פרוטוקול של נוקאוט גנים מרובים עכבר קטן Organoids באמצעות CISPR-concatemer

Bioengineering
 

ERRATUM NOTICE

Summary

פרוטוקול זה מתאר את השלבים לשיבוט מספר רב של מדריך RNAs לתוך אחד וקטור RNA concatmer מדריך, שהוא שימוש מיוחד ביצירת נוק-אאוט רב גנים באמצעות טכנולוגיית CRISPR / Cas9. הדור של נוקאאוטס כפול באורגנואידים במעיים מוצג כיישום אפשרי של שיטה זו.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Merenda, A., Andersson-Rolf, A., Mustata, R. C., Li, T., Kim, H., Koo, B. K. A Protocol for Multiple Gene Knockout in Mouse Small Intestinal Organoids Using a CRISPR-concatemer. J. Vis. Exp. (125), e55916, doi:10.3791/55916 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

CRISPR / Cas9 הטכנולוגיה שיפרה מאוד את הכדאיות ואת המהירות של אובדן של הפונקציה מחקרים חיוניים בהבנת תפקוד הגן. ב אוקריוטים גבוהים יותר, גנים paralogous יכול להסוות פנוטיפ פוטנציאלי על ידי פיצוי אובדן גן, ובכך להגביל את המידע שניתן להשיג ממחקרים גנטיים להסתמך על נוקאאוט הגן יחיד. פיתחנו שיטה שיבוט חדש, מהיר עבור RNA מדריך (gRNA) concatemers על מנת ליצור knockouts גן רב לאחר סיבוב אחד של transfection ב אורגנואידים מעיים עכברים קטנים. האסטרטגיה שלנו מאפשרת concatemerization של עד ארבעה gRNAs בודדים לתוך וקטור אחד על ידי ביצוע תגובה אחת גרירת שער אחת עם oligos annealed gRNA ו וקטור retroviral תוכנן מראש. זה מאפשר גם את נוקאאוט בו זמנית של עד ארבעה גנים שונים, או יעילות מוגברת נוקאאוט בעקבות המיקוד של גן אחד על ידי gRNAs מרובים. בפרוטוקול זה, אנו מראים בפירוטאיך לשכפל ביעילות gRNAs מרובים לתוך וקטור CRISPR- רטרובירל concatmer וכיצד להשיג electroporation יעיל ביותר באורגנואידים במעיים. כדוגמה, אנו מציגים כי נוקאאוט בו זמנית של שני זוגות של גנים קידוד הרגולטורים השליליים של נתיב איתות Wnt (Axin1 / 2 ו Rnf43 / Znrf3) הופך אורגנואידים מעיים עמיד לנסיגה של גורמי גדילה מרכזיים.

Introduction

הגישה הגנטית הפוכה היא שיטה נפוצה לחקר הפונקציה של הגן. במיוחד, אובדן של תפקוד מחקרים, שבו הפרעה של הגן גורם שינויים פנוטיפיים, לשחק תפקיד מפתח בבניית ההבנה שלנו של תהליכים ביולוגיים. שיטת CRISPR / Cas9 מייצגת את ההתקדמות האחרונה בטכנולוגיה להנדסת גנום, והיא חוללה מהפכה בתרגול הנוכחי של גנטיקה בתאים ובאורגניזמים. Cas9 הוא endonuclease מונחה RNA אשר נקשר רצף DNA ספציפי המשלים את gRNA ומייצר הפסקה פעמיים גדיל (DSB). זה DSB מגייס מכונות תיקון DNA, בהיעדר תבנית ה- DNA עבור רקומבינציה הומולוגיים, יהיה לקשור מחדש את גדיל ה- DNA לחתוך דרך מצמידים השגיאה הלא הומולוגיים סוף שהצטרף, אשר יכול ובכך לגרום החדירות או מחיקות של נוקליאוטידים (s) גרימת מוטציות frameshift 1 .

הקלות הגדולה צדדיות של CRISPR / Cas9 apprאואך עשה את זה כלי אטרקטיבי ביותר עבור מסכי הגנום בקנה מידה נוקאאוט שנועדו לפענח פונקציות הגן הלא ידוע 2 , 3 . אף על פי כן, גישות נוקאאוט חד פעמיות של גנים הן בשימוש מוגבל אם קיימים מספר פרלוגים עם פונקציות מיותרות. לכן, ablating גן יחיד לא יכול להיות מספיק כדי לקבוע את הפונקציה של הגן הזה נתון פיצוי אפשרי על ידי paralogues וכתוצאה מכך שינוי פנוטיפי מעט או ללא 4 . לכן חשוב לדפוק paralogues במקביל על ידי מתן מספר gRNA וקטורים מיקוד גנים paralogous שונים על מנת להתגבר על ההשפעה של פיצוי גנטי.

כדי להרחיב את השימוש של CRISPR / Cas9 כדי נוק-אאוט הגן paralogous, פיתחנו לאחרונה מהירה, צעד אחד שיבוט שיטה לשכפל עד ארבעה gRNAs מראש annealed לתוך וקטור retroviral אחד 5 . עמוד השדרה, הנקרא CRISPR-concatemer, מבוססעל MSVV retroviral פלסמיד המכיל חוזרים קלטות ביטוי gRNA. כל קלטת מכילה שני אתרי זיהוי הפוכה של IIS IIS סוג הגבלה BBS אני, אשר ניתן להחליף באופן בלתי הפיך על ידי oligo gRNA annealed עם overhangs תואמים באמצעות תגובת שער הזהב דשדוש בצינור אחד 6 . שיטה זו שיבוט מורכב מחזורים חוזרים ונשנים של עיכול קשירת המאפשרים הרכבה בו זמנית של שברי DNA מרובים על ידי ניצול רצפים התלוי שונים שנוצרו על ידי Bbs I. הייחודיות של האנזים הזה הוא, למשל, את היכולת לבצע קיצוצים אסימטריים מחוץ להכרה שלה סדר פעולות; לכן, כל קלטת יכול להיות רצף שונה עם overhangs מותאמים אישית צף BBS אני הליבה באתר ובדרך זו, כל gRNA ניתן לשכפל במיקום מסוים הכיוון של וקטור concatmer.

כהוכחה לעיקרון, הוכחנו את השימוש באסטרטגיה זו בעכברים אורגנואידים על ידי הפרעה בו זמנית שני זוגות של הרגולטורים השליליים paralogous של מסלול Wnt על ידי סיבוב אחד של electroporation 5 .

במהלך השנים האחרונות, קבוצות רבות אחרות פיתחו אסטרטגיות דומות המבוססות על מספר וקטורים ביטוי gRNA שנבנו באמצעות שער הזהב דשדוש 7 כדי להשיג נוק-אאוט גנים רב במערכות מודל שונים, כגון שורות תאים אנושיים 8 , 9 , דג הזברה 10 ו Escherichia coli 11 . בפרוטוקולים שלהם, gRNAs משוכפלים הראשון לתוך וקטורים ביניים בודדים ולאחר מכן התאספו יחד לתוך מוצר אחד הסופי. לעומת זאת, היתרון העיקרי של האסטרטגיה שלנו CRISPR- concatemer היא הנוחות של אחד BBS אני דשדוש, צעד שיבוט. כמו אחרים gRNA concatemers, השיטה שלנו מאפשרת גם את knockout בו זמנית של עד ארבעגנים שונים או הגדילה יעילות CRISPR נוקאאוט בעקבות המיקוד של אחד או שני גנים עם gRNAs מרובים ( איור 1 ).

בפרוטוקול זה, אנו מתארים בפירוט כל צעד בדור של CRISPR-concatemer וקטורים, מעיצוב gRNA לתגובה שער הזהב לאישור שיבוט מוצלח. אנו מספקים גם פרוטוקול יעיל מאוד transfection של CRISPR- concatemers לתוך אורגנואידים מעיים קטנים העכבר על ידי electroporation וגורמים הבאים גורם הגדילה נסיגה.

Protocol

1. gRNA עיצוב עבור CRISPR-concatemer וקטור

הערה: מטרת סעיף זה היא להסביר כיצד לבחור את אסטרטגיית המיקוד הטובה ביותר וכיצד לעצב gRNAs המכילים overhangs ספציפיים עבור וקטור concatmer וקטור.

  1. עיצוב gRNAs נגד הגנים של עניין באמצעות CRISPR gRNA כלי עיצוב של בחירה. ראה טבלה של חומרים לדוגמה.
    הערה: כאשר מיקוד זוג גנים paralogous, למרות שניתן לעצב gRNA אחד לגן, רצוי לעצב שני gRNAs לכל גן כדי להגדיל את הסיכוי להשגת נוק אאוט כפול ( איור 1 ).
  2. ודא gRNAs לא מכילים את האתר BBS אני מזהה באמצעות כלי מיפוי הגבלה (ראה טבלה של חומרים לדוגמה).
  3. הוסף ספציפיות CRISPR-concatemer וקטור overhangs לכל oligo, כפי שמוצג בטבלה 1 .
"Fo: keep-together.within-page =" 1 "עבור: שמירה עם הבא.עם דף =" תמיד "> קסטה 1 קלטת 2 קלטת 3 קלטת 4 רצף (5'-3 ') CACCGG [gRNA1] GT ACCGG [gRNA2] G CCGG [gRNA3] ACACCGG [gRNA4] GTT רצף (5'-3 ') TAAAAC [RC-gRNA1] CC AAAAC [RC-gRNA2] C AAAC [RC-gRNA3] CTAAAAC [RC-gRNA4] CCG

טבלה 1: Overhangs עבור כל קלטת של CRISPR-concatemer וקטור.

2. שיבוט של gRNAs לתוך CRISPR-concatemer וקטור

  1. זרחון וחישול של אוליגוס
    הערה: שלב זה ממחיש כיצד tO anneal העליון והתחתון strands עבור כל oligo gRNA וכיצד phosphorylate הקצוות שלהם בתגובה אחת.
    1. הכינו את תערובת התגובה עבור oligos phosphorylating ו חישול גדילי העליון והתחתון על הקרח, לפי ההוראות להלן.
      הערה: כל oligos יכול להיות משולב לתוך תגובה אחת; למשל, במקרה של וקטור 4 gRNA-concatemer, בריכה יחד 8 oligos.
    2. עבור 3 concatemers, השתמש 3.0 μL gRNA גדיל העליון (1.0 μL מ gRNA כל, 10 מיקרומטר, 1 μL / gRNA), 3.0 μL gRNA התחתונה גדיל (1.0 μL מ gRNA כל, 10 מיקרומטר, 1 μL / gRNA), 2.0 μL T4 DNA ligase חיץ (10x), 1.0 μL T4 PNK, ולהוסיף H 2 O עד נפח כולל של 20.0 μL.
    3. מערבבים היטב על ידי pipetting ולהפעיל את זה thermocycler באמצעות ההגדרות הבאות: 37 מעלות צלזיוס למשך 30 דקות, 95 מעלות צלזיוס במשך 5 דקות, כבש עד 25 מעלות צלזיוס ב 0.3 מעלות צלזיוס / דקות, להחזיק ב 4 מעלות צלזיוס.
  2. BBS אני דשדוש התגובה
    הערה: בסעיף זה, מראש annealed oligos gRNA משולבים לתוך המיקום המתאים של וקטור concatemer בשלב אחד על ידי לסירוגין מחזורים של עיכול קשירת.
    1. לדלל את תערובת התגובה 1: 100 ב DNase / RNase חינם מים כדי ליצור 3 ו 4 gRNA-concatemer וקטורים.
      הערה: כאשר שיבוט 2 gRNA- concatemers שלב זה אינו נחוץ.
    2. להרכיב את BBS אני דשדוש התגובה על הקרח, לפי ההוראות שלהלן. כלול שליטה שלילית המכילה רק את הווקטור.
    3. השתמש 100 ng CRISPR-concatemer וקטור, 10.0 תערובת אוליגו μL, 1.0 μL BSA המכיל חיץ אנזים חיץ (10x), 1.0 μL DTT (10 מ"מ), 1.0 μL ATP (10 מ"מ), 1.0 μL BBS אני, 1.0 μL T7 ליגז , ו H 2 O עד נפח כולל של 20.0 μL.
    4. מערבבים היטב על ידי pipetting ולהפעיל את זה thermocycler באמצעות ההגדרות הבאות: לרוץ 50 מחזורים שיבוט 3 ו 4 gRNA- concatemers ו להחזיק ב 37 מעלות צלזיוס למשך 15 דקות, ואז 4 מעלות צלזיוס לנצח.
  3. טיפול Exonuclease
    הערה: צעד זה מומלץ ביותר שכן הוא מגביר את היעילות של שיבוט על ידי הסרת כל עקבות של DNA לינארי.
    1. התייחס BBS אני דשדוש תגובה עם exonuclease דנ"א (ראה טבלה של חומרים ) כדלקמן.
    2. קח 11.0 μL קשירת תערובת מן השלב הקודם (2.2.3), להוסיף 1.5 μL exonuclease חיץ (10x), 1.5 μL ATP (10 מ"מ), 1.0 exonuclease DNA μL, ולהביא נפח כולל μL 15.0 עם מים. לדגור על 37 מעלות צלזיוס למשך 30 דקות ואחריו 70 מעלות צלזיוס למשך 30 דקות.
      הערה: שלב זה מסיר כל DNA לינארית שיורית בתערובת ולכן מגביר את יעילות שיבוט.
    3. השתמש 2 μL של תערובת התגובה עבור טרנספורמציה לתוך compe כימיתאוהל E. חיידקים קולי על ידי הלם חום 12 .
      הערה: לחלופין, התגובה יכולה להיות מאוחסנת עד שבוע אחד ב -20 מעלות צלזיוס.
  4. עיכול הגבלה
    הערה: מטרת שלב זה היא להעריך על ידי הגבלה עיכול ההצלחה של הליך שיבוט.
    1. כדי לאשר את נוכחותם של מוסיף gRNA בקוטר CRISPR-concatemer, לבחור 4 - 8 מושבות חיידקים עם לולאה inoculating, לגדל כל שיבוט 4 מ"ל של LB בינוני לילה ב 37 מעלות צלזיוס שייקר מסלולית. חלץ DNA באמצעות ערכת miniprep פלסמיד בהתאם להוראות היצרן (ראה טבלה של חומרים ).
    2. Digest ~ 200 ng של DNA עם 10 U EcoR אני + 5 U Bgl II בתגובת 10 μL על ידי דוגרים אותו על 37 מעלות צלזיוס במשך 3 שעות בחממה חיידקים. כלול תערובת תגובה נפרדת עם וקטור המקורי המקביל כבקרה חיובית עבור השוואה גודל.
      הערה: ThiS יאשר אם כל concatemers נוכחים, שכן אלה שני אנזימים הגבלה יבלו concatemers שלם. אלה הם גדלים הצפוי עבור כל concatemer: 2 gRNA-concatemer (800 bp), 3 gRNA-concatemer (1.2 kbp), ו 4 gRNA- concatemer (1.6 kbp).
    3. הפעל תגובות העיכול על ג'ל agarose 1% ב 90 V במשך כ 20 דקות.
    4. דמיינו את הג'ל באמצעות transilluminator UV. זיהוי שיבוטים עם גודל הכנס הנכון על ידי הבטחת דפוס הלהקה שלהם תואמת את אחד של וקטור המקורי וכי כל שבר יש את הגודל הצפוי באמצעות סולם DNA.
    5. לעכל את שיבוטים שנבחרו עם 5 U BBS אני ב 37 מעלות צלזיוס במשך 3 שעות בחממה חיידקים. כלול תערובת תגובה נפרדת עם וקטור המקורי המקביל כבקרה.
      הערה: צעד זה עיכול נוסף הוא לאשר gRNAs כבר משובטים לתוך המיקום הנכון וכתוצאה מכך כל אתרי BBS אני מזהה אבדו.
    6. הפעל את תגובות העיכול ב1% agarose ג'ל ב 90 V במשך כ 20 דקות. שקול נכון רק את הווקטורים שאינם נחתכים על ידי BBS אני כפי שהם מכילים רק gRNAs.
  5. רצף וקטור
    הערה: מטרת שלב זה היא לאשר את הנוכחות של רצפי gRNA באותם וקטורים שזוהו נכונה על ידי ניתוח עיכול הגבלה.
    1. אישור וקטורים concatmer חיובי על ידי סנגר רצף 13 באמצעות פריימרים הבאים:
      העברה קדימה: TCAAGCCCTTTGTACACCCTAAG (לבדיקת קלטת gRNA הראשונה)
      Linker1_Forward: GACTACAAGGACGACGATGACAA (לבדיקת קלטת gRNA השני)
      Linker2_Reverse: GGCGTAGTCGGGCACGTCGTAGGGGT (לבדיקת קלטת gRNA השנייה)
      Linker2_Forward: ACCCCTACGACGTGCCCGACTACGCC (לבדיקת קלטת gRNA השלישי)
      Linker3_Reverse: TCCTCCTCTGAGATCAGCTTCTGCAT (לבדיקת קלטת gRNA השלישית)
      הפוך: AGGTGGCGCGAAGGGGCCACCAAAG (לבדיקת gRNA האחרוןקַלֶטֶת)
    2. בדוק את נוכחותם של כל gRNA על ידי חיפוש sequences שלהם ברצף קורא.

3. transfection של אורגניזמים במעי באמצעות electroporation

הערה: שים לב כי הליך זה מבוסס על פרוטוקול שפורסם על ידי Fujii et al . בשנת 2015, עם הסתגלות לתרבויות אורגנואדיות קטנות של עכברים קטנים 14 .

  1. טרום electroporation
    הערה: סעיף זה מתאר כיצד להכין את אורגנואידים מעיים העכבר לפני electroporation על ידי הסרת כל אנטיביוטיקה מדיה מותנה מן המדיום התרבות שלהם. זה ימנע השפעות רעילות אפשריות במהלך electroporation.
    1. ביום 0 של הליך transfection, לפצל אורגנומים ביחס 1: 2.
      הערה: תרבויות אורגנואידים במעיים ניתן להשיג על ידי ביצוע בידוד crypt לפי פרוטוקולים שנקבעו בעבר 15 . בבקשה התייחס ל
    2. כאשר פיצול אורגנואידים electroporation, זרע מינימום של 6 בארות של צלחת 48-היטב לכל transfection.
    3. זרע את האורגנונים 20 טיפות מטריקס μL ו לגדל אותם WENR + בינוני בינוני (Wnt + EGF + Noggin + R-spondin + Nicotinamide) ב 37 ° C, 5% CO 2 בחממה humidified (כפי שתואר לעיל 15 ) .
  2. ביום 2, לשנות את המדיום על ידי החלפת WENR + ניק עם 250 μL של EN (EGF + Noggin) + CHIR99021 (מעכבי גליקוגן סינתזה Kinase-3) + Y-27632 (מעכב ROCK), ללא אנטיביוטיקה (ראה טבלה 2 ).
    הערה: בכל השלבים, כמות המדיום הוסיף היטב כל צלחת 48-היטב הוא 250 μL.
  3. ביום 3, שנה את המדיום האורגנואיד ל- EN + CHIR99021 + Y-27632 + 1.25% v / v Dimethyl sulfoxide (DMSO), ללא אנטיביוטיקה.
  • הכנת התאים
    הערה:כאן אנו מתארים כיצד לחלק אורגנואידים לתוך אשכולות תא קטן על ידי דיסוציאציה מכנית וכימית. צעדים אלה הם קריטיים להצלחת ההליך.
    1. ביום 4, לשבש את כיפות המטריצה ​​במרתף באמצעות טיפ 1 פיפטה מ"ל להעביר אורגנואידים צינור 1.5 מ"ל. תוכן בריכה של ארבע בארות של צלחת 48 גם לתוך צינור.
    2. מכני לשבור אורגנואידים לשברים קטנים על ידי pipetting למעלה ולמטה עם פיפטה P200 כ 200 פעמים. צנטריפוגה בטמפרטורת החדר, 5 דקות ב 600 x גרם.
    3. הסר את המדיום resuspend גלולה ב 1 מ"ל של תא התרבות כיתה רקומבינציה רקומביננטי (ראה טבלה של חומרים). לדגור על 37 מעלות צלזיוס למשך מקסימום של 5 דקות ולאחר מכן לבדוק ירידה 50 μL של מדגם תחת מיקרוסקופ אור הפוך עם מטרה 4x.
      הערה: אשכולות של 10 - 15 תאים רצויים, כמו זה מגביר את הישרדות התא לאחר electroporation.
    4. מעבירים את ההשעיה התא לצינור נמוך מחייב 15 מ"ל לעצור אתדיסוציאציה על ידי הוספת 9 מ"ל של המדיום הבסיסי ללא אנטיביוטיקה (ראה טבלה 2 ). צנטריפוגה בטמפרטורת החדר, 5 דקות 600 xg, ואז להשליך supernatant ו resuspend גלולה ב 1 מ"ל של המדיום בסרום מופחת (ראה טבלה של חומרים ).
    5. ספירת מספר תאים עם תא של Bürker ולהשתמש מינימום של 1 x 10 5 תאים לכל תגובה electroporation. הוסף 9 מ"ל בינוני בסרום מופחת לצינור 15 מ"ל ו צנטריפוגה בטמפרטורת החדר, 3 דקות ב 400 x גרם.
  • Electroporation
    הערה: הסעיפים הבאים מספקים הוראות כיצד לבצע electroporation ולהפוך התאוששות לאחר מכן.
    1. הסר את כל supernatant ו resuspend גלולה בפתרון electroporation (ראה טבלה של חומרים ). הוסף סכום כולל של 10 מיקרוגרם DNA ההשעיה תא ולהוסיף פתרון electroporation לנפח הסופי של μL 100 ולשמור על תא DNתערובת על קרח. השתמש וקריסר- concatamer וקטורים בשילוב עם ביטוי Cas9 פלסמיד ( למשל Addgene # 41815) ביחס 1: 1.
      הערה: נפח כולל של ה- DNA הוסיף צריך להיות פחות או שווה ל 10% מכלל נפח התגובה.
    2. כלול תערובת transfection נפרד המכיל GFP פלסמיד להעריך יעילות transfection ( למשל pCMV-GFP, Addgene # 11153, או כל הגנרית GFP- להביע פלסמיד).
    3. מוסיפים את תערובת ה- DNA תא לקובט electroporation ומניחים אותו בחדר electroporator. למדוד את עכבה על ידי לחיצה על הכפתור המתאים על electroporator ולוודא כי הוא 0.030-0.055 Ω. בצע electroporation בהתאם להגדרות שמוצג בטבלה 3 .
      הערה: אם ערך העכבה נמצא מחוץ לטווח המותר, כוונן את עוצמת הפתרון בקובט.
    4. הוסף 400 μL של חיץ electroporation + Y-27632 כדי קובט ולאחר מכן להעביר את כל צינור 1.5 מ"ל. אינקובהTe בטמפרטורת החדר למשך 30 דקות כדי לאפשר לתאים להתאושש ולאחר מכן ספין אותם בטמפרטורת החדר למשך 3 דקות ב 400 x גרם.
    5. הסר את supernatant ו resuspend גלולה 20 μL / היטב של המטריצה ​​במרתף. זרע כ 1 x 10 4 עד 1 x 10 5 תאים לכל טוב בצלחת 48 גם להוסיף EN + CHIR99021 + Y-27632 + 1.25% V / V DMSO בינוני. לדגור על 37 מעלות צלזיוס.
    6. ביום 5, לשנות את המדיום כדי EN + CHIR99021 + Y-27632, ולבדוק יעילות transfection ידי התבוננות ביטוי GFP ( איור 2 ). שמור אורגנואידים על 37 מעלות צלזיוס ו לרענן EN + CHIR99021 + Y-27632 בינוני לאחר יומיים.
    7. ביום 9, לשנות את המדיום כדי WENR + ניק + Y-27632 ו דגירה על 37 מעלות צלזיוס.
      הערה: ניתן להסיר את Y-27632 לאחר 7-10 ימים (ביום 16-19).
  • דופק משעמם העברת הדופק
    מתח 175V 20V
    אורך הדופק 5 msec 50msec
    מרווח הדופק 50msec 50msec
    מספר הדופק 2 5
    קצב דעיכה 10% 40%
    קוטביות + Map//

    טבלה 3: הגדרות electroporation.

    4. נסיגה גורם גורמי

    הערה: כאן מודגם כיצד לבצע ניסוי נסיגה גורם הגדילה כאשר דופק את הרגולטורים השליליים של מסלול Wnt באורגנואידים במעיים.

    1. 10-14 ימים לאחר מכןR electroporation, לפצל את אורגנומים ביחס 1: 3 בצלחת 48 גם בעקבות הצעדים הנ"ל (3.2.1 - 3.2.2).
    2. Resuspend גלולה אורגני ב 20 μL של מטריצת הממברנה במרתף ולתת לו לחזק ב 37 מעלות צלזיוס למשך 10 דקות. ואז, כיסוי 250 μL של גורם מקופח צמיחה גורם ( למשל EN) כדי לבדוק אם נוקאאוט של הגנים היעד הושגה 5 .
    3. לפצל את האורגנונים תחת תנאי גורמי צמיחה מקדם עבור מינימום של 2 - 3 מעברים לראות הבדל ההישרדות בין wild wildpe wild wildpe סוג (WT) שליטה אורגנואידים ו אורגנואידים מוטציה 5 , 15 .
      הערה: אורגנואידים Wildtype לא יוכלו לשרוד במדיום מונע צמיחה על פני שני מעברים, בעוד שורות מוטציה צריך להיות מסוגל לגדול.

    Representative Results

    על מנת לאשר את הנוכחות של המספר הנכון של מוסיף gRNA ב וקטור concatemer, עיכול הגבלה מבוצעת עם אנזימים ( EcoR אני + Bgl II) מאגף את כל קלטות ביטוי gRNA (כל גודל קלטת הוא ~ 400 BP, איור 1 ). לדוגמה, בעת יצירת וקטור 4 gRNA- concatemer, הגודל הצפוי של הלהקה התחתונה של agarose ג'ל הוא כ 1.6 Kbp; כל הלהקה נמוך מזה מצביע כי לא כל הקלטות gRNA 4 מוכנסים לתוך וקטור ( איור 2 א ). בנוסף, מומלץ תמיד לבדוק כי כל אתרי BBS אני מזהה הם איבדו את האנזים לא לחתוך את וקטור ( איור 2 ב ).

    לאחר המבנים אושרו, הם יכולים להימסר אורגנואידים מעיים העכבר על ידי electroporation להשיג אופטימהL רמות של יעילות transfection (עד 70%), כפי שמוצג על ידי שליטה GFP ( איור 3 ).

    לבסוף, כדי לבדוק באופן פונקציונלי את היעילות של אסטרטגיה זו, אורגנואידים מעיים transfected עם Cas9 ו וקטורים concatemer נגד Axin1 / 2 ו Rnf43 / Znrf3 היו מתורבת EN (נסיגה R-spondin) ו EN + IWP2 (R-spondin ו Wnt נסיגה, IWP2 : מעכב Porcupine, 2.5 מיקרומטר) מדיה עבור מינימום של 3 מעברים ( איור 4 ). בעוד שאורגנואידים מסוג WT שלא עברו טרנסקסידציה מתו בשני התנאים, אקסנונים 1/2 של נוקאאוט שרדו הן בשל ההפעלה במורד הזרם של מסלול ה- Wnt; בנוסף, Rnf43 / Znrf3 אורגנואידים מוטציה לשרוד בהיעדר R-spondin אבל לא יכול לשרוד בנוכחות IWP2, אשר גורם דלדול של Wnt המפעיל את המסלול. יחד, תצפיות אלה מראות כי נוקאאוט של זוגות אלה של paralogues אפשרי על ידי יצירת tהוא ציפה פנוטיפ אורגנואידים. פרטים על תוצאות אלו פורסמו ב ביולוגיה התפתחותית 5 .

    איור 1
    איור 1: ייצוג סכמטי של ה- CRISPR-concatemer עם 4 קלטות. Scheme של 4 gRNA-concatemer וקטור עם כל קלטת 400 BP המכיל מקדם U6, שני הפוך BBS אני אתרים חוזרים (גם מצויין BB) ו gRNA פיגום בסדר הזה. במהלך התגובה דשדוש, BBS אני אתרים מוחלפים על ידי שברי gRNA עם overhangs התאמה וכתוצאה מכך איבד. אתרי מחייב של פריימרים רצף לבדיקת ההכנסה הנכונה של oligos gRNA מוצגים על ידי החצים הכחולים. Fwd = תחל קדמי, Rev = תחל הפוך, קישור 1/2/3 = אזורי מקשר 1/2/3. אנא cללקק כאן כדי להציג גרסה גדולה יותר של דמות זו.

    איור 2
    איור 2: דפוסי עיכול נציג של וקטורים Concatemer. ( א ) עיכול כפול של 3 ו 4 gRNA-concatemer וקטורים עם EcoR אני ו Bgl II. דפוס העיכול הנכון מסומן על ידי טריק ירוק, ואילו וקטורים עם רק 1 או 2 gRNA הוספות מסומנים על ידי צלב אדום. נתיב 1 מראה עיכול של וקטור 4 gRNA-concatemer הורית המשמשים שליטה חיובית (מסומן על ידי "+"); באופן דומה, נתיב 5 מראה עיכול של 3 gRNA-concatemer וקטור ההורים, מסומן על ידי "+". ( ב ) עיכול עם BBS אני, מראה את הגודל הנכון של וקטורים concatmer מעוכלים (מסומן על ידי קרציות ירוק). עיכול של GRNA המכיל וקטור concatmer שאיבדה BBS אני משמש אתרים כבקרה חיובית D מסומן על ידי "+". אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

    איור 3
    איור 3: תמונה נציג של אורגנואידים מעיים electroporated בהצלחה. Transfection של GFP פלסמיד הוא אינסטרומנטלי להעריך יעילות transfection. כ 24 שעות לאחר electroporation, אורגנואידים המכילים מספר קטן של תאים כבר גלויים, ואם הליך electroporation היה מוצלח, עד 70% מהם מציג הקרינה הירוקה. BF = שדה בהיר, GFP = חלבון פלואורסצנטי ירוק. סולם בר = 2000 מיקרומטר. אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

    Ether.within-page = "1"> איור 4
    איור 4: תמונות נציג של אורגניזמים המוטציה המוטנטית. נוקאוט של הרגולטורים השליליים של המסלול Wnt Axin1 ו- Rnf43, יחד עם paralogues שלהם, הופך את האיברים המעיים עמיד למניעת גורמי גדילה. בפרט, Axin1 / 2 נוגדי אקונואידים (Axin1 / 2 KO) יכולים לצמוח בהיעדר הן R-spondin (EN: EGF + Noggin) ו- Wnt (EN + IWP2: EN + מעכב קיבה), בעוד ש- Rnf43 / Znrf3 אורגנואידים מוטנטיים (R & Z KO) יכול לשרוד רק בהעדר R-spondin (EN). לעומת זאת, WT אורגנואידים יכול לשרוד רק במצב התרבות שליטה, WENR + ניק (Wnt + EGF + Noggin + R-spondin + Nicotinamide). סולם ברים = 1000 מיקרומטר. אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

    עמוד = "1" עבור: שמור עם הבא. עם דף = "תמיד">
    המדיום הבסיסי הערות
    חנות ב 4 מעלות צלזיוס למשך 4 שבועות
    בינוני תרבות תאים 500 מ"ל ראה טבלת חומרים
    L-Glutamine 100x 5 מ"ל
    סוכן אגירה 1 M 5 מ"ל ראה טבלת חומרים
    פניצילין סטרפטומיצין 100x 5 מ"ל
    WENR + ניק (Wnt + EGF + Noggin + R-spondin + Nicotinamide)
    חנות ב 4 מעלות צלזיוס למשך 2 שבועות
    המדיום הבסיסי עד 50 מ"ל
    תוספת נוירונים ללא תוסף (50x) 1 מ"ל ראה טבלה של אמאטריאל
    תא נוירונים ללא תוסף חינם (100x) 500 μL ראה טבלת חומרים
    N-Acetylcysteine ​​(500 מ"מ) 125 μL
    עכבר EGF (100 מיקרוגרם / מ"ל) 25 μL
    עכבר Noggin (100 מיקרוגרם / מ"ל) 50 μL
    R-Spondin בינוני מותנה 5 מ"ל
    Wnt3a בינוני מותנה 25 מ"ל
    ניקוטינאמיד (1 מ ') 250 μL
    EN + CHIR + Y-27632 (EGF + Noggin + CHIR + Y-27632)
    חנות ב 4 מעלות צלזיוס למשך 2 שבועות
    בזל בינוני w / o פניצילין סטרפטומיצין עד 20 מ"ל
    תוספת נוירונים ללא תוסף (50x) 400 μL ראה טבלת חומרים
    תא נוירונים ללא תוסף חינם (100x) 200 μL ראה טבלת חומרים
    N-Acetylcysteine ​​(500 מ"מ) 50 μL
    עכבר EGF (100 מיקרוגרם / מ"ל) 10 μL
    עכבר Noggin (100 מיקרוגרם / מ"ל) 20 μL
    Y-27632 (10 מיקרומטר) 20 μL
    CHIR99021 (8 מיקרומטר) 10 μL
    EN (EGF + Noggin)
    חנות ב 4 מעלות צלזיוס למשך 4 שבועות
    המדיום הבסיסי עד 50 מ"ל
    תוספת נוירונים ללא תוסף (50x) ראה טבלת חומרים
    תא נוירונים ללא תוסף חינם (100x) 500 μL ראה טבלת חומרים
    N-Acetylcysteine ​​(500 מ"מ) 125 μL
    עכבר EGF (100 מיקרוגרם / מ"ל) 25 μL
    עכבר Noggin (100 מיקרוגרם / מ"ל) 50 μL

    טבלה 2: הרכב מדיה אורגנואידית.

    Discussion

    בפרוטוקול זה, אנו מפרטים את כל השלבים הדרושים כדי ליצור CRISPR- concatemers ולהחיל CRISPR- concatemers ב אורגנואידים מעיים העכבר על מנת לדפוק בו זמנית מספר גנים. כפי שצוין לעיל, אסטרטגיה זו יש מספר יתרונות, כגון מהירות, יעילות גבוהה ויעילות-עלות.

    על מנת לבצע בהצלחה את ההליך כולו, יש כמה היבטים קריטיים לשקול. ראשית, חיוני כי כל oligos gRNA הם annealed כראוי phosphorylated, כפי שהם מייצגים את החומר המוצא עבור BBS אני שיבוט התגובה כי כשלעצמה הוא מאוד יעיל. שנית, כאשר electroporating אורגנואידים, התאים יותר בשימוש בכל תנאי, גבוה יותר את יעילות transfection מקסימלית. בנוסף, חשוב גם כי לאחר דיסוציאציה התא, אשכולות תאים קטנים להשתלט על תאים בודדים.

    עם זאת, ניתן להיתקל prob טכניתLems כאשר מנסים או שיבוט או transfection בפעם הראשונה; במקרה של בעיות במהלך שיבוט gRNA, מומלץ לבדוק את רצף אוליגו gRNA, ואם נכון, בחר מושבות חיידקים נוספים להגבלת עיכול הגבלה. אם יעילות transfection ואת הכדאיות התא נמוכים שלאחר electroporation, אז זה רצוי לחזור על פרוטוקול באמצעות תאים יותר לכל תנאי והפחתת הזמן של ניתוק התא ל 3 דקות.

    למרות הדור של CRISPR- concatemers הוא זול יחסית וקל יחסית, ביצוע בקנה מידה גדול בקנה מידה גנטי מסכי אורגנואידים היא לא, כמו קנה המידה הוא מוגבל על ידי העלויות הקשורות לתרבות אורגנומית ועל ידי עבודה אינטנסיבית אופי. ראוי להזכיר במקרה זה כי השיטה CRISPR-concatemer הוא גם תואם עם שורות תאים, כגון HEK293 ותאי גזע עובריים העכבר.

    ללא קשר למערכת הסלולרית, חסרון פוטנציאלי נוסף של זהTrategy ניתן נתקל כאשר מכוון לעבר knockout בו זמנית של שלושה או ארבעה גנים שונים. לדוגמה, כל gRNA תהיה יעילות מיקוד שונה ושינויים להכות את כל הגנים בו זמנית יכול להיות נמוך יחסית; מסיבה זו, רצוי להעסיק את מערכת concatemer לכוון יותר gRNA אחד נגד אותו הגן.

    אסטרטגיות חלופיות באופן דומה מבוסס על שער הזהב דשדוש הוצעו במשך השנים לייצר וקטורים gRNA multiplex 7 , 8 . עם זאת, בשיטה שלנו ניתן ישירות להרכיב gRNAs מרובים לתוך וקטור יחיד retroviral בסיבוב אחד של שיבוט, מה שהופך אותו מתאים ליצירת ספריות gRNA למקד paralogues.

    ה- CRISPR-concatemer שלנו בנוי על עמוד השדרה הקטורית RTVIRAL MSCV. לפיכך, gRNA concatmer המכיל רטרווירוס ניתן להשתמש כדי ליצור שורות תאים יציב כי overexpGRNAs ress. בשילוב עם מערכת CAS9- inducible, אפשר לבצע נוקאאוט paralog inducible באמצעות המערכת שלנו.

    לסיכום, כאן אנו מתארים כיצד לשכפל עד ארבעה gRNAs שונים לתוך אותו וקטור בשלב אחד וכיצד ליישם אסטרטגיה זו לתרבות organoid עם יעילות transfection גבוהה. יתר על כן, אנו מספקים הצעות שימושיות כדי למקסם את סיכויי ההצלחה לאורך כל התהליך.

    Disclosures

    למחברים אין מה לגלות. המחברים לא הכריזו על ניגוד עניינים.

    Acknowledgments

    אנו מודים לכריסטופר הינדלי על הקריאה הביקורתית של כתב היד. AM נתמך על ידי Wntsapp (מארי Curie ITN), AA-R. נתמך על ידי המועצה למחקר רפואי (MRC), ו BK.K. ו RM נתמכים על ידי סר הנרי דייל אחוות מן Wellcome Trust ואת החברה המלכותית [101241 / Z / 13 / Z] ולקבל תמיכה באמצעות מענק הליבה מן Wellcome אמון MRC כדי Wellcome Trust - MRC קיימברידג 'תא גזע המכון .

    Materials

    Name Company Catalog Number Comments
    Optimized CRISPR Design Tool Feng Zhang group CRISPR gRNA design tool; http://crispr.mit.edu/
    Webcutter 2.0 restriction mapping tool; http://rna.lundberg.gu.se/cutter2/
    T4 PNK (Polynucleotide Kinase) New England Biolabs M0201L
    T4 DNA ligase buffer New England Biolabs M0202S
    T7 DNA Ligase New England Biolabs M0318L
    DTT (dithiothreitol) Promega P1171
    ATP (adenosine triphosphate) New England Biolabs P0756S
    FastDigest BbsI (BpiI) Thermo Fisher FD1014
    Tango buffer (BSA-containing restriction enzyme buffer) Thermo Fisher BY5
    BglII New England Biolabs R0144
    EcoRI New England Biolabs R0101
    Plasmid-safe exonuclease Cambio E3101K
    Thermal cycler Applied biosystems 4359659
    10G competent E. coli bacteria Cambridge Bioscience 60108-1
    Plasmid mini kit Qiagen 12125
    Table top microcentrifuge Eppendorf UY-02580-01
    Inoculating loops Microspec PLS5
    Bacteria incubator Sanyo MIR-262
    Luria-Bertani broth (LB) Sigma-Aldrich L3522
    Agarose Sigma-Aldrich A4718
    Agarose gel electrophoresis apparatus Bioneer A-7020
    Advanced DMEM/F12(cell culture medium) Invitrogen 12634-034
    Glutamax (L-Glutamine) 100x Invitrogen 35050-068
    HEPES 1 M (buffering agent) Invitrogen 15630-056
    Penicillin-streptomycin 100x Invitrogen 15140-122
    B27 supplement (Neuronal cell serum-free supplement) 50x Invitrogen 17504-044
    N2 supplement (Neuronal cell serum-free supplement) 100x Invitrogen 17502-048
    n-Acetylcysteine 500 mM Sigma-Aldrich A9165-5G
    Mouse EGF 500 µg/mL Invitrogen Biosource PMG8043
    Mouse Noggin 100 µg/mL Peprotech 250-38
    Nicotinamide 1 M Sigma N0636
    R-Spondin conditioned medium n.a. n.a. Produced in house from HEK293 cells, for details see Sato and Clevers 2013
    Wnt conditioned medium n.a. n.a. Produced in house from HEK293 cells, for details see Sato and Clevers 2013
    Y-27632 10 µM Sigma-Aldrich Y0503-1MG
    Standard BD Matrigel matrix BD Biosciences 356231
    48-well Plate Greiner Bio One 677980
    CHIR99021 Sigma-Aldrich A3734-1MG
    IWP-2 Cell Guidance Systems SM39-10
    TrypLE (recombinant protease) Invitrogen 12605-010
    Opti-MEM (reduced serum medium ) Life technologies 51985-034
    Electroporation Cuvettes 2 mm gap NepaGene EC-002S
    Low binding 15 mL tubes Sigma-Aldrich CLS430791
    Bürker’s chamber Sigma-Aldrich BR719520-1EA
    NEPA21 Super Electroporator NepaGene contact supplier
    Protein LoBind tubes low binding Thermo Fisher 10708704
    BTXpress electroporation buffer Harvard Apparatus 45-0805
    DMSO (Dimethyl sulfoxide) AppliChem A3672

    DOWNLOAD MATERIALS LIST

    References

    1. Mali, P., et al. RNA-Guided Human Genome Engineering via Cas9. Science. 339, (6121), 823-826 (2013).
    2. Koike-Yusa, H., Li, Y., Tan, E. -P., Velasco-Herrera, M. D. C., Yusa, K. Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library. Nat Biotech. 32, (3), 267-273 (2014).
    3. Bassett, A. R., Kong, L., Liu, J. L. A Genome-Wide CRISPR Library for High-Throughput Genetic Screening in Drosophila Cells. J Genet Genomics. 42, (6), 301-309 (2015).
    4. Diss, G., Ascencio, D., DeLuna, A., Landry, C. R. Molecular mechanisms of paralogous compensation and the robustness of cellular networks. J Exp Zool B Mol Dev Evol. 322, (7), 488-499 (2014).
    5. Andersson-Rolf, A., Merenda, A., Mustata, R. C., Li, T., Dietmann, S., Koo, B. -K. Simultaneous paralogue knockout using a CRISPR-concatemer in mouse small intestinal organoids. Dev Biol. 420, (2), 1-7 (2016).
    6. Ran, F. A., Hsu, P. P. D., Wright, J., Agarwala, V., Scott, D., Zhang, F. Genome engineering using the CRISPR-Cas9 system. Nat Protoc. 8, (11), 2281-2308 (2013).
    7. Engler, C., Gruetzner, R., Kandzia, R., Marillonnet, S. Golden gate shuffling: A one-pot DNA shuffling method based on type IIs restriction enzymes. PLoS ONE. 4, (5), (2009).
    8. Sakuma, T., Nishikawa, A., Kume, S., Chayama, K., Yamamoto, T. Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 4, (5), 5400 (2014).
    9. Kabadi, A. M., Ousterout, D. G., Hilton, I. B., Gersbach, C. A. Multiplex CRISPR/Cas9-based genome engineering from a single lentiviral vector. Nucleic Acids Res. 42, (19), 1-11 (2014).
    10. Yin, L., et al. Multiplex Conditional Mutagenesis Using Transgenic Expression of Cas9 and sgRNAs. Genetics. 200, (2), 431-441 (2015).
    11. Cress, B. F., Toparlak, O. D., et al. CRISPathBrick: Modular Combinatorial Assembly of Type II-A CRISPR Arrays for dCas9-Mediated Multiplex Transcriptional Repression in E. coli. ACS Synth Biol. 4, (9), 987-1000 (2015).
    12. Froger, A., Hall, J. E. Transformation of plasmid DNA into E. coli using the heat shock method. J Vis Exp. (6), e253 (2007).
    13. Zimmermann, J., Voss, H., Schwager, C., Stegemann, J., Ansorge, W. Automated Sanger dideoxy sequencing reaction protocol. FEBS Letters. 233, (2), 432-436 (1988).
    14. Fujii, M., Matano, M., Nanki, K., Sato, T. Efficient genetic engineering of human intestinal organoids using electroporation. Nat. Protoc. 10, (10), 1474-1485 (2015).
    15. Andersson-Rolf, A., Fink, J., Mustata, R. C., Koo, B. -K. A video protocol of retroviral infection in primary intestinal organoid culture. J Vis Exp. (90), e51765 (2014).

    Erratum

    Formal Correction: Erratum: A Protocol for Multiple Gene Knockout in Mouse Small Intestinal Organoids Using a CRISPR-concatemer
    Posted by JoVE Editors on 01/02/2018. Citeable Link.

    An erratum was issued for: A Protocol for Multiple Gene Knockout in Mouse Small Intestinal Organoids Using a CRISPR-concatemer. There was a typo in step 3.3 of the Protocol.

    Step 3.3 was corrected from:

    Add the cell-DNA mixture to the electroporation cuvette and place it in the electroporator chamber. Measure the impedance by pushing the appropriate button on the electroporator and ensure that it is 0.030-0.055 Ω

    to:

    Add the cell-DNA mixture to the electroporation cuvette and place it in the electroporator chamber. Measure the impedance by pushing the appropriate button on the electroporator and ensure that it is 0.030-0.055 kΩ

    Comments

    0 Comments


      Post a Question / Comment / Request

      You must be signed in to post a comment. Please or create an account.

      Usage Statistics