सीआरआईएसपीआर-कंटेटेमर का उपयोग करने वाले माउस छोटे आंतों के ऑर्गनाइज में एकाधिक जीन नॉकआउट के लिए एक प्रोटोकॉल

Bioengineering
 

ERRATUM NOTICE

Summary

इस प्रोटोकॉल में एक सिंगल गाइड आरएनए को एक गाइड आरएनए समामेल वेक्टर में क्लोन करने के लिए कदमों का वर्णन किया गया है, जो सीआरआईएसपीआर / सीएस 9 तकनीक का उपयोग करते हुए बहु-जीन नॉकआउट्स बनाने में विशेष रूप से इस्तेमाल होता है। आंतों के इनोगोइड्स में डबल नॉकआउट्स की पीढ़ी इस पद्धति का एक संभावित आवेदन के रूप में दिखाया गया है।

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Merenda, A., Andersson-Rolf, A., Mustata, R. C., Li, T., Kim, H., Koo, B. K. A Protocol for Multiple Gene Knockout in Mouse Small Intestinal Organoids Using a CRISPR-concatemer. J. Vis. Exp. (125), e55916, doi:10.3791/55916 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

सीआरआईएसपीआर / सीएस 9 टेक्नोलॉजी ने हानि समारोह के अध्ययन की व्यवहार्यता और गति में काफी सुधार किया है जो कि जीन फ़ंक्शन को समझने में आवश्यक हैं। उच्च यूकेरियोट्स में, पैरालॉजस जीन एक जीन के नुकसान की क्षतिपूर्ति करके एक संभावित फेनोटाइप को मुखौटा कर सकता है, इस प्रकार इस जानकारी को सीमित कर सकता है जिसे एकल जीन नॉकआउट पर निर्भर आनुवंशिक अध्ययन से प्राप्त किया जा सकता है। हमने माउस छोटे आंत्र जीवों में अभिकर्मक के एक दौर के बाद बहु-जीन नॉकआउट बनाने के लिए गाइड आरएनए (जीआरएनए) कंटेमेटर के लिए एक उपन्यास, तीव्र क्लोनिंग विधि विकसित की है। हमारी रणनीति एक एकल वेक्टर में चार अलग-अलग जीआरएनए के संवेदीकरण के लिए अनुमति देती है जो एनेल्ड जीआरएनए ऑलिगोस और पूर्व डिज़ाइन रेट्रोवायरल वेक्टर के साथ एकल गोल्डन गेट फेरबदल प्रतिक्रिया कर रही है। यह या तो एकाधिक जीआरएनए द्वारा एक जीन के लक्ष्यीकरण के बाद चार अलग-अलग जीनों के साथ-साथ नॉकआउट या नॉकआउट क्षमता में वृद्धि करता है। इस प्रोटोकॉल में, हम विस्तार से दिखाते हैंरेट्रोवाइरल क्र्रिस्प-संकिता वेक्टर में एकाधिक जीआरएनए को प्रभावी ढंग से कैसे क्लोन करना है और आंतों के इनोगोइड्स में अत्यधिक कुशल इलेक्ट्रोप्लायेशन कैसे हासिल करना है। एक उदाहरण के रूप में, हम यह दिखाते हैं कि दो जोड़े जीन के साथ-साथ, Wnt सिग्नलिंग मार्ग (एक्सिन 1/2 और आरएनएफ 43 / जेएनआरएफ 3) के नकारात्मक नियामक एन्कोडिंग प्रमुख वृद्धि कारकों को वापस लेने के लिए प्रतिरोधी आंतों के ऑर्गोइओड्स को रेखांकित करता है।

Introduction

रिवर्स आनुवंशिकी दृष्टिकोण एक जीन के कार्य की जांच करने के लिए एक व्यापक रूप से इस्तेमाल किया जाने वाला तरीका है। विशेष रूप से, हानि समारोह की पढ़ाई, जिसमें एक जीन के विघटन में फेनोटाइपिक परिवर्तन होता है, जैविक प्रक्रियाओं की हमारी समझ के निर्माण में महत्वपूर्ण भूमिका निभाता है। सीआरआईएसपीआर / सीएस 9 विधि जीनोम इंजीनियरिंग प्रौद्योगिकी में सबसे हालिया प्रगति का प्रतिनिधित्व करती है और कोशिकाओं और जीवों में आनुवंशिकी के वर्तमान अभ्यास को क्रांति लाती है। सीएस 9 एक आरएनए-निर्देशित एंडोन्यूक्लिज़ है जो जीआरएनए के पूरक के लिए एक विशिष्ट डीएनए अनुक्रम को बांधता है और डबल-स्ट्रैंड ब्रेक (डीएसबी) उत्पन्न करता है। यह डीएसबी डीएनए मरम्मत मशीनरी को भर्ती करता है, जो मुताबिक़ पुनर्संरचना के लिए डीएनए टेम्पलेट की अनुपस्थिति में, त्रुटि-प्रवण गैर-मुताबिक़ अंत में शामिल होने के माध्यम से कट डीएनए स्ट्रैंड को फिर से बाएं लगीगी, जिससे न्युक्लिओटाइड (एस) के सम्मिलन या विलोपन का परिणाम हो सकता है फ्रेशिफ़्ट म्यूटेशन 1 के कारण

सीआरआईएसपीआर / कैस 9 एफ़ की महान सहजता और बहुमुखी प्रतिभाओच ने जीनोम स्तरीय नॉकआउट स्क्रीन के लिए यह बेहद आकर्षक उपकरण बना दिया है जिसका लक्ष्य अज्ञात जीन फ़ंक्शन 2 , 3 को सुलझाना था। फिर भी, एकल जीन नॉकआउट दृष्टिकोण सीमित उपयोग के होते हैं, यदि निरर्थक कार्यों के साथ कई समानुभूतियां मौजूद हैं। इस प्रकार, एक जीन को अपहरण करने से उस जीन के कार्य को निर्धारित करने के लिए पर्याप्त नहीं हो सकता है, जिसके द्वारा पैरोलोजेस द्वारा संभव मुआवजा दिया गया था, जिसके परिणामस्वरूप थोड़ा या कोई परिवर्तन नहीं हुआ 4 । इसलिए आनुवंशिक मुआवजे के प्रभाव पर काबू पाने के लिए अलग-अलग पैरालॉजस जीन को लक्षित करने वाले कई जीआरएनए वैक्टर वितरित करके समांतर में समानुभूतियां खारिज करना महत्वपूर्ण है।

सीआरआईएसपीआर / सीएस 9 के प्रयोग को अनुवांशिक जीन नॉकआउट में बढ़ाने के लिए, हमने हाल ही में एक रेट्रोवायरल वेक्टर 5 में चार प्री-एनेल्ड जीआरएनए को क्लोन करने के लिए एक तेज़, एक-चरण क्लोनिंग पद्धति विकसित की है। सीआरआईएसपीआर- कंटेटेमर नामक रीढ़ की हड्डी, आधारित हैएक एमएससीवी रेट्रोवायरल प्लास्मिड जिसमें दोहराव वाले जीआरएनए अभिव्यक्ति केट शामिल हैं। प्रत्येक कैसेट प्रकार के दो औंधा मान्यता साइटों IIS प्रतिबंध एंजाइम Bbs मैं, जो अपरिवर्तनीय मिलान overhangs एक एकल ट्यूब 6 में एक गोल्डन गेट फेरबदल प्रतिक्रिया का उपयोग कर के साथ एक annealed gRNA oligo द्वारा प्रतिस्थापित किया जा सकता है। इस क्लोनिंग पद्धति में पाचन और बंधन के पुनरावृत्त चक्र होते हैं जो बीबीएस I द्वारा उत्पन्न विभिन्न ओवरहेंग अनुक्रमों का शोषण करके कई डीएनए टुकड़ों की एक साथ विधानसभा की अनुमति देते हैं। उदाहरण के लिए, इस एंजाइम की विशिष्टता इसकी मान्यता के बाहर असममित कटौती करने की क्षमता है अनुक्रम; इसलिए, प्रत्येक कैसेट Bbs मैं मूल साइट अगल अनुकूलित overhangs के साथ एक अलग अनुक्रम हो सकता है और इस तरह से, प्रत्येक gRNA concatemer वेक्टर के एक विशिष्ट स्थान और अभिविन्यास में क्लोन किया जा सकता है।

सिद्धांत के एक प्रमाण के रूप में, हमने इस रणनीति में इसका उपयोग करने का प्रदर्शन कियामाउस इन्टेस्टाइनल ऑर्गोऑइड, एक साथ इलेक्ट्रोपार्जन 5 के एक राउंड द्वारा विंट मार्ग के पैरालॉस नकारात्मक नियामकों के एक साथ दो जोड़े को बाधित करके।

पिछले कुछ वर्षों के दौरान, कई अन्य समूहों ने कई जीआरएनए अभिव्यक्ति वैक्टर के आधार पर विकसित किया है जो गोल्डन गेट का उपयोग कर 7 में कई मॉडल प्रणालियों में मल्टी-जीन नॉकआउट हासिल करने के लिए बनाई गई है, जैसे मानव सेल लाइन 8 , 9 , zebrafish 10 और Escherichia coli 11 अपने प्रोटोकॉल में, जीआरएनए को पहली बार मध्यवर्ती वैक्टर में क्लोन किया जाता है और फिर एक अंतिम उत्पाद में इकट्ठा किया जाता है। इसके विपरीत, हमारे सीआरआईएसपीआर-कंटेटेमर रणनीति का मुख्य लाभ एक एकल बीबीएस मैं फेरबदल, क्लोनिंग चरण की सुविधा है। अन्य जीआरएनए कंसटाइमर्स की तरह, हमारी विधि या तो चार तक के साथ-साथ नॉकआउट संभव बनाती हैकई जीआरएनए ( चित्रा 1 ) के साथ एक या दो जीन के लक्ष्यीकरण के बाद विभिन्न जीन या बढ़ी हुई क्रिस्प्र पीटकर दक्षता।

इस प्रोटोकॉल में, हम सीआरआईएसपीआर-कंटेटेमीर वैक्टर की पीढ़ी के हर चरण में जीआरएनए डिजाइन से गोल्डन गेट प्रतिक्रिया तक और सफल क्लोनिंग की पुष्टि के लिए विस्तार से वर्णन करते हैं। हम इलेक्ट्रोपायरिंग और बाद के विकास कारक वापसी प्रयोगों द्वारा माउस छोटे आंतों के आर्गोइड्स में सीआरआईएसपीआर-कॉलेटाइमर्स के अभिकर्मक के लिए एक अत्यधिक कुशल प्रोटोकॉल भी प्रदान करते हैं।

Protocol

1. सीआरआईएसपीआर-कंटेटेमेटर वेक्टर के लिए जीआरएनए डिजाइन

नोट: इस खंड का उद्देश्य सबसे अच्छा लक्ष्यीकरण रणनीति का चयन कैसे करना है और सीआरआईएसपीआर-कंटेटेमेटर वेक्टर के लिए विशिष्ट ओवरहेन्ग वाले जीआरएनए को कैसे डिज़ाइन करना है।

  1. पसंद के एक सीआरआईएसपीआर जीआरएनए डिज़ाइन टूल का इस्तेमाल करके ब्याज की जीन के खिलाफ डिजाइन जीआरएनए। एक उदाहरण के लिए सामग्री की तालिका देखें
    नोट: जब एक जीआरएनए प्रति जीन डिज़ाइन करना संभव है, तो समानांतरजन जीन की एक जोड़ी को लक्ष्यित करते हुए, एक डबल नाकआउट ( चित्रा 1 ) को प्राप्त करने की संभावना को बढ़ाने के लिए प्रति जीन दो जीआरएनए तैयार करना उचित है।
  2. सुनिश्चित करें कि जीआरएनए में प्रतिबंध मैपिंग टूल का उपयोग करके बीबीएस मैं मान्यता साइट शामिल नहीं है (उदाहरण के लिए सामग्री की तालिका देखें)।
  3. तालिका 1 में दिखाए गए अनुसार, प्रत्येक ऑलगो को विशिष्ट क्रिस्प्र-कॉन्टैटेमीर वेक्टर ओवरहांग्स जोड़ें
"Fo: रख-एक साथ। अंदर-पेज =" 1 "के लिए: साथ-साथ-आगे रखें। भीतर-पेज =" हमेशा "> कैसेट 1 कैसेट 2 कैसेट 3 कैसेट 4 अनुक्रम (5'-3 ') CACCGG [gRNA1] जी.टी. ACCGG [gRNA2] जी CCGG [gRNA3] ACACCGG [gRNA4] GTT अनुक्रम (5'-3 ') TAAAAC [आर सी-gRNA1] सीसी AAAAC [आर सी-gRNA2] सी AAAC [आर सी-gRNA3] CTAAAAC [आर सी-gRNA4] CCG

तालिका 1: सीआरआईएसपीआर-कंटेटेमेटर वेक्टर के प्रत्येक कैसेट के लिए ओवरहेन्ग।

2. सीआरआईएसपीआर-कंटेटेमेटर वेक्टर में जीआरएनए का क्लोनिंग

  1. फासीफायरेलेशन और ओलिगो का एनीलिंग
    नोट: यह कदम दिखाता है कि कैसे टीO प्रत्येक जीआरएनए oligo के लिए ऊपरी और नीचे के किनारों और एक ही प्रतिक्रिया में उनके छोर को कैसे फास्फोरेट करना है।
    1. नीचे दिए गए निर्देशों के अनुसार, फॉस्फोरेटिंग ऑलिगोस के लिए प्रतिक्रिया मिश्रण तैयार करें और बर्फ पर ऊपर और नीचे के किनारों को एनीलिंग करें।
      नोट: सभी oligos एक प्रतिक्रिया में जमा किया जा सकता है; उदाहरण के लिए, एक 4 जीआरएनए-कंटेटेमेटर वेक्टर के मामले में, एक साथ पूल 8 ऑलिगोस
    2. 3 कंटेमेस्टर के लिए, 3.0 μL जीआरएनए शीर्ष भूग्रस्त (प्रत्येक जीआरएनए से 1.0 μL, 10 माइक्रोग्राम, 1 μL / जीआरएनए), 3.0 μL जीआरएनए नीचे किनारा (प्रत्येक जीआरएनए से 1.0 μL; 10 माइक्रोग्राम, 1 μL / जीआरएनए), 2.0 μL टी 4 का उपयोग करें डीएनए ligase बफर (10x), 1.0 μL टी 4 पीएनके, और 20.0 μL की कुल मात्रा तक एच 2 ओ जोड़ें।
    3. Pipetting द्वारा अच्छी तरह मिक्स और यह निम्नलिखित सेटिंग्स का उपयोग कर एक thermocycler में चलाने: 37 डिग्री सेल्सियस 30 मिनट के लिए, 95 डिग्री सेल्सियस के लिए 5 मिनट, रैंप नीचे 25 डिग्री सेल्सियस पर 0.3 डिग्री सेल्सियस / मिनट, 4 डिग्री सेल्सियस पर पकड़।
  2. बीबीएस मैं प्रतिक्रिया फेरबदल
    नोट: इस खंड में, प्री-ऐनेल्ड जीआरएनए ऑलिगोस को संकाय वेक्टर की उचित स्थिति में पाचन और बंधन के चक्रों को एक तरफ से एक कदम में शामिल किया गया है।
    1. 3 और 4 जीआरएनए- कंटेटेमेटर वैक्टर उत्पन्न करने के लिए डीएनसी / आरएनज मुक्त पानी में प्रतिक्रिया मिश्रण 1: 100 को पतला।
      नोट: जब क्लोनिंग 2 जीआरएनए-कंसटाइमर्स यह कदम जरूरी नहीं है।
    2. बर्फ पर Bbs मैं पुथल प्रतिक्रिया नीचे दिए गए निर्देशों के अनुसार इकट्ठा। एक नकारात्मक नियंत्रण शामिल करें जिसमें केवल वेक्टर शामिल हैं
    3. 100 एनजी सीआरआईएसपीआर-कंटेटेमेटर वेक्टर, 10.0 μL ओलिगो मिश्रण, 1.0 μL बीएसए युक्त प्रतिबंध एंजाइम बफर (10x), 1.0 μL डीटीटी (10 मिमी), 1.0 μL एटीपी (10 मिमी), 1.0 μL बीबीएस I, 1.0 μL टी 7 लेगेज , और 20.0 μL की कुल मात्रा तक एच 2 ओ।
    4. Pipetting द्वारा अच्छी तरह मिक्स और यह निम्नलिखित सेटिंग्स का उपयोग कर एक thermocycler में चलाने: क्लोनिंग 3 और 4 जीआरएनए- concatemers के लिए और 50 चक्र चलाने पकड़ो ।
  3. Exonuclease उपचार
    नोट: यह कदम अत्यधिक अनुशंसित है क्योंकि यह लाइनरीकृत डीएनए के किसी भी निशान को हटाकर क्लोनिंग की दक्षता को बढ़ाता है।
    1. एक डीएनए exonuclease (सामग्री की तालिका देखें) के रूप में इस के साथ Bbs मैं फेरबदल प्रतिक्रिया उपचार करें।
    2. पिछले चरण (2.2.3) से 11.0 μL ligation मिश्रण लें, 1.5 μL exonuclease बफर (10x), 1.5 μL एटीपी (10 मिमी), 1.0 μL डीएनए एक्सोन्युक्लेज़ जोड़ें, और कुल मात्रा को 15.0 μL पानी के साथ लाएं। 30 मिनट के लिए 37 डिग्री सेल्सियस पर सेते हैं, उसके बाद 70 डिग्री सेल्सियस 30 मिनट तक होता है
      नोट: यह चरण मिश्रण में किसी भी अवशिष्ट रेखीय डीएनए को हटा देता है और इसलिए क्लोनिंग दक्षता बढ़ जाती है।
    3. रासायनिक कॉम्प में परिवर्तन के लिए प्रतिक्रिया मिश्रण के 2 μL का उपयोग करेंतम्बू ई। कोलाई बैक्टीरिया गर्मी झटका 12
      नोट: वैकल्पिक रूप से, प्रतिक्रिया -20 डिग्री सेल्सियस पर एक सप्ताह तक के लिए संग्रहीत किया जा सकता है
  4. प्रतिबंध पाचन
    नोट: इस कदम का उद्देश्य प्रतिबंध पाचन द्वारा क्लोनिंग प्रक्रिया की सफलता का आकलन करना है।
    1. सीआरआईएसपीआर-कंटेटेमेटर वेक्टर में जीआरएनए आवेषण की उपस्थिति की पुष्टि करने के लिए, 4- 8 बैक्टीरियल कॉलोनियों को एक inoculating पाश के साथ उठाएं, प्रत्येक क्लोन को 4 एमएल एलबी माध्यम में रात भर 37 डिग्री सेल्सियस पर एक कक्षीय प्रकार के बरतन में बढ़ो। निर्माता के निर्देशों के अनुसार प्लाज्मिड मिलिप्रॉप किट का उपयोग करके डीएनए को निकालें ( सामग्री की सारणी देखें)।
    2. डाइजेस्ट ~ डीएनए के 200 एनजी 10 यू इकोआर I + 5 यू बीजीएल II के साथ 10 μL प्रतिक्रिया में 37 डिग्री सेल्सियस पर एक जीवाणु इनक्यूबेटर में 3 घंटे के लिए incubating द्वारा। आकार की तुलना के लिए एक सकारात्मक नियंत्रण के रूप में संबंधित मूल सदिश के साथ एक अलग प्रतिक्रिया मिश्रण शामिल करें।
      नोट: थीS पुष्टि करेगा कि सभी कॉन्टैमेस्टर मौजूद हैं या नहीं, क्योंकि इन दो प्रतिबंध एंजाइम पूरे कस्टैमेटर्स को एक्साइज करेंगे ये प्रत्येक सम्मेलन के लिए अपेक्षित आकार हैं: 2 जीआरएनए-कॉन्सटाइमर (800 बीपी), 3 जीआरएनए-कॉन्टैटकैमर (1.2 केबीपी), और 4 जीआरएनए-कंटेटेमीटर (1.6 केबीपी)।
    3. 1% agarose जेल पर 90 वी के लगभग 20 मिनट के लिए पाचन प्रतिक्रियाएं चलाएं।
    4. एक यूवी ट्रांसिल्युमिनेटर का उपयोग करके जेल को विज़ुअलाइज़ करें अपने बैंड पैटर्न को मूल सदिशों में से एक से मेल खाकर सही सम्मिलन आकार के साथ क्लोन की पहचान करें और प्रत्येक टुकड़ा में डीएनए सीढ़ी का उपयोग करके अपेक्षित आकार हो।
    5. बैक्टीरिया इनक्यूबेटर में 3 घंटे के लिए 37 डिग्री सेल्सियस पर 5 यूबीबीएस के साथ चयनित क्लोन को डाइजेस्ट करें। नियंत्रण के रूप में संबंधित मूल सदिश के साथ एक अलग प्रतिक्रिया मिश्रण शामिल करें
      नोट: यह अतिरिक्त पाचन चरण इस बात की पुष्टि करने के लिए है कि जीआरएनए को सही स्थिति में क्लोन किया गया है और परिणामस्वरूप सभी बीबीएस पहचान स्थलों को खो दिया गया है।
    6. पर पाचन प्रतिक्रियाएं चलाएंएक 1% agarose जेल 90 वी के लिए लगभग 20 मिनट बीबीएस I द्वारा काट नहीं किए गए वेक्टर्स को सही मानते हैं क्योंकि वे केवल जीआरएनए होते हैं।
  5. वेक्टर अनुक्रमण
    नोट: इस कदम का उद्देश्य प्रतिबंध विचलन विश्लेषण द्वारा सही के रूप में पहचाने गए उन वैक्टरों में जीआरएनए दृश्यों की उपस्थिति की पुष्टि करना है।
    1. सेंन्जर अनुक्रमण द्वारा सकारात्मक सम्मेलन वैक्टर की पुष्टि 13 निम्नलिखित प्राइमरों का उपयोग करते हुए:
      आगे: TCAAGCCCTTTGTACACCCTAAG (पहले जीआरएनए कैसेट की जाँच के लिए)
      Linker1_Forward: GACTACAAGGACGACGATGACAA (दूसरे जीआरएनए कैसेट की जांच के लिए)
      Linker2_Reverse: जीजीसीजी TAGTCGGGCACGTCGTAGGGGT (दूसरे जीआरएनए कैसेट की जांच के लिए)
      Linker2_Forward: ACCCCTACGACGTGCCCGACTACGCC (तीसरे जीआरएनए कैसेट की जाँच के लिए)
      Linker3_Reverse: टीसीसीटीसीसीटीटीटीगैगैटकैगटीटीटीसीसीएसीएटी (तीसरे जीआरएनए कैसेट की जांच के लिए)
      रिवर्स: AGGTGGCGCGAAGGGGCCACCAAAG (अंतिम जीआरएनए की जाँच के लिएकैसेट)
    2. क्रमिक पढ़ने में अपनी अनुक्रमों को खोजकर सभी जीआरएनए की उपस्थिति की जांच करें।

3. इलेक्ट्रोप्लोरेशन द्वारा पेटी ऑर्गनाइज के अभिकर्मक

नोट: कृपया ध्यान दें कि यह प्रक्रिया फ़ूजी एट अल द्वारा प्रकाशित प्रोटोकॉल पर आधारित है 2015 में, माउस छोटे आंतों की जीविकाय संस्कृतियों 14 के अनुकूलन के साथ

  1. पूर्व इलेक्ट्रोपोरेशन
    नोट: यह खंड वर्णन करता है कि कैसे अपने एंटीबायोटिक्स और वातानुकूलित मीडिया को अपने संस्कृति माध्यम से हटाकर इलेक्ट्रोपोरेशन से पहले माउस आंत्र इनोगोइड्स तैयार करने के लिए। यह electroporation दौरान संभव विषाक्त प्रभाव को रोकने जाएगा
    1. अभिकर्मक प्रक्रिया के दिन 0 पर, एक 1: 2 अनुपात में विभाजित आर्गोइओड।
      नोट: पहले से स्थापित प्रोटोकॉल 15 के अनुसार क्रिस्ट अलगाव प्रदर्शन से आंतों की आंतों की संस्कृति को प्राप्त किया जा सकता है। कृपया देखें
    2. जब इलेक्ट्रोपोरेशन के लिए बंटवारे के इग्नेगोइड्स, प्रति अभिकर्मक प्रति एक 48-अच्छी तरह से थाली के 6 कुओं की कम से कम बीज।
    3. 20 μL- तहखाने मैट्रिक्स बूंदों में organoids बीज बीज और 37 डिग्री सेल्सियस, 5% सीओ 2 पर एक humidified इनक्यूबेटर (जैसा कि पहले वर्णित 15 ) में वेनआर + निक मध्यम (Wnt + ईजीएफ + नोगिन + आर-स्पॉन्डिन + निकोटीनमाइड) ।
  2. 2 दिन, एंटीबायोटिक दवाओं के बिना ( तालिका 2 देखें) 250 एमएल एन (ईजीएफ + नोगिन) + CHIR99021 (ग्लाइकोजन सिन्थेस किनेस-3 अवरोधक) + वाई -27632 (रॉक अवरोधक) के साथ वेंडी + एनएसी को बदलने के माध्यम से मध्यम बदलें।
    नोट: सभी चरणों में, 48-अच्छी तरह से एक प्लेट के प्रत्येक कूल्हे में मध्यम की मात्रा 250 μL है।
  3. 3 दिन, एंजाइमिक्स के बिना ईएन + CHIR99021 + Y-27632 + 1.25% वी / वी डाइमिथाइल सल्फोक्सीड (डीएमएसओ) के लिए ऑनोऑइड माध्यम को बदल दें।
  • कोशिकाओं की तैयारी
    ध्यान दें:यहां हम वर्णन करते हैं कि मैकेनिकल और रासायनिक पृथक्करण द्वारा छोटे सेल क्लस्टर में टुकड़ा ऑर्गोइओड्स के लिए कैसे। ये कदम प्रक्रिया की सफलता के लिए महत्वपूर्ण हैं।
    1. 4 दिन, एक 1 एमएल विंदुक टिप और 1.5 एमएल ट्यूब के लिए स्थानांतरण ऑर्गनाइज का उपयोग करके बेसमेंट मैट्रिक्स डोम को बाधित। एक ट्यूब में 48-अच्छी तरह से प्लेट के चार कुओं की पूल सामग्री।
    2. यंत्रवत् एक छोटे से टुकड़ों में ऑर्गेनॉइड को एक पी 200 विंदुक के साथ ऊपर और नीचे pipetting द्वारा लगभग 200 बार तोड़ देता है। कमरे के तापमान पर अपकेंद्रित्र, 5 मिनट 600 x ग्राम पर
    3. मध्यम निकालें और एक सेल संस्कृति ग्रेड पुनः संयोजक प्रोटीज (सामग्री की तालिका देखें) के 1 एमएल में गोली resuspend। अधिकतम 5 मिनट के लिए 37 डिग्री सेल्सियस पर सेते हैं और फिर एक 4x उद्देश्य के साथ एक औंधा प्रकाश माइक्रोस्कोप के तहत नमूने की 50-μL ड्रॉप की जांच करें।
      नोट: 10 - 15 कोशिकाओं के समूहों वांछनीय हैं, क्योंकि यह इलेक्ट्रोपोरेशन के बाद सेल अस्तित्व को बढ़ाता है।
    4. सेल निलंबन को कम बाध्यकारी 15 एमएल ट्यूब में स्थानांतरित करें और रोकेंएंटीबायोटिक दवाओं के बिना बेसल माध्यम के 9 एमएल जोड़कर पृथक्करण ( तालिका 2 देखें)। कमरे के तापमान पर अपकेंद्रित्र, 5 मिनट 600 ग्राम पर, फिर सतह पर तैरनेवाला को त्याग दें और 1 एमएल कम सीरम माध्यम ( सामग्री की तालिका देखें) में गोली को फिर से खोलें।
    5. एक ब्यकर के कक्ष के साथ कोशिकाओं की संख्या की गणना करें और प्रति-इलेक्ट्रोपायर प्रतिक्रिया प्रति 1 एक्स 10 5 कोशिकाओं का न्यूनतम उपयोग करें। 15 मिलीलीटर ट्यूब में 9 एमएल कम सीरम माध्यम और कमरे के तापमान पर अपकेंद्रित्र जोड़ें, 400 मिनट में 3 मिनट 3 मिनट
  • इलेक्ट्रोपोरेशन
    नोट: निम्न अनुभाग इलेक्ट्रोपोरॉजेशन करने के लिए और ऑगोगोइड्स को बाद में ठीक करने के निर्देश देते हैं।
    1. सतह पर तैरने वाले सभी को निकालें और एक इलेक्ट्रोपायर समाधान (गोली की सामग्री देखें) में गोली resuspend। सेल निलंबन के लिए 10 μg डीएनए की कुल राशि जोड़ें और 100 μL के अंतिम मात्रा में electroporation समाधान जोड़ें और सेल-डीएन रखनाबर्फ पर एक मिश्रण एक 1: 1 अनुपात में सीआरएसआरपी-कॉन्सटामामर वैक्टर का उपयोग सीएएसएम अभिव्यक्ति प्लाज्मिड ( उदाहरण के लिए एग्जेन # 41815) के साथ करें।
      नोट: डीएनए की कुल मात्रा कुल प्रतिक्रिया मात्रा के 10% से कम या उसके बराबर होनी चाहिए।
    2. अभिकर्मक दक्षता ( जैसे पीसीएमवी-जीएफपी, एडगेन # 11153, या कोई सामान्य जीएफपी-व्यक्त प्लाज्मिड) का मूल्यांकन करने के लिए एक जीएफपी प्लाज्मिड वाला एक अलग अभिकर्मक मिश्रण शामिल करें।
    3. Electroporation क्युवेट में कोशिका-डीएनए मिश्रण को जोड़ें और इलेक्ट्रोप्रोटर चैंबर में रखें। Electroporator पर उपयुक्त बटन धक्का द्वारा प्रतिबाधा उपाय और सुनिश्चित करें कि यह 0.030-0.055 Ω है। तालिका 3 में दिखाए गए सेटिंग के मुताबिक इलेक्ट्रोप्लोरेशन करना
      नोट: यदि प्रतिबाधा मान अनुमत सीमा के बाहर आता है, क्यूवेट में समाधान मात्रा समायोजित करें।
    4. 400 μL इलेक्ट्रोपोरेशन बफर + Y-27632 को क्युवेट में जोड़ें और फिर सभी को 1.5 एमएल ट्यूब में स्थानांतरित करें। Incubaकमरे के तापमान पर 30 मिनट के लिए तापमान पर कोशिकाओं को ठीक करने और बाद में उन्हें कमरे के तापमान पर 400 मिनट में 3 मिनट के लिए स्पिन करने की अनुमति देता है
    5. सतह पर तैरनेवाला निकालें और गोली को 20 μL / अच्छी तरह से बेसमेंट मैट्रिक्स में रीसेट करें। लगभग 1 x 10 4 से 1 x 10 5 कोशिकाओं की प्रति अच्छी तरह से 48-अच्छी तरह से प्लेट में और एन + CHIR99021 + Y-27632 + 1.25% वी / वी डीएमएसओ माध्यम जोड़ें। 37 डिग्री सेल्सियस पर सेते हैं
    6. 5 दिन, माध्यम को एन + CHIR99021 + Y-27632 में बदलें और GFP अभिव्यक्ति ( चित्रा 2 ) देखकर अभिकर्मक दक्षता की जांच करें। Organoids को 37 डिग्री सेल्सियस रखें और दो दिनों के बाद एन + CHIR99021 + Y-27632 मध्यम ताज़ा करें।
    7. 9 दिन, मध्यम को वेनआर + निक + वाई -27632 में बदलें और 37 डिग्री सेल्सियस पर सेते हैं
      नोट: Y-27632 को 7-10 दिनों के बाद हटाया जा सकता है (दिन 16-19)।
  • पियर्स पल्स स्थानांतरण पल्स
    वोल्टेज 175V 20V
    पल्स लंबाई 5 मिसे 50msec
    पल्स अंतराल 50msec 50msec
    दालों की संख्या 2 5
    क्षय दर 10% 40%
    विचारों में भिन्नता + +/-

    तालिका 3: इलेक्ट्रोप्रोरेज सेटिंग्स

    4. विकास फैक्टर निकासी

    नोट: यहां यह उदाहरण है कि आंतों के आयोजोइड्स में Wnt मार्ग के नकारात्मक नियामकों को दस्तक करते हुए वृद्धि कारक वापसी का प्रयोग कैसे किया जाए।

    1. 10-14 दिन पहलेआर इलेक्ट्रोपायर, उपरोक्त चरणों (3.2.1 - 3.2.2) के बाद 48-अच्छी तरह से एक प्लेट में 1: 3 अनुपात में ऑर्गनाइओड को विभाजित करता है।
    2. तहखाने झिल्ली मैट्रिक्स के 20 μL में organoid गोली resuspend और इसे 10 मिनट के लिए 37 डिग्री सेल्सियस पर स्थिर होना। इसके बाद, यह निर्धारित करने के लिए कि लक्ष्य जीन का पछाड़ना 5 हासिल किया गया है या नहीं, यह परीक्षण करने के लिए 250 μL की वृद्धि कारक-वंचित माध्यम ( जैसे एन एन) का ओवरले।
    3. जंगली प्रकार की जंगली प्रकार (डब्लूटी) नियंत्रण एंजाइड्स और उत्परिवर्ती organoids 5 , 15 के बीच अस्तित्व में अंतर देखने के लिए कम से कम 2 - 3 मार्गों के लिए विकास कारक-वंचित स्थितियों के तहत इण्डोएड्स को विभाजित करें।
      ध्यान दें: वन्यजीव पीढ़ी के माध्यम से दो मार्गों पर विकास कारक-वंचित माध्यम में जीवित रहने में सक्षम नहीं होना चाहिए, जबकि उत्परिवर्ती लाइनों को बढ़ने में सक्षम होना चाहिए।

    Representative Results

    संगामी वेक्टर में जीआरएनए सम्मिलन की सही संख्या की पुष्टि करने के लिए, प्रतिबंध पाचन एंजाइमों ( इकोआर I + Bgl II) के साथ किया जाता है जो सभी जीआरएनए कोटिंग्स व्यक्त करता है (प्रत्येक कैसेट आकार ~ 400 बीपी, चित्रा 1 )। उदाहरण के लिए, जब 4 जीआरएनए-कंटेटेमीर वेक्टर उत्पन्न करते हैं, तो एगरोस जेल में निचले बैंड के अनुमानित आकार लगभग 1.6 केपीपी; इस से कम कोई भी बैंड इंगित करता है कि सभी 4 जीआरएनए कैसेट वेक्टर ( चित्रा 2 ए ) में डाली जाती हैं। इसके अलावा, यह हमेशा जांचने की सिफारिश की जाती है कि सभी बीबीएस I मान्यता स्थलों को खो दिया जाता है और एंजाइम वेक्टर ( चित्रा 2 बी ) काट नहीं करता है।

    एक बार निर्माण की पुष्टि हो जाने के बाद, ऑप्टिमा को प्राप्त करने के लिए इलेक्ट्रोपायर द्वारा माउस आंतों के आयोजोइड को वितरित किया जा सकता हैएल के स्तर अभिकर्मक दक्षता (70% तक), जैसा कि GFP नियंत्रण ( चित्रा 3 ) द्वारा दिखाया गया है।

    अंत में, इस रणनीति की कार्यक्षमता का कार्यात्मक रूप से परीक्षण करने के लिए, एक्स 7/2 और आरएनएफ 43 / जेएनआरएफ 3 के खिलाफ कैस 9 और कंटेटेमेटर वैक्टर के साथ ट्रांसटेक्टेड आंतों के इनोगोइड्स एन (आर-स्पॉन्डीन निकासी) और एन + आईडब्लूपी 2 (आर-स्पॉन्डिन और डब्ल्यूटीएफ, आईडब्ल्यूपी 2 : पर्किफाइन इनहिबिटर, 2.5 माइक्रोग्राम) न्यूनतम 3 मार्गों के लिए मीडिया ( चित्रा 4 )। जबकि अप्रतिबंधित डब्ल्यूटीई ऑर्गोयॉइड दोनों शर्तों के तहत मृत्यु हो गई, एक्स -1 / 2 नॉकआउट ऑर्गोइओड्स Wnt मार्ग के डाउनस्ट्रीम सक्रियण के कारण दोनों में बचे; इसके अलावा, आरएनएफ 43 / जेनआरएफ 3 उत्परिवर्ती organoids आर-स्पंडिन की अनुपस्थिति में जीवित रहते हैं लेकिन IWP2 की उपस्थिति में जीवित नहीं रह सकते हैं, जिससे मार्ग सक्रिय करने वाले Wnt की कमी हो सकती है। एक साथ लिया जाता है, इन टिप्पणियों से पता चलता है कि इन जोड़ों के नॉकआउट को टी उत्पन्न करने से संभव हैवह ऑर्गेऑन फेनोटाइप की उम्मीद कर रहा था। इन परिणामों का विवरण विकास जीवविज्ञान 5 में प्रकाशित किया गया है।

    आकृति 1
    चित्रा 1: 4 कैसेट्स के साथ क्रिस्टी-कॉन्टैटेमर के योजनाबद्ध प्रतिनिधित्व इस क्रम में प्रत्येक उल्लिखित दोहराया बीबीएस आई साइटें (बी बी के रूप में भी इंगित किया गया है) और जीआरएनए पाबंदी वाले प्रत्येक 400 बीपी केसेट के साथ 4 जीआरएनए-कंटेटेमेटर वेक्टर की योजना। फेरबदल प्रतिक्रिया के दौरान, Bbs मैं साइटों overhangs मिलान और फलस्वरूप खो साथ gRNA टुकड़े ने ले ली है। जीआरएनए oligos के सही प्रविष्टि की जांच के लिए अनुक्रमण primers की बाध्यकारी साइटें नीले तीर द्वारा दिखाए जाते हैं। एफडब्ल्यूडी = आगे प्राइमर, रेव = रिवर्स प्राइमर, लिंक 1/2/3 = लिंकर क्षेत्र 1/2/3 कृपया देखेंइस आंकड़े का एक बड़ा संस्करण देखने के लिए यहाँ चाटना

    चित्र 2
    चित्रा 2: समासमीटर वेक्टर के प्रतिनिधि पाचन पैटर्न ( ) इकोआर I और बीजीएल II के साथ 3 और 4 जीआरएनए-कंटेटेमेटर वैक्टर के डबल पाचन। सही पाचन पैटर्न एक हरे रंग की टिक से चिह्नित होता है, जबकि केवल 1 या 2 जीआरएनए सम्मिलन वाले वैक्टर को एक लाल क्रॉस द्वारा चिह्नित किया जाता है। लेन 1 सकारात्मक नियंत्रण ("+" द्वारा चिन्हित) के रूप में इस्तेमाल किया गया एक 4 जीआरएनए- संगीतात्मक पैतृक वेक्टर के पाचन को दिखाता है; इसी प्रकार, लेन 5 एक 3 जीआरएनए-कॉन्टैटेमर पैतृक वेक्टर के पाचन को दर्शाता है, जिसे "+" द्वारा चिह्नित किया गया है। ( बी ) बीबीएस I के साथ पाचन, अपरिहार्य संविदात्मक वैक्टर का सही आकार दिखाते हुए (हरे रंग की टिक्कों द्वारा इंगित किया गया) एक gRNA युक्त concatemer वेक्टर कि Bbs मैं साइटों को खो दिया है के पाचन एक सकारात्मक नियंत्रण एक के रूप में प्रयोग किया जाता हैडी "+" द्वारा चिह्नित है इस आंकड़े के एक बड़े संस्करण को देखने के लिए कृपया यहां क्लिक करें

    चित्र तीन
    चित्रा 3: सफलतापूर्वक electroporated आंतों organoids की प्रतिनिधि छवि जीएफपी प्लाज्मिड की अभिकर्मक अभिकर्मक दक्षता का मूल्यांकन करने के लिए महत्वपूर्ण है। Electroporation के बाद लगभग 24 घंटे, छोटे कोशिकाओं युक्त organoids पहले से ही दिखाई दे रहे हैं और, अगर electroporation प्रक्रिया सफल रहा, उनमें से 70% तक हरी प्रतिदीप्ति प्रदर्शित करता है बीएफ = उज्ज्वल क्षेत्र, जीएफपी = हरे फ्लोरोसेंट प्रोटीन स्केल बार = 2,000 माइक्रोन इस आंकड़े के एक बड़े संस्करण को देखने के लिए कृपया यहां क्लिक करें


    चित्रा 4: उत्परिवर्ती आंतों के संगठनों की प्रतिनिधि छवियाँ Wnt मार्ग Axin1 और Rnf43 के नकारात्मक नियामकों का नॉकआउट, साथ में उनके paralogues के साथ, वृद्धि कारक अभाव के लिए प्रतिरोधी आंत्र organoids प्रदान करता है। विशेष रूप से, एक्सिन 1/2 नॉकआउट अंगोइड (एक्सिन 1/2 केओ) आर-स्पोंडिन (एन: ईजीएफ + नोगिन) और Wnt (एन + आईडब्ल्यूपी 2: एन + पोर्कोप्पीन इन्हिबिटर) के अभाव में बढ़ सकता है, जबकि आरएनएफ 43 / जेनआरएफ 3 उत्परिवर्ती organoids (आर एंड जेड केओ) केवल आर-स्पोंडिन (एन) की अनुपस्थिति में जीवित रह सकते हैं। इसके विपरीत, WT organoids केवल नियंत्रण संस्कृति की स्थिति, WENR + निक (Wnt + EGF + नोगिन + आर स्पॉन्डिन + निकोटीनमाइड) में जीवित रह सकते हैं। स्केल सलाखों = 1000 माइक्रोन इस आंकड़े के एक बड़े संस्करण को देखने के लिए कृपया यहां क्लिक करें

    बेसल माध्यम टिप्पणियाँ
    4 सप्ताह के लिए 4 डिग्री सेल्सियस पर स्टोर करें
    सेल संस्कृति माध्यम 500 एमएल सामग्रियों की तालिका देखें
    एल-ग्लुटामाइन 100x 5 एमएल
    बफरिंग एजेंट 1 एम 5 एमएल सामग्रियों की तालिका देखें
    पेनिसिलिन स्ट्रेप्टोमाइसिन 100x 5 एमएल
    वेनआर + निक (विंट + ईजीएफ + नोगिन + आर स्पॉन्डिन + निकोटिनमाइड)
    2 सप्ताह के लिए 4 डिग्री सेल्सियस पर स्टोर करें
    बेसल माध्यम 50 एमएल तक
    न्यूरॉनल सेल सीरम मुक्त पूरक (50x) 1 एमएल मा की तालिका देखेंterials
    न्यूरॉनल सेल सीरम मुक्त पूरक (100x) 500 μL सामग्रियों की तालिका देखें
    एन-एसिटीस्सीस्टीन (500 मिमी) 125 μL
    माउस ईजीएफ (100 माइक्रोग्राम / एमएल) 25 μL
    माउस नोगिन (100 माइक्रोग्राम / एमएल) 50 μL
    आर स्पॉन्डिन वातानुकूलित माध्यम 5 एमएल
    Wnt3a मध्यम वातानुकूलित 25 एमएल
    निकोटीनामाइड (1 एम) 250 μL
    एन + चीर + वाई -27 632 (ईजीएफ + नोगिन + चीर + वाई -27 632)
    2 सप्ताह के लिए 4 डिग्री सेल्सियस पर स्टोर करें
    बेसल मध्यम w / ओ पेनिसिलिन स्ट्रेप्टोमाइसिन 20 एमएल तक
    न्यूरॉनल सेल सीरम मुक्त पूरक (50x) 400 μL सामग्रियों की तालिका देखें
    न्यूरॉनल सेल सीरम मुक्त पूरक (100x) 200 μL सामग्रियों की तालिका देखें
    एन-एसिटीस्सीस्टीन (500 मिमी) 50 μL
    माउस ईजीएफ (100 माइक्रोग्राम / एमएल) 10 μL
    माउस नोगिन (100 माइक्रोग्राम / एमएल) 20 μL
    वाई -27,632 (10 सुक्ष्ममापी) 20 μL
    CHIR99021 (8 सुक्ष्ममापी) 10 μL
    एन (ईजीएफ + नोगिन)
    4 सप्ताह के लिए 4 डिग्री सेल्सियस पर स्टोर करें
    बेसल माध्यम 50 एमएल तक
    न्यूरॉनल सेल सीरम मुक्त पूरक (50x) सामग्री की तालिका देखें
    न्यूरॉनल सेल सीरम मुक्त पूरक (100x) 500 μL सामग्री की तालिका देखें
    एन-एसिटीस्सीस्टीन (500 मिमी) 125 μL
    माउस ईजीएफ (100 माइक्रोग्राम / एमएल) 25 μL
    माउस नोगिन (100 माइक्रोग्राम / एमएल) 50 μL

    तालिका 2: ऑर्गेनॉयड मीडिया संरचना।

    Discussion

    इस प्रोटोकॉल में, हम सीआरआईएसपीआर-कॉस्मेटर्स को उत्पन्न करने के लिए आवश्यक सभी कदमों का विस्तार करते हैं और माउस आंतों के ऑर्गेनाइएड्स में सीआरआईएसपीआर-कॉम्टाटाइमर्स को लागू करने के लिए एक साथ कई जीनों को बाहर निकालते हैं। जैसा कि पहले उल्लेख किया गया है, इस रणनीति में कई फायदे हैं, जैसे कि इसकी गति, उच्च दक्षता और लागत-प्रभावशीलता।

    पूरी प्रक्रिया को सफलतापूर्वक पूरा करने के लिए, विचार करने के लिए कुछ महत्वपूर्ण पहलू हैं। सबसे पहले, यह जरूरी है कि सभी gRNA ओलिगोस ठीक से annealed हैं और फॉस्फोरिलेटेड है, के रूप में वे प्रतिक्रिया क्लोनिंग अपने आप में बहुत ही कुशल है कि Bbs मैं के लिए शुरू कर सामग्री का प्रतिनिधित्व करते हैं। दूसरे, जब इलेक्ट्रोफोरेटिंग ऑ organoids, अधिक प्रति कोशिकाओं के लिए इस्तेमाल कोशिकाओं, अधिकतम संभव अभिकर्मक दक्षता उच्च। इसके अलावा, यह भी महत्वपूर्ण है कि कोशिका के पृथक्करण के बाद, छोटे कोशिका समूहों एकल कोशिकाओं पर प्रबल हो जाते हैं।

    फिर भी, तकनीकी समस्या का सामना करना संभव हैपहली बार क्लोनिंग या अभिकर्मक का प्रयास करते समय लीम; जीआरएनए क्लोनिंग के दौरान समस्याओं के मामले में, जीआरएनए ओलिगो अनुक्रम को दोबारा जांचने की सिफारिश की जाती है, और अगर सही हो, प्रतिबंध पाचन स्क्रीनिंग के लिए अतिरिक्त बैक्टीरियल कॉलोनियों का चयन करें। यदि अभिकर्मक दक्षता और सेल व्यवहार्यता कम-पोस्ट-इलेक्ट्रोपोरेशन हैं, तो यह प्रति शर्त अधिक कोशिकाओं का उपयोग कर प्रोटोकॉल को दोहराने और 3 मिनट तक सेल विस्थापन के समय को कम करने की सलाह दी जाती है।

    हालांकि सीआरआईएसपीआर-कंसटाइमर्स की पीढ़ी अपेक्षाकृत सस्ता और आसान है, ऑर्गनोइड में बड़े पैमाने पर आनुवंशिक स्क्रीन प्रदर्शन करना नहीं है, क्योंकि पैमाने पर ऑनोनोइड संस्कृति से जुड़े लागत और श्रम-गहन प्रकृति द्वारा सीमित है। इस मामले में उल्लेखनीय रूप से उल्लेखनीय है कि सीआरआईएसपीआर-कंसाटेमर विधि सेल लाइनों जैसे एचई 2 9 3 और माउस भ्रूण स्टेम कोशिकाओं के साथ भी संगत है।

    सेलुलर सिस्टम के बावजूद, इस एस के एक और संभावित दोषतीन या चार अलग-अलग जीनों के साथ-साथ नॉकआउट करने पर ट्राटेजी का सामना करना पड़ सकता है। उदाहरण के लिए, प्रत्येक जीआरएनए में एक अलग लक्ष्यीकरण दक्षता होगी और एक ही समय में सभी जीनों को मारने के बदलाव अपेक्षाकृत कम हो सकते हैं; इस कारण से, एक ही जीन के खिलाफ एक से अधिक जीआरएनए को निर्देशित करने के लिए सम्मेलन प्रणाली को नियोजित करने की सलाह दी जाती है।

    मल्टीप्लेक्स जीआरएनए वैक्टर 7 , 8 को उत्पन्न करने के लिए इसी तरह गोल्डन गेट फेरबदल पर आधारित वैकल्पिक रणनीतियों को प्रस्तावित किया गया है। हालांकि, हमारे पद्धति में क्लोनिंग के एक ही दौर में एक एकल रेट्रोवायरल वेक्टर में कई जीआरएनए को सीधे इकट्ठा करना संभव है, जो जीआरएनए लाइब्रेरियों को पैरोलोजेस को लक्षित करने के लिए उपयुक्त बनाता है।

    हमारे सीआरआईएसपीआर-कंटेटेमेटर एमएससीवी रेट्रोवायरल वेक्टर बैकबोन में बनाया गया है। इस प्रकार, जीआरएनए समामेलर वाले रेट्रोवायरस का उपयोग स्थिर सेल लाइनों को उत्पन्न करने के लिए किया जा सकता है जो ओवरएक्सपीरेस जीआरएनए जब Cas9-inducible प्रणाली के साथ संयुक्त, एक हमारे सिस्टम का उपयोग कर inducible paralogue knockouts प्रदर्शन कर सकते हैं।

    संक्षेप में, हम यहां बताते हैं कि एक ही सदिश में एक ही सदिश में चार अलग-अलग जीआरएनए को क्लोन कैसे करें और उच्च अभिकर्मक दक्षता के साथ organoid संस्कृति को इस रणनीति को कैसे लागू किया जाए। इसके अलावा, हम पूरी प्रक्रिया में सफलता की संभावना को अधिकतम करने के लिए उपयोगी सुझाव प्रदान करते हैं।

    Disclosures

    लेखकों के पास खुलासे के लिए कुछ भी नहीं है। लेखकों को ब्याज का कोई विरोध नहीं घोषित किया गया है।

    Acknowledgments

    हम पांडुलिपि के महत्वपूर्ण पढ़ने के लिए क्रिस्टोफर हिंडले को धन्यवाद करते हैं। एएम Wntsapp (मैरी क्यूरी आईटीएन), एए-आर द्वारा समर्थित है चिकित्सा अनुसंधान परिषद (एमआरसी), और बीके के द्वारा समर्थित है। और आरएम वेलकम ट्रस्ट और रॉयल सोसाइटी [101241 / जेड / 13 / जेड] से सर हेनरी डेल फेलोशिप द्वारा समर्थित हैं और वे वेलकम ट्रस्ट और एमआरसी से वेलकम ट्रस्ट - एमआरसी कैम्ब्रिज स्टेम सेल इंस्टीट्यूट ।

    Materials

    Name Company Catalog Number Comments
    Optimized CRISPR Design Tool Feng Zhang group CRISPR gRNA design tool; http://crispr.mit.edu/
    Webcutter 2.0 restriction mapping tool; http://rna.lundberg.gu.se/cutter2/
    T4 PNK (Polynucleotide Kinase) New England Biolabs M0201L
    T4 DNA ligase buffer New England Biolabs M0202S
    T7 DNA Ligase New England Biolabs M0318L
    DTT (dithiothreitol) Promega P1171
    ATP (adenosine triphosphate) New England Biolabs P0756S
    FastDigest BbsI (BpiI) Thermo Fisher FD1014
    Tango buffer (BSA-containing restriction enzyme buffer) Thermo Fisher BY5
    BglII New England Biolabs R0144
    EcoRI New England Biolabs R0101
    Plasmid-safe exonuclease Cambio E3101K
    Thermal cycler Applied biosystems 4359659
    10G competent E. coli bacteria Cambridge Bioscience 60108-1
    Plasmid mini kit Qiagen 12125
    Table top microcentrifuge Eppendorf UY-02580-01
    Inoculating loops Microspec PLS5
    Bacteria incubator Sanyo MIR-262
    Luria-Bertani broth (LB) Sigma-Aldrich L3522
    Agarose Sigma-Aldrich A4718
    Agarose gel electrophoresis apparatus Bioneer A-7020
    Advanced DMEM/F12(cell culture medium) Invitrogen 12634-034
    Glutamax (L-Glutamine) 100x Invitrogen 35050-068
    HEPES 1 M (buffering agent) Invitrogen 15630-056
    Penicillin-streptomycin 100x Invitrogen 15140-122
    B27 supplement (Neuronal cell serum-free supplement) 50x Invitrogen 17504-044
    N2 supplement (Neuronal cell serum-free supplement) 100x Invitrogen 17502-048
    n-Acetylcysteine 500 mM Sigma-Aldrich A9165-5G
    Mouse EGF 500 µg/mL Invitrogen Biosource PMG8043
    Mouse Noggin 100 µg/mL Peprotech 250-38
    Nicotinamide 1 M Sigma N0636
    R-Spondin conditioned medium n.a. n.a. Produced in house from HEK293 cells, for details see Sato and Clevers 2013
    Wnt conditioned medium n.a. n.a. Produced in house from HEK293 cells, for details see Sato and Clevers 2013
    Y-27632 10 µM Sigma-Aldrich Y0503-1MG
    Standard BD Matrigel matrix BD Biosciences 356231
    48-well Plate Greiner Bio One 677980
    CHIR99021 Sigma-Aldrich A3734-1MG
    IWP-2 Cell Guidance Systems SM39-10
    TrypLE (recombinant protease) Invitrogen 12605-010
    Opti-MEM (reduced serum medium ) Life technologies 51985-034
    Electroporation Cuvettes 2 mm gap NepaGene EC-002S
    Low binding 15 mL tubes Sigma-Aldrich CLS430791
    Bürker’s chamber Sigma-Aldrich BR719520-1EA
    NEPA21 Super Electroporator NepaGene contact supplier
    Protein LoBind tubes low binding Thermo Fisher 10708704
    BTXpress electroporation buffer Harvard Apparatus 45-0805
    DMSO (Dimethyl sulfoxide) AppliChem A3672

    DOWNLOAD MATERIALS LIST

    References

    1. Mali, P., et al. RNA-Guided Human Genome Engineering via Cas9. Science. 339, (6121), 823-826 (2013).
    2. Koike-Yusa, H., Li, Y., Tan, E. -P., Velasco-Herrera, M. D. C., Yusa, K. Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library. Nat Biotech. 32, (3), 267-273 (2014).
    3. Bassett, A. R., Kong, L., Liu, J. L. A Genome-Wide CRISPR Library for High-Throughput Genetic Screening in Drosophila Cells. J Genet Genomics. 42, (6), 301-309 (2015).
    4. Diss, G., Ascencio, D., DeLuna, A., Landry, C. R. Molecular mechanisms of paralogous compensation and the robustness of cellular networks. J Exp Zool B Mol Dev Evol. 322, (7), 488-499 (2014).
    5. Andersson-Rolf, A., Merenda, A., Mustata, R. C., Li, T., Dietmann, S., Koo, B. -K. Simultaneous paralogue knockout using a CRISPR-concatemer in mouse small intestinal organoids. Dev Biol. 420, (2), 1-7 (2016).
    6. Ran, F. A., Hsu, P. P. D., Wright, J., Agarwala, V., Scott, D., Zhang, F. Genome engineering using the CRISPR-Cas9 system. Nat Protoc. 8, (11), 2281-2308 (2013).
    7. Engler, C., Gruetzner, R., Kandzia, R., Marillonnet, S. Golden gate shuffling: A one-pot DNA shuffling method based on type IIs restriction enzymes. PLoS ONE. 4, (5), (2009).
    8. Sakuma, T., Nishikawa, A., Kume, S., Chayama, K., Yamamoto, T. Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 4, (5), 5400 (2014).
    9. Kabadi, A. M., Ousterout, D. G., Hilton, I. B., Gersbach, C. A. Multiplex CRISPR/Cas9-based genome engineering from a single lentiviral vector. Nucleic Acids Res. 42, (19), 1-11 (2014).
    10. Yin, L., et al. Multiplex Conditional Mutagenesis Using Transgenic Expression of Cas9 and sgRNAs. Genetics. 200, (2), 431-441 (2015).
    11. Cress, B. F., Toparlak, O. D., et al. CRISPathBrick: Modular Combinatorial Assembly of Type II-A CRISPR Arrays for dCas9-Mediated Multiplex Transcriptional Repression in E. coli. ACS Synth Biol. 4, (9), 987-1000 (2015).
    12. Froger, A., Hall, J. E. Transformation of plasmid DNA into E. coli using the heat shock method. J Vis Exp. (6), e253 (2007).
    13. Zimmermann, J., Voss, H., Schwager, C., Stegemann, J., Ansorge, W. Automated Sanger dideoxy sequencing reaction protocol. FEBS Letters. 233, (2), 432-436 (1988).
    14. Fujii, M., Matano, M., Nanki, K., Sato, T. Efficient genetic engineering of human intestinal organoids using electroporation. Nat. Protoc. 10, (10), 1474-1485 (2015).
    15. Andersson-Rolf, A., Fink, J., Mustata, R. C., Koo, B. -K. A video protocol of retroviral infection in primary intestinal organoid culture. J Vis Exp. (90), e51765 (2014).

    Erratum

    Formal Correction: Erratum: A Protocol for Multiple Gene Knockout in Mouse Small Intestinal Organoids Using a CRISPR-concatemer
    Posted by JoVE Editors on 01/02/2018. Citeable Link.

    An erratum was issued for: A Protocol for Multiple Gene Knockout in Mouse Small Intestinal Organoids Using a CRISPR-concatemer. There was a typo in step 3.3 of the Protocol.

    Step 3.3 was corrected from:

    Add the cell-DNA mixture to the electroporation cuvette and place it in the electroporator chamber. Measure the impedance by pushing the appropriate button on the electroporator and ensure that it is 0.030-0.055 Ω

    to:

    Add the cell-DNA mixture to the electroporation cuvette and place it in the electroporator chamber. Measure the impedance by pushing the appropriate button on the electroporator and ensure that it is 0.030-0.055 kΩ

    Comments

    0 Comments


      Post a Question / Comment / Request

      You must be signed in to post a comment. Please or create an account.

      Usage Statistics