הצלה אפיון של וירוס רקומביננטי מעולם חדש Zika וירוס זיהום מזוהם

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

פרוטוקול זה מתאר את ההתאוששות של וירוס זיהום זיהומיות משני שיבוט cDNA שני פלסמיד זיהומיות.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Weger-Lucarelli, J., Duggal, N. K., Brault, A. C., Geiss, B. J., Ebel, G. D. Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone. J. Vis. Exp. (124), e55857, doi:10.3791/55857 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

שיבוטים cDNA זיהומיות לאפשר מניפולציה גנטית של הנגיף, ובכך להקל על עבודה על חיסונים, פתוגנזה, שכפול, שידור האבולוציה ויראלי. כאן אנו מתארים את הבנייה של שיבוט זיהומיות עבור Zika וירוס (ZIKV), אשר כרגע גורם להתפרצות נפץ באמריקה. כדי למנוע רעילות לחיידקים, כי הוא נצפה בדרך כלל עם פלסמידים הנגזרים flavivirus, יצרנו מערכת שני פלסמיד המפריד בין הגנום בגן NS1 והוא יציב יותר מאשר באורך מלא בונה שלא ניתן לשחזר בהצלחה ללא מוטציות. לאחר עיכול קשירת להצטרף שני קטעים, RNA ויראלי באורך מלא יכול להיווצר על ידי שעתוק במבחנה עם פולימרז T7 RNA. בעקבות electroporation של RNA transcribed לתאים, וירוס היה התאושש כי הציג דומה קינטיקה הצמיחה במבחנה ב vivo ארסיות פנוטיפים זיהום בעכברים ויתושים, בהתאמה.

Introduction

נגיף זיקה (ZIKV: משפחה Flaviviridae : Genus Flavivirus ) הוא flavivirus שנולדו יתוש שהגיע בברזיל ב 2013-14 ו היה קשור לאחר מכן עם התפרצות מסיבית של מחלה חום כי התפשטה ברחבי אמריקה 1 . בנוסף, ZIKV נקשר לתוצאות חמורות של המחלה, כגון תסמונת Guillain-Barré במבוגרים ו מיקרוסקפליה בעוברים ובילודים. מעט ידוע על ZIKV לפני התפשטותה המהירה בחצי הכדור המערבי. זה כלל היעדר כלים מולקולריים, ובכך מעכב מחקר מכניסטי. כלים מולקולריים לווירוסים, כגון שיבוטים cDNA זיהומיות, להקל על החיסון ועל התפתחות טיפולית אנטי ויראלית, ולאפשר הערכה של גורמים גנטיים ויראליים הקשורים פתוגנזה ויראלי דיפרנציאלי, התגובה החיסונית ואת האבולוציה ויראלי.

Flavivirus שיבוטים זיהומיות ידועים להיות מאוד לא יציבים חיידקים עקב CRיזמים prokaryotic yptic הנוכחי בגנום שלהם 3 . מספר גישות שימשו לשיפור הבעיה; כולל החדרת טנדם חוזרת במעלה הזרם של רצפים ויראליים 4 , מוטציה של רצפים prokaryotic משוער prokaryotic 5 , פיצול הגנום למספר פלסמידים 6 , וקטורים מספר להעתיק נמוך (כולל כרומוזומים מלאכותיים חיידקים) 7 , 8 והכנסת אינטרונים בגנום ויראלי 9 . מערכת אחת באורך מלא ללא שינויים תוארה עבור ZIKV; עם זאת, שיבוט זה נראה להיות מוחלש בתרבית תאים בעכברים 10 . קבוצות אחרות יש מהונדסים אינטרונים לתוך הגנום ZIKV, המאפשר הפרעה רצפים יציבים חיידקים שיכולים להיות spliced ​​החוצה בתאי יונקים במבחנה לייצור וירוס זיהומיות 11, 12 . בנוסף, מערכת מבוססת PCR בשם זיהום Subgenomic-Amplicons שימש בהצלחה להציל את אב טיפוס MR766 אב טיפוס של ZIKV 13 . הגישה המתוארת כאן אינה דורשת רצפים זרים, אלא משבשת את הגנום באזור של חוסר יציבות גבוהה באמצעות פלסמידים מרובים, אשר בעבר נעשה שימוש בהצלחה עם קדחת צהובה 6 , דנגה 14 , 15 ו נילוס המערבי וירוסים 16 . יתר על כן, תוספת של רצף הפטיטיס D ribozyme על טרמיני הגנומי ויראלי מקל על יצירת של 3 אות 'אותנטי ללא צורך הוספת של האתר linearization. בנוסף, הן פלסמידים בנויים וקטור מספר עותק נמוך (pACYC177, ~ 15 עותקים לכל תא) כדי למתן כל רעילות שיורית 17 . הנגיף התאושש מציג פרופיל צמיחה דומהנגיף הוריתי ב עקומות הצמיחה במבחנה 8 שורות תאים המרכיבים מגוון של סוגי תאים נגזר הן יונקים וחרקים, וכן הציג פרופילים פתוגניים זהים בעכברים זיהום, הפצה ושיעורי תעבורה יתושים 18 .

להלן, אנו מפרטים בפרוטוקול המתאר כיצד לגדל את פלסמידים משוכפלים זיהומיות, ליצור אורך מלא RNA ויראלי (הגנום ויראלי) במבחנה, ולשחזר וירוס זיהומיות בתרבית תאים. ראשית, אנו מתארים את התפשטות של פלסמידים חיידקים או חיידקים ללא הגברה באמצעות הגברה מעגל הגברה (RCA). לאחר מכן, אנו מראים כיצד שני פלסמידים מתעכלים ולאחר מכן ligated לאחר מכן יחד כדי ליצור וירוס באורך מלא. לבסוף, אנו מתארים את הייצור של רנ"א transcript ו electroporation הבאים שלה לתוך תאים Vero, ואחריו טיטרציה של וירוס התאושש ( איור 1 ). הגישה המתוארת היא מהירה, המאפשרתR ההתאוששות של מניות זיהומיות וירוס בשבועות 1-2.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. המרה ושחזור של פלסמידים משוכפלים זיהומיות

  1. להפוך את שני פלסמידים (בנפרד) באמצעות פרוטוקול טרנספורמציה מסחרית ( למשל , פרוטוקול שינוי 5 דקות NEB) עם כמה שינויים. שני פלסמידים מכילים קידוד גנים עבור עמידות ampicillin, ולכן להשתמש ampicillin או carbenicillin לבחירה. Carbenicillin הוא העדיף, כפי שהוא יציב יותר.
    1. הסרת תאים (ראה טבלת חומרים) מ -80 ° C מקפיא להפשיר על הקרח במשך 5-10 דקות. מרק ליזוגני מוקדם (LB) (המכיל 10 גרם / L NaCl ו 25 מיקרוגרם / מ"ל ​​carbenicillin, קרא LB- פחמימות) צלחות מרק עם דיכוי catabolite (SOC (ללא אנטיביוטיקה) - מגיע עם התאים) על 37 מעלות צלזיוס.
    2. הוסף בין 100 pg -10 ng ב 1 μL של DNA פלסמיד לצינור המכיל 50 μL של תאים המוסמכות; לערבב בעדינות על ידי לחיצה על הצינור.
    3. דגירה צינורות על הקרח במשך 5 דקות.
    4. מחממים צינורות הלם על 42 מעלות צלזיוס למשך 30 שניותבאמבט מים. חזרו לקרח למשך 2 דקות מיד לאחר ההלם.
    5. פיפטה 950 μL של טמפרטורת החדר SOC לתוך צינור כל ומערבבים על ידי pipetting. מורחים 100 μL של תערובת חיידקים על צלחת LB- פחמימות ו דגירה לילה ב 37 מעלות צלזיוס (בערך 12-14 שעות).
  2. הסר צלחות מ 37 ° C חממה לאחר הדגירה 12-14 h. מקום צלחות במגירה כהה בטמפרטורת החדר כדי לאפשר מושבות להמשיך לגדול (בערך 8-9 שעות).
  3. באמצעות 5 מ"ל של מרק מעולה (TB, המכיל 25 מיקרוגרם / מ"ל ​​carbenicillin, קרא TB- פחמימות), לגדול 5-10 מושבות קטנות עבור כל לילה פלסמיד ב 30 מעלות צלזיוס שייקר חיידקי (בערך 14-16 שעות).
    הערה: מושבות קטנות הן אינדיקציה לכך הפלסמיד הוא שלם; מושבות עם פלסמידים המכילים מחיקות, סידורים מחדש או מוטציות (להלן אירועי אי יציבות) יגדל מהר יותר, ולכן להיות גדול יותר. לכן, יש לנסות לבחור את המושבות הקטנות על הצלחת, במיוחד לאT בחירת המושבות הגדולות הנוכחי. כמה מושבות בגודל בינוני עשויים גם להיבחר לשלמות. הטמפרטורה הנמוכה המשמשת מקטינה את ההסתברות שהתאים יגדל (OD 600 של יותר מ 0.6-0.8). כמו רוב החוקרים לבצע צמיחה לילה, זה מאפשר שליטה רבה יותר סיכוי מופחת של יתר.
  4. בדוק תרבויות נוזלי עבור עכירות (בערך OD 600 של 0.6-0.8). מניחים כל צינורות עכורים ב 4 ° C ולאפשר צינורות אחרים להיות עכירות על ידי גידול במשך זמן רב יותר.
    הערה: אל תגדל חיידקים לערכים 600 OD גדול יותר מומלץ, כמו אירועי חוסר יציבות פלסמיד עלול להתרחש.
  5. חלץ DNA פלסמיד חיידקים עם ערכת minidrep פלסמיד מסחרי (ראה טבלת חומרים). Elute μL 15 של מראש מחומם (עד 70 מעלות צלזיוס בלוק חימום) חיץ elution. אפשר למאגר elution לדגור על הטור במשך 5 דקות לפני צנטריפוגה.
    הערה: לשמר לפחות 1 מ"ל של תרבות המתנע הזה ב 4 מעלות צלזיוס עבורשימוש נוסף בשלב הבא.
  6. Digest 10 μL של פלסמידים התאושש להעריך אם אירועים חוסר יציבות פלסמיד התרחשו במהלך התרבות.
    הערה: תקציר P1 עם SalI / NheI ו P2 עם BamHI / HindIII ב 37 מעלות צלזיוס למשך 1 שעות. לאשר את הנוכחות של להקות הנכון לאחר העיכול ( איור 2 א ) על ידי ג'ל אלקטרופורזה ולהמשיך לשלב 2. אם הכנת DNA פלסמיד ידי הגברה מעגל הגברה (RCA), שומרים כמה eluate miniprep לשמש כתבנית.

2. הכנת DNA פלסמיד מספיק עבור קשירת

הערה: קשירת electroporation שלאחר מכן דורש כמות מספקת של DNA פלסמיד כי חייב להיות שנוצר באמצעות maxiprep או RCA. בעוד maxiprep היא הגישה המסורתית בשימוש, RCA מציעה את היתרון של לא דורשת חיידקים, ובכך להסיר את הפוטנציאל של רעילות המושרה פלסמיד חיידקים שיכולים לגרום לאי יציבות אירועים.

  1. עבור כל פלסמיד שהוכיח את ההגבלה הנכונה אנזים עיכול דפוס בסעיף הקודם, להוסיף 500 μL של תרבות המתנע 1 L של פחמימות (25 מיקרוגרם / מ"ל ​​carbenicillin) מרק ולנער לילה ב 30 מעלות צלזיוס (בערך 14-16 שעות , בערך OD 600 של 0.6-0.8).
    הערה: אל תאפשר לתרבות לגדול על ערך זה 600 OD. זה עלול לגרום לאי יציבות אירועים בתוך פלסמידים.
  2. קציר את החיידקים ולבצע maxipreps לכל פרוטוקול של היצרן (ראה טבלת חומרים).
  • באמצעות miniprep השמורה משלב 1.6, בצע את הפעולות הבאות עבור הליך RCA.
    1. העברת 1 μL של DNA פלסמיד לצינור המכיל 50 μL למאגר מדגם.
    2. מחממים לשבש את המדגם ב 95 מעלות צלזיוס למשך 3 דקות, ולאחר מכן דגירה על 4 מעלות צלזיוס עד מוכן לשימוש.
    3. הכינו את ההגברה המסחריתPremix (ראה טבלת חומרים ). שלב 50 μL של חיץ התגובה עם μL 2 של תערובת האנזים בצינור להגדיר על הקרח.
      הערה: יש להגביר את הקדם הקרח על הקרח עד לשימוש. זה נוח להכין תערובת אב על ידי שילוב של ריאגנטים מספיק עבור המספר הנדרש של תגובות הגברה. יש לבטל כל פרימיום שלא נעשה בו שימוש.
    4. העברת 50 μL של הגברה מוכן premix למדגם מפוגל.
    5. דגירה של צינורות התגובה ב 30 מעלות צלזיוס במשך 18 שעות.
    6. דגירה של צינורות ב 65 מעלות צלזיוס למשך 10 דקות לנטרל את הפולימרז דנ"א ø29.
    7. אחסן את צינורות התגובה ב 4 ° C או -20 ° C עד מוכן לשימוש.
      הערה: בשלב זה, DNA פלסמיד שהוכן באמצעות שתי השיטות יש לכמת (באמצעות ספיגת ב 260 ננומטר) ואת הגנום ZIKV צריך להיות סנגר רצף לחלוטין כדי לאשר שום אי יציבות אירועים (מחיקות וסידורים) התרחשו במהלך ההכנה.
  • שם פריימר רצף (5 '- 3')
    ZIKV PRVABC59 1. AGTTGTTGATCTGTGTAGATATCAGAC
    ZIKV שמר 632. GCCCTATGCTGGATGAGG
    זיקב נשמר. GGTTCCGTACACAACCCAAGTTG
    ZIKV שמר 1313. CTCCCTTTGCCAAAAAGTCCACA
    ZIKV שמר 1201. CCAACACAAGGTGAAGCCTAC
    ZIKV שמר 1663For. GCAGACACCGGAACTCCACACT
    ZIKV נשמר 2008 עבור. CAGATGGCGGTGATATGC
    ZIKV שמר 2350Rev. GTGAGAACCAGGACATTCCTCC
    ZIKV שמר 2605I. TACAAGTACCATCCTGACTCCC
    זיקב שימר. GCCTTATCTCCATTCCATACCA
    ZIKV שמר על 3961. TTGCCAACCAGGCCAAAG
    ZIKV שמר 4132 עבור. CATTTGTCATGGCCCTGG
    זיקוב שמר על 4561. CTATTGGGTTCATGCCACAGAT
    ZIKV נשמר 4665For. GACCACAGATGGAGTGACACAGAGT
    ZIKV שמר על 5189. AAGACAGTTAGCTGCTTCTTCTTCAG
    ZIKV שמר 5219. GAGAGTTCTTCCTGAAATAGTCCGTGA
    ZIKV שמר על 6086. CTTGCTTCAAGCCAGTGTGC
    ZIKV שמר 6119For. GCCTCATAGCCTCGCTCTATCG
    ZIKV שמר 6721Rev. CCATTCCAAAGCCCATCTTCCC
    ZIKV שמר 6769For. CCAGCCAGAATTGCATGTGTCC
    ZIKV שמר על 7209Rev. ATCATTAGCAGGGGACTCCAA
    ZIKV שמר 7343I. GTTGTGGATGGAATAGTGTT
    ZIKV שמר על 8243. TGCCCATACACCAGCACTATGA
    זיקב. TGCATTGCTACGAACCTTGTTG
    ZIKV שמר על 9133 עבור. AGTCTTGGATTCTTGAACGAGGA
    ZIKV PRVABC59 9673. AACGCAATCATCTCCACTGACT
    ZIKV נשמר 9686For. GATGATAGGTTGCACATATGCC
    ZIKV שמר על 10321. GTTCATGTACTTTTCTTCATCACCTAT
    ZIKV שמר 10455I. CAGGAGAAGCTGGGAAACC
    זיקב נשמר 10621. CAGATTGAAGGGTGGGGAAGGTC

    טבלה 1: Primers עבור שיבוט cDNA שיבוטים. פלסמידים ניתן רצף לחלוטין עם primers המפורטים. פריימרים מסומנים "שימור" אינדיCate כי הם ככל הנראה מסוגל רצף / להגביר את כל גנוטיפים של ZIKV. פריימרים שכותרתם "PRVABC59" הם ספציפיים לזן זה, אך עשויים גם לעבוד על זנים אחרים גנוטיפ אסייתי ואולי גנוטיפים אחרים.

    3. הכנה של רטרו transcripted vitro

    1. הגדרת תגובת העיכול של maxiprep או DNA מוכן RCA.
      1. לעיכול P1, לערבב 10 μL של חיץ התגובה 10x, 3 μL של ApaLI, 3 μL של BamHI-HF, 3 μL של rSAP או CIP, ו -3,3 מיקרוגרם של ה- DNA 1 p1. הוסף ddH 2 O 100 μL.
      2. עבור עיכול P2, לערבב 10 μL של חיץ התגובה 10x, 3 μL של ApaLI, 3 μL של EcoRI-HF, ו 13.3 מיקרוגרם של ה- DNA 2 p2. הוסף ddH 2 O 100 μL.
      3. לדגור על 37 מעלות צלזיוס במשך 1-2 שעות.
      4. לטהר באמצעות ג 'ל מסחרי PCR ערכת ניקוי (ראה טבלת חומרים). Elute ב 30 μL של חיץ elution מראש מחומם ל 70 מעלות צלזיוס בלוק חימום (דגירהעמודה במשך 5 דקות לפני ספינינג).
        הערה: שמור 1 μL לרוץ על ג'ל מאוחר יותר.
    2. הכן התגובה קשירת.
      1. שלב 10 μL של 10x T4 DNA חיץ תגובת התגובה, 3 μL של ליגז DNA T4 (400 U / μL), 29 μL של P1 מטוהרים, ו 29 μL מטוהרים P2. הוסף ddH 2 O 100 μL.
      2. דגירה בטמפרטורת החדר למשך 2 שעות או 16 מעלות צלזיוס למשך הלילה.
      3. לטהר באמצעות ג 'ל מסחרי PCR ערכת ניקוי (ראה טבלת חומרים). Elute μL 10 של חיץ elution מראש מחומם ל 70 מעלות צלזיוס בלוק חימום (דגירה טור במשך 5 דקות לפני ספינינג).
        הערה: שמור 1 μL לרוץ על ג'ל מאוחר יותר.
    3. הפעל פלסמידים מעוכלים, פלסמידים מתעכל, קשירת על ג'ל agarose. המוצר קשירת צריכה להיות רצועת משקל מולקולרי גבוה (סביב 11 קילו) או מתעכל פלסמיד לבד, המציין קשירת היה מוצלח ( איור 2 ב ).
    4. הגדרת T7 בתגובה שעתוק במבחנה .
      1. שלב 10 מיקס μl 2x ARCA / NTP, 2 μL של תערובת T7 RNA פולימראז, ו 8 μL של תגובה קשורה מטוהרים עבור נפח סופי של 20 μL.
        הערה: ה ARCA הכלול בתמהיל הוא אנלוגי כיפה המשולב באופן בלעדי בכיוון הנכון. אנלוגי כובע רגיל יכולים לגרום רק ל -50% מהתמלילים שיש להם מכסה בכיוון הנכון.
      2. לדגור על 4 שעות ב 37 ° C.
      3. למדוד ריכוז RNA באמצעות ספקטרופוטומטר UV. לחלופין, הפעל ג'ל agarose denaturing כדי לאשר את אורך תמליל רנ"א.

    4. הצלה של זיהום זיהום על ידי Electroporation

    1. ימים לפני electroporation, להכין 1 T182 בקבוק של תאים Vero (בין T150 ו T182 מקובל, גדל DMEM + 10% בסרום שור עוברית (FBS)) לכל לבנות להיות התאושש. כלול 1 T182 כמו שליטה transfection מדומה. לִספִירַת הַנוֹצרִיםLls יש להשתמש ב 70-80% confluency.
    2. כאשר התאים מוכנים, מקום 12 מ"ל / תגובה של DMEM + 15% FBS + 10 מ"מ HEPES באמבט מים מחומם ל 37 מעלות צלזיוס.
    3. לנתק תאים על ידי trypsinization עם פרוטוקול סטנדרטי, ולשחזר תאים בתקשורת עם 10% FBS להשבית טריפסין; תאים צנטריפוגה ב XG 150 דקות 5 ב 4 ° C.
    4. לשטוף תאים 1x פוספט שנאגרו מלוחים (PBS), תאים pelleting ב XG 150 דקות 5 ב 4 ° C. חזור על שלב זה פעמיים עבור סך של שלושה שוטף.
    5. תאים Resuspend μL 200 של RPMI 1640 + 10 מ"מ HEPES (סטרילית) לכל # דגימות. העברת 200 μL ההשעיה התא לצינור סטרילי. תאים צריך להיות ~ 0.5 x 10 7 תאים / מ"ל.
    6. הוסף 20 μL של מים (שליטה שלילית מדומה) או 20 μL של רנ"א (רצוי 5-10 מיקרוגרם) המיוצר בשלב 3.4 לכל קבוצה של תאים. מערבבים בעדינות על ידי מהבהב את הצינור ולהעביר את התוכן של הצינור כדי coveette 2 מ"מ electroporation הפער.
    7. הגדר אלקטרוOporator ל 170 V LV, אומגה (התנגדות) ב 0 ו 950 μF (בערך ל 625 V / cm ו 20 ms זמן קבוע עבור מכונות אחרות). הגדר התנגדות להגדרה הזמינה ביותר, או 0 או ∞ אם זמין.
    8. דופק פעם ומיד להוסיף 600 μL של DMEM +15% FBS +10 מ"מ HEPES כי התחמם בשלב 4.2. שוטפים בתוך קובט ביסודיות כדי להסיר את כל התאים. הוסף תאים בקבוק T75 רקמה תרבות המכיל 10 מ"ל של התקשורת מחומם מראש. הסר מדיה נוספת מ קובט באמצעות טפטפת הכלול עם קובט. היזהר לשמור על סטריליות.
    9. מערבולת בקבוק כדי לערבב מדיה ותאים במקום 37 ° C חממה.
    10. בדוק למחרת עבור כדאיות התא, ולעשות זאת כל יום עד 50-75% מוות של תאים הוא ציין. המוות התא הוא ציין על ידי השוואת השליטה electroporated מדומה.
      הערה: אפקט ציטופטי ZIKV (CPE) הוא בולט למדי בתאים Vero, וכתוצאה מכך מעוגל תאים כי לנתק לצוף במדיום התרבות. יש לנונצפתה טווח של 8-10 ימים כמו אידיאל למסיק.
    11. קציר supernatant בצינור חרוטי צנטריפוגה להסיר פסולת הסלולר ב 3000 xg במשך 10 דקות ב 4 ° C.
    12. הסר supernatant מבהירים צינור חדש ותוספת עם ריכוז סופי של 20% FBS (מ 100% מלאי). בנוסף, להוסיף HEPES סטרילית בריכוז סופי של 10 מ"מ כסוכן אגירה כדי לשמר infectivity וירוס בעת קפוא (מ 1 מ 'סטרילי המניה).
    13. מערבבים את הנגיף על ידי vortexing ו aliquot לתוך בקבוקי מכסה בורג. חנות ב -80 מעלות צלזיוס לשימוש עתידי.

    5. טיטרציה של וירוס משוחזר

    1. זרע את המספר המתאים של צלחות 6 או 12 היטב של תאים Vero יום לפני טיטרציה.
    2. הסר וירוס מהמקפיא ולעשות דילולים סידורי פי 10 ב DMEM + 2% FBS בצינורות או 96 צלחות היטב.
      הערה: הציר הצפוי משיבוטים משוחזרים הוא בין 1 x 10 6 לבין 5 x 10 7 PFU / mL.
    3. הוסף 200 oR 400 μL של דילול כל כפולות היטב של צלחת 12 או 6 - היטב, בהתאמה.
    4. המקום צלחות 37 ° C חממה סלע כל 15 דקות, עבור סכום כולל של ~ 1-1.5 שעות תקופה ספיחה.
    5. הסר inoculum ויראלי ולהוסיף 1 מ"ל של (12 גם) או 2 מ"ל (6-היטב) DMEM-Tragacanth כיסוי כל טוב.
      הערה: ניתן להשתמש agarose, אגר, methylcellulose או מדיה שכבת אחרים כאן.
    6. דגירה תאים 37 מעלות צלזיוס חממה במשך 5 ימים. הזמן להיווצרות רובד תקין ישתנה בהתאם שכבת בשימוש.
    7. כדי לתקן תאים, להסיר צלחות מן חממה ו decant כיסוי בעדינות לתוך חומר חיטוי.
    8. הוסף מספיק אתנול 20% / 0.1% קריסטל סגול (CV) לכל טוב כדי לכסות מערבולת לערבב.
      הערה: קיימים מספר רב של מקבעים אחרים וניתן להשתמש בהם כאן. בנוסף, אם באמצעות כיסוי agarose או אגר, שכבה שנייה ניתן להשתמש בשילוב עם אדום נייטרלי לדמיין פלאקים ללא קיבוע. 20% האתנול הוכיח להיותיעיל ב וירוסים במעטפת וירוסים במחקרים קודמים; אל תשתמש בכמות זו עבור וירוסים שאינם עוטפים אותם מכיוון שהם לא יופעלו.
    9. דגירה צלחות עבור 30-60 דקות בטמפרטורת החדר (בקומה השנייה biosafety ארון); להתעלם CV (לפי תקנות מקומיות) וצלחות לשטוף עם מי ברז.
    10. אפשר לוחות להתייבש, ולספור באופן ידני פלאקים.
      הערה: הפניה 20 יכול לשמש כנקודת התייחסות נוספת לביצוע מבחני פלאק.

    Subscription Required. Please recommend JoVE to your librarian.

    Representative Results

    פרוטוקול המתואר כאן מאפשר התאוששות של זיהום נגוע נגוע זיקה וירוס. מניפולציה של שני מערכת פלסמיד שיבוט זיהומיות היא פשוטה כאשר מבוצעת בזהירות, לעומת גירסאות באורך מלא, שהם מאוד לא יציבים (נתונים לא מוצגים). לאחר עיכול קשירת של שתי חתיכות נפרדות, כתרים CNA מיוצר באמצעות שעתוק במבחנה עם פולימראז T7 אשר לאחר מכן electroporated לתוך תאים Vero ( איור 1 ). רצף פלסמיד נכון ניתן לפקח באמצעות עיכול הגבלה כמו miniprep פרוקסי הבאה ( איור 2 א ) ודרך סנגר רצף לאחר הייצור בקנה מידה גדול DNA עם RCA או maxiprep. לאחר אישור של שיבוטים על ידי רצף, ההתאוששות של וירוס זיהומיות דורש רק עיכול, קשירת, שעתוק במבחנה ולבסוף electroporation. ניתן לבצע את השלבים הבאים ביום אחד. נכון digeStion ו קשירת יכול להיות פיקוח על ידי agarose ג'ל אלקטרופורזה ( איור 2b ), המאפשר פתרון בעיות, במידת הצורך.

    כפי שמוצג באיור 3 , וירוס משוכפל נגזר משוכפל לרמות דומות כמו ההורה לבודד במבחנה במספר שורות תאים, מה שמרמז כי הנגיף התאושש מן cDNA משכפל דומה לבודד העיקרי. בנוסף, לא נצפו הבדלים משמעותיים בין הנגיף הנגוע המשובש לבין ההפרדה ההורית בשיעורי ההישרדות בעכברים או בשיעורי ההדבקה, ההפצה וההעברה של יתושים Aedesyi Aedes ( איור 4 ).

    איור 1
    איור 1: זרימת עבודה של ZIKV הצלה מתוך שיבוט cDNA שני פלסמיד.הגנום של זיקוב זן PRVABC59 היה משובטים בשני חלקים נפרדים לתוך עמוד השדרה פלסמיד pACYC177. שני פלסמידים היו מעוכל אז ligated עם ליגז T4 DNA. Capped- זיהומיות RNA הופק אז באמצעות שעתוק במבחנה ואחריו electroporation לתוך תאים Vero. (איור מותאם מתוך התייחסות 21 ). אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

    איור 2
    איור 2: ג 'ל אלקטרופורזה לפקח על עיכול קשירת cDNA שיבוט. ( א ) עיכול הגבלה ראשונית של miniprep פלסמידים נגזרות להעריך יציבות גנטית. ( ב ) דוגמאות של עיכול מוצרים קשירת במהלך ההתאוששות של וירוס זיהומיות ממערכת שני פלסמיד שיבוט. Href = "http://ecsource.jove.com/files/ftp_upload/55857/55857fig2large.jpg" target = "_ blank"> לחץ כאן כדי להציג גרסה גדולה יותר של נתון זה.

    איור 3
    איור 3: במבחנה צמיחה קינטיקה של וירוס נגזר משובטים. קינטיקה הצמיחה של סוג בר PRVABC59 ו זיהום נגוע נגוע בנגיף על האדם (SH-SY5Y, צנצנת ו NTERA2 cI.D1), יתוש (C6 / 36, Aag2) ואת הלא פרימאטים אנושיים (Vero) שורות תאים הוערכו על ידי assay פלאק. N = 3 שורות שגיאה מייצגות סטיית תקן מהממוצע. (איור מותאם מתוך התייחסות 21 ). אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

    55857fig4.jpg "/>
    איור 4: אפיון vivo של וירוס נגזר משובטים בעכברים ויתושים. ( A ) בן 4 שבועות של זכר ונקבה אינטרפרון אלפא, נוקאאא ביתא וגאמא, AG129, עכברים היו מחוסנים intraperitoneally עם 1,000 PFU של PRVABC59 או נגוע נגוע בנגיף נגוע זיהום לאורך זמן להישרדות (n = 11). יתושים aegypti Aedes ניתנו מדלקת דם מידבקת המכיל ZIKV ו גזור 14 ימים לאחר מכן. ( ב ) מבחני פלאק שימשו להערכת גופים יתושים (זיהום), רגליים (הפצה) או הפרשות הרוק (שידור) עבור וירוס מדבק. השיעורים מוצגים כאחוז מכלל היתושים שנבדקו (איור מותאם מתוך התייחסות 21 ). אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

    Subscription Required. Please recommend JoVE to your librarian.

    Disclosures

    למחברים אין מה לחשוף.

    Acknowledgments

    המחברים מבקשים להודות לקריסטן בולרד-פייבלמן, למילנה וסלינוביץ וקלאודיה רוקר על עזרתם באפיון הווירוס הנגזר משבטים. עבודה זו נתמכה בחלקו על ידי מענקים של המכון הלאומי לאלרגיה ומחלות זיהומיות, NIH תחת מענקים AI114675 (BJG) ו AI067380 (GDE).

    Materials

    Name Company Catalog Number Comments
    NEB Stable CompetentE. coli New England BioLabs C3040H
    Carbenicillin, Disodium Salt various
    Zyppy Plasmid Miniprep Kit Zymo Research D4036
    ZymoPURE Plasmid Maxiprep Kit Zymo Research D4202
    SalI-HF New England BioLabs R3138S 20,000 units/ml
    NheI-HF New England BioLabs R3131S 20,000 units/ml
    ApaLI New England BioLabs R0507S 10,000 units/ml
    EcoRI-HF New England BioLabs R3101S 20,000 units/ml
    BamHI-HF New England BioLabs R3136S 20,000 units/ml
    HindIII-HF New England BioLabs R3104S 20,000 units/ml
    illustra TempliPhi 100 Amplification Kit GE Healthcare Life Sciences 25640010
    NucleoSpin Gel and PCR Clean-up Macherey-Nagel 740609.5
    Shrimp Alkaline Phosphatase (rSAP) New England BioLabs M0371S 1,000 units/ml
    Alkaline Phosphatase, Calf Intestinal (CIP) New England BioLabs M0290S 10,000 units/ml
    T4 DNA Ligase New England BioLabs M0202S 400,000units/mL
    HiScribe T7 ARCA mRNA Kit New England BioLabs E2065S
    Vero cells ATCC CCL-81
    ECM 630 High Throughput Electroporation System BTX 45-0423 Other machines are acceptable.
    LB Broth with agar (Miller) Sigma L3147 Can be homemade as well.
    Terrific Broth Sigma T0918 Can be homemade as well.
    Petri Dish Celltreat 229693
    Culture Tubes VWR International 60818-576
    T75 flasks Celltreat 229340
    T182 flasks Celltreat 229350
    1x PBS Corning 21-040-CV
    RPMI 1640 with L-glutamine Corning 10-040-CV
    DMEM with L-glutamine and 4.5 g/L glucose Corning 10-017-CV
    Fetal Bovine Serum (FBS) Atlas Biologicals FP-0500-A
    Tragacanth Powder MP Bio MP 104792
    Crystal Violet Amresco 0528-1006
    Ethanol Denatured VWR International BDH1156-1LP
    6 well plate Celltreat 229106
    12 well plate Celltreat 229111
    Sequencing Oligos IDT see table 1
    Qubit 3.0 ThermoFisher Qubit 3.0 other methods are acceptable.
    Qubit dsDNA BR Assay Kit ThermoFisher Q32850 other methods are acceptable.
    Qubit RNA HS Assay Kit ThermoFisher Q32852 other methods are acceptable.
    Class II Biosafety Cabinet Varies N/A This is necessary for live-virus work.

    DOWNLOAD MATERIALS LIST

    References

    1. Kindhauser, M. K., Allen, T., Frank, V., Santhana, R. S., Dye, C. Zika: the origin and spread of a mosquito-borne virus. Bull World Health Organ. 94, (9), 675C-686C (2016).
    2. Oehler, E., et al. Zika virus infection complicated by Guillain-Barre syndrome--case report, French Polynesia, December 2013. Euro Surveill. 19, (9), (2014).
    3. Li, D., Aaskov, J., Lott, W. B. Identification of a cryptic prokaryotic promoter within the cDNA encoding the 5' end of dengue virus RNA genome. PLoS One. 6, (3), e18197 (2011).
    4. Pu, S. Y., et al. A novel approach to propagate flavivirus infectious cDNA clones in bacteria by introducing tandem repeat sequences upstream of virus genome. J Gen Virol. 95, (Pt 7), 1493-1503 (2014).
    5. Pu, S. Y., et al. Successful propagation of flavivirus infectious cDNAs by a novel method to reduce the cryptic bacterial promoter activity of virus genomes. J Virol. 85, (6), 2927-2941 (2011).
    6. Rice, C. M., Grakoui, A., Galler, R., Chambers, T. J. Transcription of infectious yellow fever RNA from full-length cDNA templates produced by in vitro ligation. New Biol. 1, (3), 285-296 (1989).
    7. Yun, S. I., Kim, S. Y., Rice, C. M., Lee, Y. M. Development and application of a reverse genetics system for Japanese encephalitis virus. J Virol. 77, (11), 6450-6465 (2003).
    8. Gualano, R. C., Pryor, M. J., Cauchi, M. R., Wright, P. J., Davidson, A. D. Identification of a major determinant of mouse neurovirulence of dengue virus type 2 using stably cloned genomic-length cDNA. J Gen Virol. 79, (Pt 3), 437-446 (1998).
    9. Johansen, I. E. Intron insertion facilitates amplification of cloned virus cDNA in Escherichia coli while biological activity is reestablished after transcription in vivo. Proc Natl Acad Sci U S A. 93, (22), 12400-12405 (1996).
    10. Shan, C., et al. An Infectious cDNA Clone of Zika Virus to Study Viral Virulence, Mosquito Transmission, and Antiviral Inhibitors. Cell Host Microbe. 19, (6), 891-900 (2016).
    11. Schwarz, M. C., et al. Rescue of the 1947 Zika Virus Prototype Strain with a Cytomegalovirus Promoter-Driven cDNA Clone. mSphere. 1, (5), (2016).
    12. Tsetsarkin, K. A., et al. A Full-Length Infectious cDNA Clone of Zika Virus from the 2015 Epidemic in Brazil as a Genetic Platform for Studies of Virus-Host Interactions and Vaccine Development. MBio. 7, (4), (2016).
    13. Gadea, G., et al. A robust method for the rapid generation of recombinant Zika virus expressing the GFP reporter gene. Virology. 497, 157-162 (2016).
    14. Kapoor, M., Zhang, L., Mohan, P. M., Padmanabhan, R. Synthesis and characterization of an infectious dengue virus type-2 RNA genome (New Guinea C strain). Gene. 162, (2), 175-180 (1995).
    15. Messer, W. B., et al. Development and characterization of a reverse genetic system for studying dengue virus serotype 3 strain variation and neutralization. PLoS Negl Trop Dis. 6, (2), e1486 (2012).
    16. Kinney, R. M., et al. Avian virulence and thermostable replication of the North American strain of West Nile virus. J Gen Virol. 87, (Pt 12), 3611-3622 (2006).
    17. Chang, A. C., Cohen, S. N. Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid. J Bacteriol. 134, (3), 1141-1156 (1978).
    18. Weger-Lucarelli, J., et al. Development and Characterization of Recombinant Virus Generated from a New World Zika Virus Infectious Clone. J Virol. 91, (1), (2017).
    19. Roberts, P. L., Lloyd, D. Virus inactivation by protein denaturants used in affinity chromatography. Biologicals. 35, (4), 343-347 (2007).
    20. Baer, A., Kehn-Hall, K. Viral concentration determination through plaque assays: using traditional and novel overlay systems. J Vis Exp. (93), e52065 (2014).
    21. Weger-Lucarelli, J., et al. Development and Characterization of Recombinant Virus Generated from a New World Zika Virus Infectious Clone. J Virol. (2016).
    22. Grubaugh, N. D., et al. Genetic Drift during Systemic Arbovirus Infection of Mosquito Vectors Leads to Decreased Relative Fitness during Host Switching. Cell Host Microbe. 19, (4), 481-492 (2016).

    Comments

    0 Comments


      Post a Question / Comment / Request

      You must be signed in to post a comment. Please or create an account.

      Usage Statistics