik göstergelerle birleştiğinde fare, genetik manipülasyon için çekici bir model yaptı. Özellikle, modern genetikte çok erken yaşlarda, Gregor Mendel, bitkilere gitmeden önce farelerde çalışmaya başladı 3 .

Gen transferi teknikleri başlangıçta viral doğum kullanılarak yaratılan, ilk otuz yıl önce ilk transjenik fare oluşumuyla sonuçlandı. Bununla birlikte, araştırmacılar kısa sürede, fare transgenezinin ana zorluklarından birinin, eksojen DNA'nın kaderini kontrol edemediğini fark etti. Transgenlerin fare oositlerine viral olarak verilmesi, birden fazla kopyanın genom içine rasgele entegre edilmesine neden olduğundan, olasılıklarDaha sonraki transgenik hatların kurulması sınırlıydı.

Böyle bir kısıtlamaya Gordon ve ark. Ilk transjenik fare hattını mikroenjeksiyon 5 , 6 ile üretti. Bu, rekombinant DNA teknolojisi çağına başladı ve bir mikroenjeksiyon oturumunun sonucunu etkileyen parametreler çokça incelendi. Mikroenjeksiyon, transgenin entegrasyon bölgesinin (sonuçta her bir kurucu fare için spesifik ekspresyon seviyeleri ile sonuçlanır) kontrol edilmesini sağlamasa da, pronükleer mikroenjeksiyonun ana avantajı, konkatemlerin oluşumunda kalmaktadır ( yani, transgenin çoklu kopyalarının dizileri, Seri bağlı) genomik integrasyon öncesi 5 . Bu özellik, ilgilenilen bir geni aşırı ifade eden binlerce transgenik fare hattı kurmak için yıllarca kullanılmıştır. O zamandan beri, transgenesis, birBir organizmanın genomunun doğal tadilatı, hastalıkların ortaya çıkmasında tekli genlerin rolünü tanımlamak için yaygın bir şekilde kullanılmıştır.

Fare genomunun manipüle edilmesinde bir diğer önemli başarı, Mario Capecchi'nin, fare üzerindeki tek bir geni başarıyla bozmasıyla, hedeflenen 8 gen hedefinin açılışında ulaşıldı. Bununla birlikte, büyük dezavantajlar, ES hücrelerinin kültürlenmesindeki zorluklar, biraz değişen kimeriklik derecesi ve sürecin uzunluğu (fare elde etmek için en az 12-18 ay, asgari olarak) dahil olmak üzere ES hücre temelli gen hedeflemesinden hızla çıkmıştır. .

Son zamanlarda, mühendislik endonükleazları ( örneğin, çinko parmak nükleazları (ZFN), transkripsiyon aktivatörü benzeri efektör nükleazları (TALEN) ve düzenli olarak aralıklı kısa palindromik tekrarlar (CRISPR / Cas9) gibi yeni teknolojilerdeki ilerlemeler) alternatif yöntemler olarak ortaya çıkmıştır Mikrofonda gen hedefleme sürecini hızlandırmakE 9 , 10 . Bu endonükleazlar, 6 hafta gibi kısa bir sürede gen hedefli farelerin üretilmesine olanak tanıyan, mikroenjeksiyon yoluyla fare oositlerine kolayca enjekte edilebilir.

Genom düzenleme 11 için CRISPR kullanımıyla ilgili ilk rapordan bu yana, bu bakteriyel adaptif bağışıklık sistemi, sentez kolaylığı ve bir defada birden fazla lokus hedefleme yeteneği de dahil olmak üzere birçok avantajı nedeniyle ZFN ve TALEN'in yerini almıştır ("çoğullama" "). CRISPR ilk farelerde 12 gen hedeflemesi için kullanılmıştır ve o zamandan beri bitkilerden insanlara 13 , 14'e kadar sayısız türün uygulanmıştır. Bugüne kadar, CRISPR genomu düzenine dirençli tek bir türe ilişkin rapor bulunmamaktadır.

Transjenik farelerin üretiminin iki temel sınırlayıcı aşaması oositlerin enjeksiyonu ve reimplantasyonBu oositlerden psödo-gebe kadınlara dönüşür. Bu teknik bizim 15 ve diğerleri16 tarafından tarif edilmesine rağmen, fare embriyolojisinde ve gen transfer tekniklerinde son zamanlardaki teknik gelişmeler, genetiği değiştirilmiş fareler üretme sürecinde devrim yaratmıştır. Bu iyileştirmeler burada açıklanacaktır.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Tüm prosedürler Yeni Güney Galler Hayvan Bakımı ve Etik Kurulu tarafından onaylanmıştır.

1. Transgenin Hazırlanması (Rasgele Entegrasyon)

  1. Analitik agaroz jel elektroforezi.
    1. Üreticinin tavsiyelerini izleyerek uygun bir enzim (1 saat inkübasyon) veya hızlı sindirim enzimleri (15 ila 30 dakika inkübasyon) kullanarak transgeni tüketmek için plazmidi özümleyin (bkz. Şekil 2A ve efsanesi).
    2. 0.5-1.0 ug / mL etidyum bromid (EtBr) ile boyanan% 1 tris-asetat-etilendiamintetraasetik asit (EDTA) (TEA) agaroz jeli dökün.
      NOT: EtBr kullanırken dikkatli olun; Bu güçlü bir mutajendir. Lütfen uygun kişisel koruyucu ekipman kullanın (madde güvenlik bilgi formuna bakın).
    3. 1 kb'lik bir molekül ağırlığı işaretleyicisi yükleyin.
    4. Doğrusallaştırılmış parçaları yükleyin ( yani, transgen ve omurga). Elektroforezi 100 V'de 45 dakika boyunca çalıştırın.
    5. Jelin, sindirimin tamamlandığını kontrol etmek ve transgenin doğru boyutunu teyit etmek için ultraviyole (UV) transilüminatör üzerinde görselleştirin ( ör . 7,338 bp; bkz. Şekil 2A ).
  2. Hazırlayıcı agaroz jel elektroforezi.
    1. Düşük toksisite jel lekesi ile boyanan% 1 TAE agaroz jeli dökün. Bir molekül ağırlığı markörü olmaksızın 8 alikuot (her biri 1 μg) doğrusallaştırılmış transgeni yükleyin ve elektroforezi 100 V'de 45 dakika boyunca çalıştırın. Doğrusallaştırılmış transgene karşılık gelen 8 bandın tümünü çıkarmak için neşter kullanın.
    2. Üreticinin tavsiyelerine uyarak DNA'yı bir jel özütleme kiti kullanarak çıkarın ( Malzeme Tablosuna bakın ).
      1. Jel parçalarını en az 15 dakika boyunca 1.5 mL'lik tüplerde 50 ° C'de eritin. Bunu izopropanol ile çöktürünüz ve daha sonra bağlama tamponunu ekleyin.
      2. Tüm D'yi birleştirNA hepsini tek bir sütuna pipetle atarak. Nükleaz içermeyen mikroenjeksiyon tamponuna (8 mM Tris-HC1 ve 0.15 mM EDTA) elute edin. 0.22 μm'lik mikrosantrifüj filtresinden geçirin ve 12.000 x g'de 60 saniye santrifüjleyin.
    3. Bir spektrofotometre kullanarak DNA konsantrasyonunu ve kalitesini ölçün. A260 / A280 oranının 1.8 civarında olduğunu ( yani, proteinlerin bulaşması olmadığını) ve A260 / A230 oranının en az 2.0 olduğunu kontrol edin ( yani, organik çözücüler tarafından bulaşma olmamalıdır). Nükleaz içermeyen mikroenjeksiyon tamponu, 3 ng / μL'ye kadar seyreltin (20-50 μL) ve -20 ° C'de dondurun.

2. CRISPR Bileşenlerinin Sentezi (Gen Hedefleme)

  1. Cas9 mRNA'sı.
    1. Nazlâksız mikroenjeksiyon tamponunda 1 μg / μL'lik bir konsantrasyona kadar Cas9 mRNA'yı seyreltin (ticari bir kaynaktan elde edin , Malzeme Tablosuna bakın ).
    2. 2 uL'lik kısım ve serbest -80 ° C'de ze.
  2. Tek kılavuz RNA (SgRNA).
    1. İstenilen iki hedefli genomik sekansları (kılavuzları) minimum potansiyel hedef dışı etkinliğe izin veren bir hesaplama tasarım aracı kullanarak belirleyin 17 .
      1. Gen nakavt için, sistematik olarak zıt yönlerde birkaç yüz baz çiftli (bp) bulunan iki kılavuz seçin ve ilgilenilen genin başlangıç ​​kodonu dahil edilir. Homoloji doğrudan onarımı için, birbirine zıt yönlerde birbirine örtüşen iki kılavuz (mümkün olduğunda) seçin.
        NOT: Bir örnek olarak, TPM4.2 geninin ilk ekzonunu bozmak için şu kılavuzlar yakın bir tarihte başarılı bir şekilde enjekte edilmiştir :
        Kılavuz 1: 5 'CGCCATCCAGTTCGCGCTGC 3';
        Kılavuz 2: 5 'CAGAACGATTGAGCTATGGC 3'
    2. Tablo 1'de açıklandığı gibi bir dizi primer sipariş edin.
    3. Doğrusal bir DNA şablonunu sentezleyin.
      1. Seyreltik px330Ref "> 12 plazmitten 10 ng / μL'ye kadar nükleaz içermeyen suda yıkanır.
      2. Ana karışımın Tablo 1'de belirtildiği şekilde hazırlanması. Polimerazı sonunda ekleyin ve ana karışığı buzda tutun.
      3. Karıştırın ve 8 PCR tüpüne bölün (19 uL / ​​tüp). Tüp başına 1 μL px330 ekleyin ve PCR'yi aşağıdaki koşullar altında çalıştırın: 98 ° C'de 1 dakika; 10 saniye için 98 ° C, 30 saniye için 64 ° C ve 15 saniye boyunca 72 ° C'lik 40 döngü; Ve son uzatma 72 ° C'de 5 dakika. 4 ° C'de tutun.
      4. Bir PCR saflaştırma kiti ( Malzeme Tablosuna bakın ), bir manifold ve bir vakum kaynağı (daha hızlı işlem için) kullanarak PCR ürünlerini saflaştırın. Maksimum vakum gücünü uygulayın ( yani, 8 mbar).
        1. PCR örneğinin 1 hacmine 5 hacim (100 μL) bağlama tamponu ilave edin ve karıştırın.
        2. Santrifüjleme için (sağlanan) 2 mL'lik bir toplama tüpüne (sağlanan) silika membran spin sütunu yerleştirin veya vakum işlemi için manifolddaing. DNA'yı bağlamak için, 8 numuneyi sırasıyla sütuna ve vakumda veya santrifüjde, her yük için 12,000 xg'de 60 saniye süreyle uygulayın.
        3. Yıkamak için, sütuna 0.75 mL yıkama tamponu (tampon PE) ilave edin ve 12,000 x g'de 60 s vakum veya santrifüj uygulayın. Kalıntı etanolü gidermek için sütunu 12,000 xg'de 60 saniye boyunca santrifüjleyin.
        4. Sütunu temiz bir 1.5 mL'lik mikrosantrifüj tüpüne yerleştirin. DNA'yı çözmek için membranın merkezine 30 uL nükleaz içermeyen su ekleyin, sütun 1 dakika bekletin ve 12.000 g'da 60 saniye boyunca santrifüjleyin.
      5. Bir spektrofotometre kullanarak konsantrasyonu ölçün; Tipik olarak konsantrasyon 100 ng / μL veya daha yüksek olmalıdır. A260 / A280 oranının 1.8 civarında olduğunu ( yani, proteinlerin bulaşması olmadığını) ve A260 / A230 oranının en az 2.0 olduğunu kontrol edin ( yani, organik çözücüler tarafından bulaşma olmamalıdır).
    4. T7 RNA sentez kiti kullanılarak in vitro transkripsiyon.
      1. HazırlaTablo l' de gösterildiği gibi ana karıştırın ve 3 saat süreyle 37 ° C'de bir termosiklör içinde inkübe edin. 28 μL nükleaz içermeyen su ve 2 μL DNase I ekleyin ve 37 ° C sıcaklıkta başka bir 15 dakika süreyle inkübe edin.
    5. Spin kolonlarını kullanarak RNA saflaştırması.
      1. Verilen spin sütununda bulunan tozu, tüm hava kabarcıklarını dikkatle kaldırarak 650 μL nükleaz içermeyen mikroenjeksiyon tampon çözündürün. Tüpü kapatıp oda sıcaklığında 5 - 15 dakika hidratlayın.
      2. Tabandaki mavi kapağı çıkarıp sütunu 2 mL tüp içine yerleştirin. 750 xg'de ve oda sıcaklığında 2 dakika boyunca santrifüjleyin. Sütunu taze bir 1.5 mL tüp içine yerleştirin ve sütun duvarına dokunmadan ortasına damla damla 50 μL RNA solüsyonu uygulayın. Sütunu 750 x g'de 2 dakika döndürün.
      3. Bir spektrofotometre kullanarak RNA konsantrasyonunu ölçün (bir reaksiyonun tipik verimi 30 - 50 ug'dir). A260 / A280 oranının bir2.0 yuvarlak ( yani, proteinler tarafından kontaminasyon yok) ve A260 / A230 oranı en az 2.0'dır ( yani, organik çözücüler tarafından bulaşma olmamalıdır). Kullanana kadar sgRNA'ları -80 ° C'de saklayın.
      4. DNA elektroforezinde rutin olarak kullanılan% 1 TAE jellerini kullanarak RNA'nın kalitesini değerlendirin. 200-400 ng DNA şablonunu ve karşılık gelen sgRNA'yı paralel olarak çalıştırın. RNA bandı (≈ 100 bp) DNA bandından biraz daha büyük olmalıdır (bkz. Şekil 3A ).

3. Donör Şablon

  1. Nokta mutasyonları veya 50 bp'ye kadar küçük dizilerin entegrasyonu için ticari olarak sentezlenmiş tek sarmallı oligonükleotidleri (s0-0ligos, Malzeme Tablosuna bakın ) sipariş edin; Homoloji kolları tipik olarak 60-90 bp uzunluğundadır.
  2. Daha büyük eklemeler için bir kalıp olarak bir donor plasmid kullanın. Klasik klonlama metodu veya bir yeni molekülün de novo sentezi kullanılarak uygun bir plazmid üretilir.Ticari kaynak.
    NOT: Her bir homoloji kolu için en az 800 bp önerilir. Omurganın boyutu, homoloji doğrudan onarımının (HDR) etkinliği üzerinde hiçbir etkiye sahip değildir.

4. Enjeksiyon Karışımı

  1. Gen nakavt denemeleri için nükleazsız mikroenjeksiyon tamponu kullanarak Cas9 mRNA'sını 50 ng / μL'ye ve sgRNA'ları 12.5 ng / μL'ye (toplam 25 ng / μL) seyreltin. Homoloji doğrudan onarımına dayanan genom düzenleme deneyleri için 200 ng / μL'lik bir konsantrasyonda donör şablonunu (ssOligo veya plazmid) ekleyin.
    NOT: Seyreltme hacimleri, yeniden süspansiyon hesaplayıcı 18 gibi çevrimiçi araçlarla kolaylıkla belirlenebilir.
  2. Mikroenjeksiyon oturumu esnasında her bir alikotu buz üzerinde tutun ve daha sonra atın (enjeksiyon karışımını tekrar dondurmayın).

5. Scrotal Vazektomi

NOT: Farelerde iki tip vazektomi sıklıkla uygulanır: abdominal ve skrotal. İkincisiDaha az invazivdir ve daha önce tarif edilmiştir15.

  1. Tüm paslanmaz çelik cerrahi aletleri otoklavlayın.
  2. Bir tartım ölçeği kullanarak fare ağırlığını belirleyin ve enjekte edilebilir anestetikler (ketamine 100 mg / kg, xylazine 10 mg / kg) ile intraperitoneal (ip) enjeksiyon ile erkekleri anestezi edin.
  3. Parmak çimdik refleksinin kaybolduğunu takip edin ve fare sıkıştığında bir ısıtma yastığının üzerine yerleştirin.
  4. Testis çevresindeki cildi, klorheksidin ve% 70 etanol gibi topikal bir antiseptik mendille yıkayarak dezenfekte edin.
  5. Testisleri skrotal keseye itin ve bir neşter ile cilt kesiği yapın.
  6. Testiste, cauda epididimisinde ve vas deferens'i görselleştirin.
  7. Vas deferens'leri forsepsle tutun, tutun ve vas deferens'in 3 mm'lik kısmını çıkarmak için forsepsin her iki yanına da tarayın.
  8. Aynı işlemi ikinci testis üzerinde yapın.
  9. Cilt insizyonlarını yara klipsleriyle kapatın veTam iyileşene kadar fareyi yakından izleyin.

6. Süperovulasyon (Oosit Bağışçıları) ve Eş zamanlı (Psödo-gebe Dişiler)

NOT: Reimplantasyon için döllenmiş oositlerin ve fişek tutturulmuş dişilerin uygun sayıda üretilmesi için teknik başka bir yerde tanımlanmıştır 15 .

  1. 10 dişeyi, günde 1 I'de 12 I civarı civarında, 5 IU gebe kaltak muayene serum gonadotropini (PMSG; 100 μL'de) ile enjekte edin.
  2. Dişileri, 46-48 saat sonra 5 IU insan koryonik gonadotropin (hCG; 100 μL'de) ile enjekte edin (3. günde saat 11'de).
  3. Dişileri hemen tek evli erkeklerle bir gece çiftleştirin.

7. Pronükleer (rastgele bütünleşme) ve Sitoplazmik (Gen-hedefleme) Enjeksiyonlar

  1. Aşırı hareketli fareleri servikal çıkığıyla yok edin, karın bölgesini açın ve daha önce tarif edildiği gibi 15 yumurtalıklara ve yumurtalara erişin. O parçayı söyleKümülüs-oosit komplekslerini (KOK'ler) bir stereomikorskopta viducts ve hasat eder 15 . Onları geleneksel yöntem 15 izleyerek amino asitler (KSOMaa) ile takviye edilmiş bir damla potasyum simpleks optimizasyon ortamı içine yerleştirin.
  2. Bir aspiratör ağızlı parçası kullanarak KSOMaa ortamı damlasına yaklaşık olarak 1 μL hiyalüronidaz (10 mg / mL) ilave ederek oositleri saflaştırın ve 1 dakika 30 saniye boyunca 37 ° C /% 5 CO 2 kuluçka makinesinde çanağı yerleştirin.
  3. Oositleri aspiratör ağız parçası kullanarak 4 taze damla KSOMaa aracı ile yıkayın ve onları mineral yağı (yaklaşık 2 mL) ile kaplanmış son bir KSOMaa damlası damlasına aktarın. Oositlerin enjeksiyona hazır olana kadar çanağı 37 ° C /% 5 CO 2 inkübatörüne yerleştirin.
  4. Pronükleer enjeksiyon (rasgele entegrasyon).
    1. Yumurtaları stereoskopik mikroskop altında görselleştirin ve enjeksiyon odasına yaklaşık 50 yumurta aktarın (bir droP orta madeni yağ ile kaplanmış M2 ortamı) aspiratör ağız parçası kullanarak.
    2. Enjeksiyon odasını tersine çevrilmiş mikroskopta aktarın ve döllenmiş oositleri (iki görünür pronüklei) enjeksiyon karışımından birkaç pikolitre ile enjekte edin (bir pronukleus hedef alınabilir). Baş dönmesinin şişmesi gözlemlenerek başarılı bir enjeksiyonun görselleştirilmesi.
  5. Sitoplazmik enjeksiyon (gen hedeflemesi).
    1. Ağız parçası kullanılarak 5 μg / mL Cytochalasin B içeren bir damla KSOMaa yaklaşık 50 yumurta aktarın ve 37 ° C /% 5 CO 2 inkübatörde 5 dakika inkübe edin.
    2. Yumurtaları ağız parçasını kullanarak enjeksiyon odasına aktarın.
    3. Mümkün olduğunca otomatik enjektörün kompanzasyon basıncını kullanarak, çok düşük basınçta (50-100 hPa) enjeksiyon karışımının birkaç pikoliteri sitoplazmaya enjekte edin.
    4. Enjeksiyondan sonra, oositleri bir damla KSO'aMaa (ağız parçası kullanarak) ve psödo-gebe kadınların yumurta akışına yeniden implante edilene kadar onları 37 ° C /% 5 CO2 inkübatöründe tutun.

8. Reimplantasyon

  1. Tüm paslanmaz çelik cerrahi aletleri otoklavlayın.
  2. Tartı skalasını kullanarak fare ağırlığını belirleyin ve dişileri, enjekte edilebilir anestetikler (ketamine 100 mg / kg, xylazine 10 mg / kg) ile intraperitoneal (ip) enjeksiyon ile anestezi altına alın.
  3. Parmak çimdik refleksinin kaybolduğunu takip edin ve fare sıkıştığında bir ısıtma yastığının üzerine yerleştirin.
  4. Dişi farenin dorsal orta çizgisinin çevresinde kürkün büyük bir bölümünü klipsleyin.
  5. Maruz kalan deri, klorheksidin ve% 70 etanol gibi topikal bir antiseptik mendille yıkanarak dezenfekte edilir.
  6. Geleneksel yöntemle üreme kanalını açığa vurun 15 . Dorsal orta çizgiye paralel 1 cm uzunluğunda bir cilt insizyonu yapın, kası kesin ve yağ yastığını kapınForseps uygulayın, sonra ovaryumunu bağlı oviduct ve uterusa açıkça görene kadar hafifçe çekin.
  7. Yağ bandını bir damar kelepçesi ile sabitleyin. Stereoskopik mikroskopta yumurta akışını gözünüzde canlandırın ve bir çift mikro makas kullanarak ampülün birkaç milimetre akış yukarıdaki kanalına bir kesi yapın.
  8. Stereoskopik mikroskop altında, ağız parçasına bağlı cam kılcal içine 25 mikroenjeksiyon yumurta yükleyin (kılcal iç çap yaklaşık 120 μm geniş olmalıdır). Cam kılcal boruyu ovıdüktürün içine sokun ve ampülün içinde hava kabarcığı görünene kadar dışarı atın.
  9. Cam kılcal damağı hafifçe çıkarın ve üreme bölgesini karın içine geri koyun. Kesiyi 3-0 emilemez ameliyat dikişleri ile dikin, sonra yara klipsleriyle kapatın. Tam iyileşme sağlanıncaya kadar fareyi yakından izleyin.

9. Genotiplendirme Stratejileri / Sıralaması

NOT: Genomik izole etmekİlgili hayvan etiği yönetmeliklerine uyarak 2 mm kuyruk veya kulak biyopsilerinden DNA.

  1. Hızlı genomik DNA ekstraksiyonu (rasgele entegrasyon).
    1. Doku örneklerini (~ 2 mm), 100 uL alkalin lizis ayıracı (25 mM sodyum hidroksit ve 0.2 mM EDTA, pH = 12) içinde 95 ° C'de 1 saat süreyle lize edin.
    2. 100 μL nötrleştirici reaktif (40 mM Tris-HC1, pH = 5) ekleyin.
    3. 12,000 g ve 4 ° C'de 5 dakika boyunca santrifüjleyin.
  2. Yüksek kaliteli genomik DNA ekstraksiyonu (gen hedeflemesi).
    1. 500 μL kuyruk tamponu (50 mM Tris, pH = 8; 100 mM EDTA, pH = 8; 100 mM NaCl;% 1 SDS ve taze eklenmiş 0.5 mg / mL proteinaz K) ekleyin.
    2. Gecelik 55 ° C'de inkübe edin.
    3. 5 dakika karıştırılarak çevirin (vorteks yapmayın).
    4. 250 μL doymuş NaCl (6 M) ilave edin ve ters çevirerek (vorteks yapmayın) 5 dakika karıştırın.
    5. 5-10 dakika boyunca 12.000 xg ve 4 ° C'de döndürün ve süpernatanı yeni tüpe boşaltın. 500 uL izopropanol ekleyin ve ters çevirerek 5 dakika karıştırın (girdapsız).
    6. 12.000 xg'de ve oda sıcaklığında 10 dakika döndürün.
    7. Süpernatantı boşaltın (pellet görünmezdir ve boruya yapışır).
    8. 1 mL% 70 etanol ile yıkayın.
    9. 12.000 xg'de ve oda sıcaklığında 5-10 dakika döndürün. Yüzen pellet artık yapışkan olmadığından ve kaybolabildiğinden, süpernatanı dikkatlice çıkarın.
    10. Havayı 1 saat kadar kurutun.
    11. 400 uL TE tamponu (10 mM Tris ve 1 mM EDTA, pH = 8) ilave edin.
    12. DNA'yı 55-60 ° C'de 2 saat eritin.
  3. Astar tasarımı.
    1. Hesaplama aracı 19 kullanarak minimum 20 bp dizayn edin.
      NOT: Rasgele entegrasyon için, primerler transgene hibridize edilmeli ve 200-800 bp'lik farklı bir fragman üretilmelidir. Gen hedeflemesi için, primerleri genomik DNA ile hibridize olacak şekilde tasarlayın, farklı bir fKesilen sitelerin etrafında birkaç yüz bp bölün. Büyük eklemeler için, primerler transgene oturabilir, ancak daha sonra primer yürüyüş veya benzeri bir teknik kullanılarak hedeflenen entegrasyonun doğrulanması yapılmalıdır.
  4. PCR genotiplendirme.
    1. Her bir genomik değişiklik için yeni bir PCR protokolü tasarlayın ve ampirik olarak test edin. Üretilen parçanın uzunluğunu ve her primer çiftinin erime sıcaklığını (Tm) göz önünde bulundurun.
  5. Sıralama.
    1. Gen hedeflemesi için, PCR ürünleri Sanger sıralama hizmeti sağlayıcısına gönderin.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Aşağıda, rasgele entegrasyon ve CRISPR aracılı gen hedeflemesi durumunda mikroenjeksiyon için iş akışları açıklanmaktadır ( Şekil 1 ).

Şekil 1
Şekil 1: Genetiği Değiştirilmiş Farelerin Üretimi için Tipik İş Akışı. Rastgele entegrasyon için, saflaştırılmış transgen, döllenmiş oositlerin pronukleusuna, tıkanmış yavru dişilere yumurtadan aktarmadan önce enjekte edilir. Soyun analizi hızlı bir genomik DNA özümlemesinden sonra PCR ile yapılır. CRISPR gen hedeflemesi için sgRNA'lar burada açıklanan klonlamasız yöntem kullanılarak sentezlenir ve iki kılavuz, döllenmiş oositlerin sitoplazmalarına birlikte (Cas9 mRNA ile birlikte) enjekte edilir. Bu strateji, soyun sonraki PCR-temelli analizi için kullanılır, ki bu da yüksek oranda saflaştırılmış gEnomik DNA. Bu rakamın daha büyük bir versiyonunu görmek için lütfen tıklayınız.

Oositlerin mikroenjeksiyonu ve bu enjekte edilen yumurtaların reimplantasyonu teknik becerileri ve eğitimi gerektiren iki temel sınırlayıcı adım olmakla birlikte, enjeksiyon karışımının kalitesi, genetiği değiştirilmiş fareleri başarıyla üretmek için son derece önemlidir. Transgen saflaştırma ( Şekil 2A ) ve sgRNA sentezi ( Şekil 3A ) kalitesi analitik agaroz jelleri üzerinde sistematik olarak değerlendirilmelidir. Karışımın olası kirleticileri, spektrofotometre ile konsantrasyonları ölçerken de kontrol edilmelidir, çünkü farklı absorpsiyon değerleri doğrudan çözeltinin saflığının derecesine bağlıdır (bkz. Adım 1.2.3, 2.2.3.5 ve 2.2.5.3).

Şekil 2B ) hem de gen hedeflemesi ( Şekil 3B ) için bir mikroenjeksiyon oturumunun tipik bir okumasını göstermektedir. DNA ekstraksiyon protokolleri de deney türüne bağlı olarak farklıdır; Sonraki PCR'ler sırasıyla transgen veya genomik DNA üzerinde melezleşen primerlere dayanır. Burada sunulan stratejiler, genetiği değiştirilmiş farelerin üretilmesi için gerekli olan her adımın kolaylıkla giderilmesini ve kolaylaştırılmasını sağlar.

Bir mikroenjeksiyon oturumunun kantitatif sonucu deneycinin deneyimlerine bağlı olarak değişmekle birlikte, protokolün her bir adımı optimize edildiğinde, elde edilen transjenik yavruların yüzdesi tipik olarak rasgele integral için% 10-25'e ulaşmalıdırRasyon, Şekil 2B'de gösterildiği gibi (doğumdan 15 yavrudan 4 kurucu =% 26.6). Bu biraz "düşük" verimlilik, CRISPR bileşenlerinin fare genomunu düzenleme yeteneğiyle ters düşüyor. Genellikle, gen hedefleme için CRISPR kullanıldığında üretilen kurucuların sayısı daha yüksektir ve% 25-100 aralığındadır (bkz. Şekil 3B ; 13 pupdanın 3 kurucusu =% 23). CRISPR kullanılarak düzenlendiğinde başarıyla homozigot olan tüm bir yavru elde etmek nadir değildir.

şekil 2
Şekil 2: Aşırı Ezme İçin Transgenik Farelerin Başarılı Üretimi İçin Kalite Kontrolü ve Genotiplendirme Stratejisi. ( A ) Plazmid PvuI ve NotI ile 1 saat süreyle sindirilir. Tam sindirim ve doğru boyutlar ( örn. Transgen = 7,338 bp, omurga = 1,440+ 896 bp) analitik bir jel üzerinde kontrol edilir (1). Hazırlayıcı jelden (2) birkaç sindirim ürününün çıkarılması, transgenin artmış bir konsantrasyonunu üretir. UV'ye uzun süre maruz kalmaktan kaçınılmalıdır ve bir UV transilluminatör yerine mavi bir ışık kullanılması önerilir. (B) Genotiplendirme stratejisi (1): Primerler transgene oturmalı ve 200 - 800 bp'lik bir fragman oluşturmak üzere tasarlanmalıdır. Genotipleme yapıldığında (2), pozitif bir kontrol ( yani, mikroenjeksiyon için kullanılan enjeksiyon karışımı) ve negatif bir kontrol ( yani, bir WT fare genomik DNA'sı) içermesi önerilir. Bu rakamın daha büyük bir versiyonunu görmek için lütfen tıklayınız.

Şekil 3
Şekil 3: Kalite Kontrolü ve Genotipleme StraGen hedefli (KO) Fareler Başarılı Üretim için tegy. ( A ) In vitro transkripsiyonla üretilen sgRNA'ların kalitesi, DNA şablonunun ve üretilen RNA'nın her rehber için paralel olarak değerlendirilmesi ile değerlendirilir. RNA'nın boyutu DNA'dan biraz daha büyüktür. Kalitenin tatminkâr olması durumunda ( yani smear bandı yok) konsantrasyonlar ölçülür. ( B ) (1) Ekson 1'deki Başlangıç ​​kodonunu kapsayan iki kılavuzun (ters yönler) tasarımı. Primerler, sonunda iki kılavuz tarafından eksize edilen bölge dışındaki genetik DNA ile hibridize olacak şekilde seçilir. Genellikle, bu strateji, PCR (2) kullanarak heterozigot (# 5 ve 9) ve homozigot (# 3) KO kurucularının doğrudan tanımlanmasını sağlar. Homozigot hayvanların PCR ürünleri herhangi bir WT bandı göstermemektedir. Bu rakamın daha büyük bir versiyonunu görmek için lütfen tıklayınız.

reaksiyon Bileşenler hacim Not Doğrusal DNA şablonunun sentezi
(2.5) Nükleaz serbest su 97.2 uL 5x HF tampon 36 uL MgCl2 9 uL 10 mM dNTP'ler 9 uL 10 uM fwd primer 9 uL 5'TTAATACGACTCACTATAGN 20
gttttagagctagaaatagcaagttaaaata
Aggctagtc 3 ' 10 uM devir primeri 9 uL 5 'AAAAGCACCGACTCGGTGCC 3' PrOkuma-okuma polimeraz 1.8 uL T7 RNA sentez kiti kullanarak IVT
(2.6) Nükleaz serbest su X μL Toplam hacim olarak 20 mcL'ye kadar olun NTP tampon karışımı 10 uL Şablon DNA ≈ 300 ng T7 RNA polimeraz 2 μL

Tablo 1: Bu Çalışmada Kullanılan Farklı Ana Karışımların Bileşimi. Doğrusal DNA şablonunun sentezi: T7 promotör minimal dizisi (TTAATACGACTCACTATAG), 20 bp'lik dizinin (kılavuz; CR20PB tasarım aracı kullanılarak tanımlanan N20) yukarı akış ve ekspresyon vektörüne tamamlayıcı bir dizilim (gttttagagctagaaagagagagttaaaaaagtcttagtc) 'dir. In vitroTranskripsiyon (IVT): DNA şablonunun konsantrasyonuna bağlı olarak nihai hacim, nükleaz içermeyen su ile 20 μL'ye ayarlanmalıdır.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Protokol dahilinde kritik adımlar

Genetiği değiştirilmiş farelerin üretimi teknik açıdan zorlayıcı olarak bilinir. Bununla birlikte, burada sunulan protokol tekniğin rekor düzeyde hakim olmasına ve gidermesine olanak tanıyan optimize edilmiş ve basitleştirilmiş bir yöntemdir. Tekniğin başarılı bir şekilde tamamlanması için iki adım vardır. Birincisi, lineer DNA şablonlarının sentezi (sgRNA'ların sentezi için) magnezyum klorid (MgCl2) olmadan başarılabilir. Bununla birlikte, sistemik olarak MgCl2'yi ana kartere eklemek çok önemlidir, çünkü ileri primerin kısmi hibridizasyonu sıklıkla MgCl2 yokluğunda engellenir. Buna ek olarak, hedeflenen genomik dizinin donör şablonunun herhangi bir bölümünde (hedef entegrasyon durumunda) bulunmaması kritiktir, aksi halde, Cas9 nükleazı onu keserek HDR oluşumunu önleyecektir.

DeğişikliklerVe sorun giderme

Genetik olarak modifiye edilmiş fareler üretmek için bu protokol yıllar içinde optimize edilmiş ve hızlandırılmış olmasına rağmen, mikroenjeksiyon için kaliteli oositlerin verimi ve koruyucu çocukların takılma oranı ile ilgili bazı hususlar vardır. Arka plan gerginlik seçimi, bir mikroenjeksiyon oturumundan kaynaklanan canlı canlı yavruların sayısı açısından kritiktir. C57BL / 6, fare hastalık modelleri için en yaygın kullanılan arka plantır. Bununla birlikte, aynı zamanda mikroenjeksiyona karşı direnç bakımından daha az etkin arka planlardan biridir 20 . Ayrıca, dişi yaş çok sayıda oosit üretmek için kritik önem taşır; Hormonal uyarıma cevap vermenin en az olumlu olanı olduğu için, arka plandan bağımsız olarak 5-8 haftalık farelerden kaçınması önerilir21. Deneyimlerimize göre, 3 ila 4 haftalık C57BL / 6 fareler kadın başına 20-30 yumurta üretmektedir. Bu önemliYeni bir teknik (ultra superovulation olarak anılacaktır) her bir kadında 100 yumurta üretti ve son zamanlarda mikroenjeksiyon 22 için oosit üretmek için kullanılmıştır. Bununla birlikte, mikroenjeksiyon için ultra süperovulasyonun kullanımı genellikle çok sayıda yumurta yapay olarak gübreleme ( in vitro fertilizasyon) ihtiyacıyla engellenir.

Reimplantasyona uygun takılı dişçi köpeği elde etmek için, dişi fareler vazektomize edilmiş erkeklerle eşleştirilir (bu farelerin arka planı kritik değildir). Takılan alıcıların sayısını artırmak için östrüs evresinin dikkatle incelenmesi ve uygun dişilerin seçilmesi yapılabilir. Kadınların sikluslarının senkronizasyonu, çiftleşmeden iki gün önce dişileri vazektomize edilmiş erkeklere maruz bırakarak ("Whitten etkisi" olarak adlandırılır) 24 neden olabilir .

Tekniğin sınırlamaları

Nokta mutasyonları gibi çok küçük genomik modifikasyonların nispeten üretilmesi oldukça kolaydır fakat tanımlanması zordur. Genotipleme yapıldığında, PCR ürünleri doğrudan Sanger dizilemesi ile dizilenir. Bununla birlikte, CRISPR bileşenlerinin fare oositlerine direkt olarak mikroenjeksiyonu mozaik hayvanlara neden olur, çünkü Cas9 oldukça uzun süre aktif kalır ve oositin ilk bölünmesinden sonra farklı genomik modifikasyonlar meydana gelebilir. Bu karıştırıcı etki, çeşitli aleller arasındaki ayrı mutasyonların tanımlanmasını zorlaştırır ve yeni nesil sıralama (NGS), okunması zor olan konulara yardımcı olabilir. Hassas teknikler, örneğin tetra-primerARMS-PCR, 25 kurucuların dizilimle tanımlanmasından sonra koloni genotiplendirmesinde de yardımcı olabilir.

Tersine, büyük DNA parçalarını hedefe yönelik bir biçimde eklemek zorlu kalır. Eksojen DNA ne kadar büyükse, HDR'nin etkinliği o kadar az olur. Sonuç olarak, günümüzde plazmid yerine uzun süren bağışçıların kullanımı veya HDR'den bağımsız hedeflenen entegrasyon 27 gibi yeni stratejiler geliştirilmektedir.

Protokolün önemi

Bu protokol, dört ana aşamayı ( yani, transgen veya CRISPR bileşenlerini hazırlama, mikroenjeksiyon, reimplantasyon ve genotipleme) laboratuarımızda optimize etmiş, test etmiş ve doğrulamış olduğundan önemli ilerlemeler sunmaktadır.

Transgenlerin rastgele entegrasyonu aşırı ifade çalışmalarında iki ana nedenden dolayı yaygın olarak kullanılmaktadır. Önce, avoyaPotansiyel "pozisyon etkisi", CRRSPR'yi Rosa26 28 ve Col1a 29 lokasyonları gibi "güvenli liman" lokülerinde hedefleyen entegrasyon, HDR'nin etkinliği düşük olduğu için kötü bir iddia olmaya devam ediyor. Bu sorunun üstesinden gelebilecek stratejiler 26 , 27 önümüzdeki günlerde ancak rastgele entegrasyon şimdiye kadar daha verimli kanıtladı. Ayrıca, aynı transgeni farklı ifade seviyeleri ile aşırı miktarda eksprese eden çoklu transgenik çizgilerin üretilmesi, bir fenotip 30'u tersine çevirmek için tedavi stratejileri içeren çalışmalarda ilgi çekicidir. Plazmid bazlı transgenler, ilgilenilen bir proteinin ekspresyonu için gerekli parçaları birleştirmek için ad hoc restriksiyon enzimleri kullanılarak klonlama vasıtasıyla üretilir. Genellikle, bir transgen en az üç elementten oluşur: uygun bir promotör (bazen arttırıcı bölgeler eklenir); KodlamaIntronik bölgeleri olan veya olmayan, dizi (cDNA); Ve mRNA ekspresyonunu stabilize etmek için bir PolyA kuyruğu 31 .

Bir araya getirildikten sonra, transgen bakteriyel replikasyon elementleri içeren bir plasmid içerisine sokulur ve transformasyondan sonra kültürde genleşir (tipik olarak ısı-şok esaslı). Mikroenjeksiyon için transgenlerin saflaştırma yöntemi kritik önem taşır. Bu çalışma, jel üzerinde (geleneksel kristal mor ile karşılaştırıldığında) ilgi parçasının daha doğru görüntülenmesi ve düşük mutajenik maruziyetin (etidyum bromid ile karşılaştırıldığında) yeni nesil (düşük toksiklik) DNA lekelerinin kullanımını açıklamaktadır.

Burada gen hedeflemesi için tarif edilen klonlamasız yöntem çok hızlıdır ve sadece birkaç saat içinde sentezlenmesine izin verir. Yalnızca dört adım gereklidir: hedeflenen sekansın tanımlanması, bir T7 promotörünü içeren bir doğrusal DNA şablonunun sentezi ve seçilen hedef sekans, sentez oF in vitro transkripsiyon (IVT) ile sgRNA ve spin kolonlarını kullanarak sgRNA'nın saflaştırılması.

CRISPR fare genomu düzenlemesinin erken döneminde, fare embriyolarında çok sınırlı olduğu gösterilmiş olmasına ve ancak seçilen farelerin sadece taşıyan bir ıslah planı ile kolaylıkla seyreltilebildiği halde, potansiyel hedef dışı etki sistematik olarak değerlendirilmiştir Istenen genomik modifikasyon. Hedeflenen aktivite ayrıca, farklı kılavuzları kullanarak ve daha aktif olanları seçerek, in vitro olarak sistematik olarak ön değerlendirildi ( 12) . Bu uygulama birkaç nedenden dolayı daha az yaygındır. Birincisi, hedef üzerinde aktivite ölümsüzleştirilmiş fare hücre hatlarının (tipik olarak N2a veya NIH3T3) CRISPR kodlayan plasmidlerle transfeksiyonu kullanılarak değerlendirilir. Bu, CRISPR RNA bileşenlerini fare oositlerine enjekte etmekten farklı bir yöntemdir. Bu nedenle, in vitro bulunan sonuçlar her zaman eşit derecede tercüme edilmezOositlere. Ayrıca, yüksek verimli deneyler, kılavuzların çoğunun aktif olduğunu gösteriyor 33 . Sonuç olarak, hedef üzerinde aktivite değerlendirilmez ve şu ana kadar fare oositlerinde aktivite göstermeyen bir rehberin kanıtı yoktur. Burada sunulan sgRNA'ları sentezlemek için klonlamayan yöntemle birlikte, bu, iş akışını büyük ölçüde basitleştirir ve düzenler ve bir günde birden fazla aktif kılavuzlar sorunsuz bir şekilde sentezlenebilir.

CRISPR, teknikleri gerçekleştirme biçimini değiştiren bir yenilik olan "yıkıcı bir teknoloji" olarak düşünülür. Mikroenjeksiyon yapıldığında, Brinster ve ark. Elde edilebilir olmasına rağmen sitoplazmik transgenezisin çoğunlukla yetersiz kaldığını gösterdi 7 . Sonuç olarak, farelerde hedeflenen başarılı bir CRISPR geninin ilk gösterilene kadar, pronükleer mikroenjeksiyon neredeyse 30 yıldır yaygın olan tek uygulama haline geldi. Bu çalışma, sitoplazmik mikroenjeksiyon Iyon, pronükleer doğum ile karşılaştırıldığında benzer veya daha üstün bir sonuç üretebilir 12 . Açıkçası, CRISPR bileşenleri tipik olarak RNA'dan yapıldığı için, sitoplazmanın hedeflendiği açıktır. Bununla birlikte, sitoplazma enjekte edildiğinde dahi, donör şablonları HDR'yi başarıyla indükleyebilir. Şablonların yüksek bir sitoplazmik konsantrasyonu çekirdeğe yayılmasını sağlar. Dahası, piezo-tahrikli sitoplazmik mikroenjeksiyon 16 kullanımı da şart değildir. Oositlerin, Sitokalasin B gibi bir sitoskeleton inhibitörü ile kısa bir inkübasyonu oositlerin 34 , 35 yaşamsallığını arttırır, bu da pıgmento darbe tahrik sistemi olmadan sitoplazmik enjeksiyonlar yapmak için yeterli olur. Benzer bir şekilde, KSOMaa gibi geliştirilmiş bir kültür ortamının kullanılması, iki hücreli evredeki tıkanmayı azaltmakta ve embriyonların gelişim kapasitelerini M16 ortamı ile karşılaştırıldığında iyileştirmektedirXref "> 36.

Tek hücreli veya iki hücreli (gece boyunca ekildiklerinde) embriyolar ovidukt'a aktarılabilir. Ovaryumu koruyan bursa yırtılmayı gerektirdiğinden konvansiyonel prosedür oldukça invazivdir. Ayrıca, teknik açıdan zorlayıcı bir durumdur, çünkü cam kılcal infüzyon borusuna takılmalıdır 15 . Burada sunulan yöntem öğrenilmesi daha kolaydır, potansiyel kanamaya yol açmaz ve yumurtalık bütünlüğünü korur. Kumamoto Üniversitesi'nde 37 geliştirilen çalışmaya dayanıyor.

Genotipleme stratejileri ve sıralama teknikleri, potansiyel kurucuları belirlemek için kritik önem taşır. Rastgele entegrasyon için, genomik DNA ekstraksiyonu, Truett ve diğerleri tarafından uyarlanmış basit bir metodu temel alır . 38 . Böyle hızlı bir ekstraksiyon yöntemi potansiyel kurucuları belirlemek için yeterlidir, çünkü primerler transgen ile hibridize olacak şekilde tasarlanmıştır (çoğunlukla integrBirden çok kopya olarak ated). Tersine, PCR hedefi modifiye edilmiş genomik bölgeyi kapsadığı için gen hedeflemesi oldukça saflaştırılmış genomik DNA gerektirir.

Gen nakavt için, tek bir sgRNA enjekte etmek için geleneksel yöntem, küçük silme (indels) veya en sonunda ilgi genini nakavt, eklemeler oluşturur 12 . Bu küçük değişikliklerin tanımlanması zordur ve bu mutasyonların doğasını teyit etmek için çoğu zaman zaman alıcı, ligazdan bağımsız klonlama ve sekanslama gerektirir.

Bu protokolde, ilgi konusu bir genin başlangıç ​​kodonunu kapsayan iki sgRNA'nın sistematik ortak enjeksiyonunu geliştirmek için CRISPR çoğullamadan yararlandık. Bu sadece bir genin nakavt edilme ihtimalini arttırmakla kalmaz, aynı zamanda basit PCR ile kurucuların kolayca tanımlanmasına olanak tanıyan önceden tanımlanmış bir boyuttaki (100-300 bp) bir genomik DNA yığınının eksizyonunu da arttırır. Not, beklenen genomik e'yi taşımayan yavrularYalnızca bir sgRNA aktif olduğunu kanıtladığında, küçük çerçeve kaydırma mutasyonları için xcision hala analiz edilebilir. Benzer şekilde, gen düzenleme durumunda, hücre onarım mekanizmaları tercihan iki iplikçikten 39 birini kullandığından zıt yönlerde iki örtüşen sgRNA'nın sistematik olarak birlikte enjekte edilmesi HDR'nin etkinliğini arttırmalıdır.

Gelecekteki uygulamalar

Mevcut protokol, fare embriyolojisinde ve gen hedefleme 40'daki en son gelişmelerden faydalanarak, sofistike insan koşulları fare modelleri üretme sürecini kolaylaştırıyor ve düzenler. Bu modeller, patomekanizmalar hakkındaki anlayışımızı geliştirmemize yardımcı olarak, sonuçta terapötik stratejilerin geliştirilmesinde yardımcı olmakta önemli bir rol oynar 2 . Gen hedeflemesi veya rasgele entegrasyon için gerekli reaktiflerin optimizasyonu ve hızlandırılması yaygın olarak ve kolayca uygulanabilirSıçanlar, tavşanlar ve hatta sığır gibi büyük hayvanlara kadar herhangi bir başka memeli türde bulaştırır.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar, Yeni Güney Galler Üniversitesi Mark Wainwright Analitik Merkezi aracılığıyla farelerde akademik transgenesis hizmetleri sunmaktadır.

Acknowledgments

Yazarlar, devam eden destekleri için hayvan tesisi personeline (BRC) teşekkür ederler. Bu çalışma Ulusal Sağlık ve Tıbbi Araştırma Konseyi ve Avustralya Araştırma Konseyi tarafından finanse edildi.

Materials

Name Company Catalog Number Comments
Micropipette 0.1-2.5 μL Eppendorf 4920000016
Micropipette 2 - 20 μL Eppendorf 4920000040
Micropipette 20 - 200 μL Eppendorf 4920000067
Micropipette 100 - 1,000 μL Eppendorf 4920000083
Molecular weight marker  Bioline BIO-33025 HyperLadder 1 kb
Molecular weight marker  Bioline BIO-33056 HyperLadder 100 bp
Agarose Bioline BIO-41025
EDTA buffer Sigma-Aldrich 93296 10x - Dilute to 1x
Ethidium bromide Thermo Fisher Scientific 15585011
SYBR Safe gel stain Invitrogen S33102
Gel extraction kit Qiagen 28706
PCR purification kit (Qiaquick) Qiagen 28106
Vacuum system (Manifold) Promega A7231
Nuclease-free microinjection buffer  Millipore MR-095-10F
Ultrafree-MC microcentrifuge filter  Millipore UFC30GV00
Cas9 mRNA Sigma-Aldrich CAS9MRNA
CRISPR expressing plasmid (px330) Addgene 42230
Nuclease free water Sigma-Aldrich W4502
Phusion polymerase New England Biolabs M0530L
T7 Quick High Yield RNA kit New England Biolabs E2050S
RNA purification spin columns (NucAway) Thermo Fisher Scientific AM10070
ssOligos Sigma-Aldrich OLIGO STANDARD
Donor plasmid Thermo Fisher Scientific GeneArt
Hyaluronidase Sigma-Aldrich H3884
KSOMaa embryo culture medium Zenith Biotech  ZEKS-100
Mineral oil Zenith Biotech  ZSCO-100
M2 Medium Sigma-Aldrich M7167
Cytochalasin B Sigma-Aldrich C6762
Mouthpiece Sigma-Aldrich A5177
Glass microcapillaries Sutter Instrument BF100-78-10
Proteinase K Applichem A3830.0100
Dumont #5 forceps Fine Science Tools  91150-20
Iris scissors Fine Science Tools  91460-11
Vessel clamp Fine Science Tools  18374-43
Wound clips  Fine Science Tools  12040-01
Clips applier  Fine Science Tools  12018-12
Micro-scissors  Fine Science Tools  15000-03
Cauterizer Fine Science Tools  18000-00
Non-absorbable surgical sutures (Ethilon 3-0) Ethicon 1691H
5% CO2 incubator MG Scientific Galaxy 14S
Spectrophotometer Thermo Fisher Scientific Nanodrop 2000c
Thermocycler Eppendorf 6321 000.515
Electrophoresis set up BioRad 1640300
UV Transilluminator BioRad 1708110EDU
Thermocycler Eppendorf 6334000069
Stereoscopic microscope Olympus SZX7
Inverted microscope Olympus IX71
2x Micromanipulators Eppendorf 5188000.012
Oocytes manipulator Eppendorf 5176000.025
Microinjector (Femtojet) Eppendorf 5247000.013
Mice C57BL/6J strain Australian BioResources C57BL/6JAusb 

DOWNLOAD MATERIALS LIST

References

  1. Ittner, L. M. Dendritic function of tau mediates amyloid-beta toxicity in Alzheimer's disease mouse models. Cell. 142, (3), 387-397 (2010).
  2. Ittner, A. Site-specific phosphorylation of tau inhibits amyloid-beta toxicity in Alzheimer's mice. Science. 354, (6314), 904-908 (2016).
  3. Marantz Henig, R. The Monk in the Garden. Mariner books. (2000).
  4. Jaenisch, R., Mintz, B. Simian virus 40 DNA sequences in DNA of healthy adult mice derived from preimplantation blastocysts injected with viral DNA. Proc Natl Acad Sci U S A. 71, (4), 1250-1254 (1974).
  5. Gordon, J. W., Ruddle, F. H. Integration and stable germ line transmission of genes injected into mouse pronuclei. Science. 214, (4526), 1244-1246 (1981).
  6. Gordon, J. W., Scangos, G. A., Plotkin, D. J., Barbosa, J. A., Ruddle, F. H. Genetic transformation of mouse embryos by microinjection of purified DNA. Proc Natl Acad Sci U S A. 77, (12), 7380-7384 (1980).
  7. Brinster, R. L., Chen, H. Y., Trumbauer, M. E., Yagle, M. K., Palmiter, R. D. Factors affecting the efficiency of introducing foreign DNA into mice by microinjecting eggs. Proc Natl Acad Sci U S A. 82, (13), 4438-4442 (1985).
  8. Capecchi, M. R. Gene targeting in mice: functional analysis of the mammalian genome for the twenty-first century. Nat Rev Genet. 6, (6), 507-512 (2005).
  9. Carbery, I. D. Targeted genome modification in mice using zinc-finger nucleases. Genetics. 186, (2), 451-459 (2010).
  10. Sung, Y. H. Knockout mice created by TALEN-mediated gene targeting. Nat Biotechnol. 31, (1), 23-24 (2013).
  11. Jinek, M. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337, (6096), 816-821 (2012).
  12. Wang, H. One-step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering. Cell. 153, (4), 910-918 (2013).
  13. Kang, X. Introducing precise genetic modifications into human 3PN embryos by CRISPR/Cas-mediated genome editing. J Assist Reprod Genet. 33, (5), 581-588 (2016).
  14. Liang, P. CRISPR/Cas9-mediated gene editing in human tripronuclear zygotes. Protein Cell. 6, (5), 363-372 (2015).
  15. Ittner, L. M., Götz, J. Pronuclear injection for the production of transgenic mice. Nat Protoc. 2, (5), 1206-1215 (2007).
  16. Yang, H., Wang, H., Jaenisch, R. Generating genetically modified mice using CRISPR/Cas-mediated genome engineering. Nat Protoc. 9, (8), 1956-1968 (2014).
  17. CRISPR DESIGN. Available from: http://crispr.mit.edu (2017).
  18. Integrated DNA Technologies. Resuspension Calculator. Available from: https://sg.idtdna.com/calc/resuspension/ (2017).
  19. BioTools at UMass Medical School. Primer3: WWW primer tool. Available from: http://biotools.umassmed.edu/bioapps/primer3_www.cgi (2017).
  20. Auerbach, A. B. Strain-dependent differences in the efficiency of transgenic mouse production. Transgenic Res. 12, (1), 59-69 (2003).
  21. Merriman, J. A., Jennings, P. C., McLaughlin, E. A., Jones, K. T. Effect of aging on superovulation efficiency, aneuploidy rates, and sister chromatid cohesion in mice aged up to 15 months. Biol Reprod. 86, (2), 49 (2012).
  22. Nakagawa, Y., et al. Ultra-superovulation for the CRISPR-Cas9-mediated production of gene-knockout, single-amino-acid-substituted, and floxed mice. Biol Open. 5, (8), 1142-1148 (2016).
  23. Byers, S. L., Wiles, M. V., Dunn, S. L., Taft, R. A. Mouse estrous cycle identification tool and images. PLoS One. 7, (4), e35538 (2012).
  24. Whitten, W. K. Modification of the oestrous cycle of the mouse by external stimuli associated with the male. J Endocrinol. 13, (4), 399-404 (1956).
  25. Ye, S., Dhillon, S., Ke, X., Collins, A. R., Day, I. N. An efficient procedure for genotyping single nucleotide polymorphisms. Nucleic Acids Res. 29, (17), E88 (2001).
  26. Yoshimi, K., et al. ssODN-mediated knock-in with CRISPR-Cas for large genomic regions in zygotes. Nat Commun. 7, 10431 (2016).
  27. Suzuki, K., et al. In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration. Nature. (2016).
  28. Soriano, P. Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat Genet. 21, 70-71 (1999).
  29. Liu, X., et al. A targeted mutation at the known collagenase cleavage site in mouse type I collagen impairs tissue remodeling. J Cell Biol. 130, (1), 227-237 (1995).
  30. Ke, Y. D. Short-term suppression of A315T mutant human TDP-43 expression improves functional deficits in a novel inducible transgenic mouse model of FTLD-TDP and ALS. Acta Neuropathol. 130, (5), 661-678 (2015).
  31. Auerbach, A. B. Production of functional transgenic mice by DNA pronuclear microinjection. Acta Biochim Pol. 51, (1), 9-31 (2004).
  32. Iyer, V., et al. Off-target mutations are rare in Cas9-modified mice. Nat Methods. 12, (6), 479 (2015).
  33. Zhou, Y. High-throughput screening of a CRISPR/Cas9 library for functional genomics in human cells. Nature. 509, (7501), 487-491 (2014).
  34. Brinster, R. L., Chen, H. Y., Trumbauer, M. E., Avarbock, M. R. Translation of globin messenger RNA by the mouse ovum. Nature. 283, (5746), 499-501 (1980).
  35. Pinkert, C. A., Irwin, M. H., Johnson, L. W., Moffatt, R. J. Mitochondria transfer into mouse ova by microinjection. Transgenic Res. 6, (6), 379-383 (1997).
  36. Biggers, J. D., Summers, M. C. Choosing a culture medium: making informed choices. Fertil Steril. 90, (3), 473-483 (2008).
  37. Nakagata, N. Embryo transfer through the wall of the fallopian tube in mice. Jikken Dobutsu. 41, (3), 387-388 (1992).
  38. Truett, G. E. Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris (HotSHOT). Biotechniques. 29, (1), 52-54 (2000).
  39. Richardson, C. D., Ray, G., DeWitt, M. A., Curie, G. L., Corn, J. E. Enhancing homology-directed genome editing by catalytically active and inactive CRISPR-Cas9 using asymmetric donor DNA. Nat Biotechnol. 34, (3), 339-344 (2016).
  40. Delerue, F., Ittner, L. M. Genome Editing in Mice Using CRISPR/Cas9: Achievements and Prospects. Clon. Transgen. 4, (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics