En protokol til multipel gen-knockout i mus-små tarmorganoider ved anvendelse af en CRISPR-concatemer

Bioengineering
 

ERRATUM NOTICE

Summary

Denne protokol beskriver trinene til kloning af flere enkelt-guide-RNA'er i en RNA-concatemervektor, som er særlig anvendelig til at skabe multi-gen-knockouts ved hjælp af CRISPR / Cas9-teknologi. Frembringelsen af ​​dobbelt knockouts i tarmorganoider er vist som en mulig anvendelse af denne metode.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Merenda, A., Andersson-Rolf, A., Mustata, R. C., Li, T., Kim, H., Koo, B. K. A Protocol for Multiple Gene Knockout in Mouse Small Intestinal Organoids Using a CRISPR-concatemer. J. Vis. Exp. (125), e55916, doi:10.3791/55916 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

CRISPR / Cas9 teknologi har i høj grad forbedret gennemførligheden og hastigheden af ​​tab af funktionsstudier, der er afgørende for forståelsen af ​​genfunktionen. I højere eukaryoter kan paralogøse gener maske en potentiel fænotype ved at kompensere tabet af et gen, hvilket begrænser de informationer, der kan opnås ved genetiske undersøgelser, der baserer sig på enkeltgenstrengninger. Vi har udviklet en roman hurtig kloning metode til guide RNA (gRNA) concatemers for at skabe multi-gen knockouts efter en enkelt transfektion i mus tyndtarmorganoider. Vores strategi gør det muligt for concatemerization af op til fire individuelle gRNA'er i en enkelt vektor ved at udføre en enkelt Golden Gate-shufflingreaktion med annealed gRNA oligos og en foruddesignet retroviral vektor. Dette tillader enten samtidig udfald af op til fire forskellige gener eller øget knockout effektivitet efter målretningen af ​​et gen ved flere gRNA'er. I denne protokol viser vi detaljeretHvordan man effektivt kloner flere gRNA'er i den retrovirale CRISPR-concatemer-vektor og hvordan man opnår høj effektiv elektroporation i tarmorganoider. Som et eksempel viser vi, at samtidig udkobling af to par gener kodende for negative regulatorer af Wnt signalvejen (Axin1 / 2 og Rnf43 / Znrf3) gør intestinale organoider resistente over for tilbagetrækning af vigtige vækstfaktorer.

Introduction

Omvendt genetik tilgang er en meget anvendt metode til at undersøge funktionen af ​​et gen. Specielt tab af funktionsstudier, hvor forstyrrelse af et gen forårsager fænotypiske ændringer, spiller en central rolle i opbygningen af ​​vores forståelse af biologiske processer. CRISPR / Cas9-metoden repræsenterer den seneste udvikling inden for genomteknologi og har revolutioneret den nuværende praksis med genetik i celler og organismer. Cas9 er en RNA-styret endonuclease, som binder til en specifik DNA-sekvens komplementær til gRNA'et og genererer en dobbeltstrengspause (DSB). Denne DSB rekrutterer DNA-reparationsmaskineri, som i mangel af en DNA-skabelon til homolog rekombination vil re-ligere den skårne DNA-streng via fejlpræget, ikke-homolog end-sammenføjning, hvilket således kan resultere i insertioner eller deletioner af nukleotid (er) Forårsager fremskift mutationer 1 .

Den store lethed og alsidigheden af ​​CRISPR / Cas9 apprOach har gjort det til et yderst attraktivt værktøj til genome-scale knockout skærme med det formål at unraveling ukendte genfunktioner 2 , 3 . Ikke desto mindre er single gen-knockout-fremgangsmåder af begrænset anvendelse, hvis der findes flere paraloger med overflødige funktioner. Ablatering af et enkelt gen kan således ikke være nok til at bestemme funktionen af ​​dette gen givet mulig kompensation ved paraloger, der resulterer i ringe eller ingen fænotypisk ændring 4 . Det er derfor vigtigt at udjævne paraloger parallelt ved at levere flere gRNA-vektorer rettet mod de forskellige paralogøse gener for at overvinde indflydelsen af ​​genetisk kompensation.

For at udvide brugen af ​​CRISPR / Cas9 til paraloggengen-knockout har vi for nylig udviklet en hurtig, en-trins kloningsmetode til kloning af op til fire for-annealed-gRNA'er i en enkelt retroviral vektor 5 . Rygraden, der hedder CRISPR-concatemer, er baseretPå et MSCV retroviralt plasmid indeholdende gentagne gRNA ekspressionskassetter. Hver kassette indeholder to inverterede genkendelsessteder af Type IIS-restriktionsenzymet Bbs I, som kan erstattes irreversibelt med en glødet gRNA-oligo med matchende overhæng ved anvendelse af en Golden Gate-shufflingreaktion i et enkeltrør 6 . Denne kloningsmetode består af gentagne cykler af fordøjelse og ligering, der tillader samtidig montering af flere DNA-fragmenter ved at udnytte de forskellige overhængssekvenser frembragt af Bbs I. Entiteten af dette enzym er for eksempel evnen til at udføre asymmetriske snit uden for dets genkendelse sekvens; Derfor kan hver kassette have en anden sekvens med tilpasset overhængsflankerende Bbs I-kerneområde, og på denne måde kan hver gRNA klones i en specifik position og orientering af concatemervektoren.

Som et principprincip viste vi brugen af ​​denne strategi iMus-intestinale organoider ved samtidig at forstyrre to par af paralog-negative regulatorer af Wnt-banen med en runde elektroporation 5 .

I de sidste par år har mange andre grupper udviklet lignende strategier baseret på flere gRNA ekspressionsvektorer konstrueret ved anvendelse af Golden Gate shuffling 7 for at opnå multi-gen knockout i forskellige model systemer, såsom humane cellelinjer 8 , 9 , zebrafisk 10 og Escherichia coli 11 . I deres protokoller klones først gRNA'er i individuelle mellemvektorer og samles derefter sammen i et slutprodukt. I modsætning hertil er den største fordel ved vores CRISPR-concatemer-strategi, at det er enkelt med et enkelt Bbs I-shuffling-kloningstrin. Ligesom andre gRNA concatemers muliggør vores metode enten den samtidige knockout på op til fireForskellige gener eller øget CRISPR knockout effektivitet efter målretningen af ​​et eller to gener med multiple gRNA'er ( Figur 1 ).

I denne protokol beskriver vi i detaljer hvert trin i generationen af ​​CRISPR-concatemervektorer, fra gRNA-design til Golden Gate-reaktionen og til bekræftelse af vellykket kloning. Vi tilvejebringer også en yderst effektiv protokol til transfektion af CRISPR-concatemers i mus-tarmorganoider ved elektroporation og efterfølgende vækstfaktor tilbagetrækningsforsøg.

Protocol

1. gRNA Design for CRISPR-concatemer Vector

Bemærk: Formålet med dette afsnit er at forklare, hvordan man vælger den bedste målretningsstrategi og hvordan man designer gRNA'er indeholdende specifikke overhæng for CRISPR-concatemervektoren.

  1. Design gRNA'er mod genene af interesse ved brug af et CRISPR gRNA designværktøj efter eget valg. Se materialebordet til et eksempel.
    BEMÆRK: Når man målretter mod et par paralogøse gener, selvom det er muligt at designe et gRNA pr. Gen, er det tilrådeligt at designe to gRNA'er pr. Gen for at øge chancerne for at opnå en dobbelt knockout ( figur 1 ).
  2. Sørg for, at gRNA'erne ikke indeholder Bbs I genkendelsesstedet ved hjælp af et restriktionskortlægningsværktøj (se Materialebeskrivelsen til et eksempel).
  3. Tilføj specifikke CRISPR-concatemer-vektoroverhæng til hver oligo, som vist i tabel 1 .
"Fo: keep-together.within-page =" 1 "for: keep-with-next.within-page =" always "> Kassette 1 Kassette 2 Kassette 3 Kassette 4 Sekvens (5'-3 ') CACCGG [gRNA1] GT ACCGG [gRNA2] G CCGG [gRNA3] ACACCGG [gRNA4] GTT Sekvens (5'-3 ') TAAAAC [RC-gRNA1] CC AAAAC [RC-gRNA2] C AAAC [RC-gRNA3] CTAAAAC [RC-gRNA4] CCG

Tabel 1: Overhæng for hver kassette af CRISPR-concatemer Vector.

2. Kloning af gRNA'er i CRISPR-concatemer Vector

  1. Fosforylering og udglødning af oligos
    BEMÆRK: Dette trin illustrerer, hvordan tO anneal top og bundstrenger for hver gRNA oligo og hvordan man phosphorylerer deres ender i en enkelt reaktion.
    1. Forbered reaktionsblandingen til phosphorylerende oligoer og annealing øverste og nederste tråde på is, pr. Instruktionerne nedenfor.
      BEMÆRK: Alle oligoer kan samles i en reaktion; For eksempel i tilfælde af en 4 gRNA-concatemer vektor, sammensamler 8 oligos.
    2. For 3 concatemers anvender 3,0 μL gRNA topstreng (1,0 μL fra hver gRNA; 10 μM, 1 μL / gRNA), 3,0 μL gRNA bundstreng (1,0 μL fra hvert gRNA; 10 μM, 1 μl / gRNA), 2,0 μl T4 DNA-ligasepuffer (10x), 1,0 pi T4 PNK og tilføje H2O op til totalt volumen på 20,0 pi.
    3. Bland godt ved pipettering og kør dette i en termocykler ved hjælp af følgende indstillinger: 37 ° C i 30 minutter, 95 ° C i 5 minutter, rampe ned til 25 ° C ved 0,3 ° C / min, hold ved 4 ° C.
  2. Bbs jeg shuffling reaktion
    BEMÆRK: I dette afsnit inkorporeres de pre-annealed gRNA oligos i den passende position af concatemervektoren i et trin ved alternerende cykler af fordøjelse og ligering.
    1. Fortynd reaktionsblandingen 1: 100 i DNase / RNase-frit vand for at danne 3 og 4 gRNA-concatemervektorer.
      BEMÆRK: Ved kloning af 2 gRNA-concatemers er dette trin ikke nødvendigt.
    2. Saml Bbs I shuffling reaktion på is, pr. Instruktionerne nedenfor. Inkluder en negativ kontrol, der kun indeholder vektoren.
    3. Brug 100 ng CRISPR-concatemer vektor, 10,0 μl oligo-blanding, 1,0 μl BSA-indeholdende restriktionsenzymbuffer (10x), 1,0 μl DTT (10 mM), 1,0 μl ATP (10 mM), 1,0 μl Bbs I, 1,0 μl T7-ligase og H2O op til totalt volumen på 20,0 pi.
    4. Bland godt ved pipettering og kør dette i en termocykler ved hjælp af følgende indstillinger: Kør 50 cykler til kloning af 3 og 4 gRNA-concatemers og hold ved 37 ° C i 15 minutter og derefter 4 ° C for evigt.
  3. Exonucleasebehandling
    BEMÆRK: Dette trin anbefales stærkt, da det øger kloningens effektivitet ved at fjerne spor af lineariseret DNA.
    1. Behandl Bbs I shuffling reaktionen med et DNA exonuclease (se Tabel af Materialer ) som følger.
    2. Tag 11,0 μl ligationsblanding fra det foregående trin (2.2.3), tilsæt 1,5 μL exonucleasebuffer (10x), 1,5 μL ATP (10 mM), 1,0 μl DNA-exonuklease og opsaml totalvolumen til 15,0 μl med vand. Inkuber ved 37 ° C i 30 minutter efterfulgt af 70 ° C i 30 minutter.
      BEMÆRK: Dette trin fjerner ethvert restlinjeret DNA i blandingen og øger dermed kloningseffektiviteten.
    3. Brug 2 μl af reaktionsblandingen til transformation til kemisk kompeTelt E. coli- bakterier ved varmeskok 12 .
      BEMÆRK: Alternativt kan reaktionen opbevares i op til en uge ved -20 ° C.
  4. Restriktion fordøjelse
    BEMÆRK: Formålet med dette trin er at vurdere ved hjælp af restriktionsfordøjelse succesen med kloningsproceduren.
    1. For at bekræfte tilstedeværelsen af ​​gRNA-indsatser i CRISPR-concatemer-vektoren, vælger 4-8 bakteriekolonier med en inokuleringssløjfe, dyrker hver klon i 4 ml LB-medium natten over ved 37 ° C i en orbital-ryster. Ekstraher DNA ved hjælp af et plasmid miniprep kit ifølge producentens anvisninger (se Materialetabellen ).
    2. Digest ~ 200 ng DNA med 10 U EcoR I + 5 U Bgl II i en 10 μl reaktion ved inkubering den ved 37 ° C i 3 timer i en bakterie inkubator. Inkluder en separat reaktionsblanding med den tilsvarende oprindelige vektor som en positiv kontrol for størrelsesligning.
      BEMÆRK: ThiS vil bekræfte, om alle concatemers er til stede, da disse to restriktionsenzymer vil punkere hele concatemers. Disse er de forventede størrelser for hver concatemer: 2 gRNA-concatemer (800 bp), 3 gRNA-concatemer (1,2 kbp) og 4 gRNA-concatemer (1,6 kbp).
    3. Kør fordøjelsesreaktioner på en 1% agarosegel ved 90 V i ca. 20 min.
    4. Visualiser gelen ved hjælp af en UV-transilluminator. Identificer kloner med korrekt indsatstørrelse ved at sikre, at deres båndmønster matcher den oprindelige vektor, og at hvert fragment har den forventede størrelse ved at bruge en DNA-stige.
    5. Fordøj de udvalgte kloner med 5 U Bbs I ved 37 ° C i 3 timer i en bakterieinkubator. Inkluder en separat reaktionsblanding med den tilsvarende oprindelige vektor som en kontrol.
      BEMÆRK: Dette yderligere fordøjelsestrin er at bekræfte, at gRNA'er er blevet klonet i den rigtige position, og derfor er alle Bbs I genkendelsessteder blevet tabt.
    6. Kør fordøjelsesreaktioner påEn 1% agarosegel ved 90 V i ca. 20 minutter. Betragt som korrekte kun de vektorer, der ikke skæres af Bbs I, da de kun indeholder gRNA'er.
  5. Vektor sekventering
    BEMÆRK: Formålet med dette trin er at bekræfte tilstedeværelsen af ​​gRNA-sekvenser i de vektorer, der er identificeret som korrekte ved restriktionsfordøjelsesanalyse.
    1. Bekræft positive concatemervektorer ved Sanger-sekventering 13 ved anvendelse af følgende primere:
      Fremad: TCAAGCCCTTTGTACACCCTAAG (til kontrol af den første gRNA-kassette)
      Linker1_Forward: GACTACAAGGACGACGATGACAA (til kontrol af den anden gRNA-kassette)
      Linker2_Reverse: GGCGTAGTCGGGCACGTCGTAGGGGT (til kontrol af den anden gRNA-kassette)
      Linker2_Forward: ACCCCTACGACGTGCCCGACTACGCC (til kontrol af den tredje gRNA-kassette)
      Linker3_Reverse: TCCTCCTCTGAGATCAGCTTCTGCAT (for at kontrollere den tredje gRNA-kassette)
      Omvendt: AGGTGGCGCGAAGGGGCCACCAAAG (til kontrol af det sidste gRNAkassette)
    2. Kontroller tilstedeværelsen af ​​alle gRNA ved at søge deres sekvenser i sekventeringen læses.

3. Transfektion af tarmorganoider ved elektroporation

BEMÆRK: Bemærk, at denne procedure er baseret på protokollen udgivet af Fujii et al . I 2015, med tilpasning til mus-tarm-organoidkulturer 14 .

  1. Pre-elektroporering
    BEMÆRK: Dette afsnit beskriver hvordan man forbereder museintestinale organoider inden elektroporation ved at fjerne alle antibiotika og konditionerede medier fra deres dyrkningsmedium. Dette vil forhindre mulige toksiske virkninger under elektroporation.
    1. På dag 0 i transfektionsproceduren fordeles organoider i et forhold på 1: 2.
      BEMÆRK: Intestinale organoidkulturer kan opnås ved at udføre kryptisolering ifølge tidligere etablerede protokoller 15 . Vær sød at henvise til
    2. Ved opdeling af organoider til elektroporering skal frøene mindst 6 brønde af en 48 brønds plade pr. Transfektion.
    3. Pode organoider i 20 pi-basement matrix dråber og dyrke dem i WENR + Nic medium (Wnt + EGF + Noggin + R-spondin + Nicotinamid) ved 37 ° C, 5% CO2 i en fugtig inkubator (som tidligere beskrevet 15) .
  2. På dag 2 ændres medium ved at erstatte WENR + Nic med 250 μL EN (EGF + Noggin) + CHIR99021 (Glycogen Synthase Kinase-3-hæmmer) + Y-27632 (ROCK-hæmmer) uden antibiotika (se tabel 2 ).
    BEMÆRK: I alle trin er mængden af ​​medium tilsat til hver brønd på en 48-brønds plade 250 μL.
  3. På dag 3 ændres organoidmediet til EN + CHIR99021 + Y-27632 + 1,25% v / v Dimethylsulfoxid (DMSO) uden antibiotika.
  • Fremstilling af cellerne
    BEMÆRK:Her beskriver vi hvordan man fragmenterer organoider i småcellede klynger ved mekanisk og kemisk dissociation. Disse trin er afgørende for procedurens succes.
    1. På dag 4, forstyrre kælder matrix kupler ved hjælp af en 1 ml pipette tip og overføre organoider til en 1,5 ml rør. Poolindhold af fire brønde i en 48-brønds plade i et rør.
    2. Mekanisk bryde organoider i små fragmenter ved pipettering op og ned med en P200 pipette ca. 200 gange. Centrifuge ved stuetemperatur, 5 minutter ved 600 x g.
    3. Fjern mediet og resuspender pelleten i 1 ml af en rekombinant protease af cellekulturklasse (se tabel over materialer). Inkubér ved 37 ° C i maksimalt 5 minutter og kontroller derefter en 50 μl dråbe prøve under et inverteret lysmikroskop med et 4x objektiv.
      BEMÆRK: Klynger på 10-15 celler er ønskelige, da dette øger celleoverlevelse efter elektroporation.
    4. Overfør cellesuspensionen til et lavbindende 15 ml rør og stands forDissociation ved tilsætning af 9 ml basalt medium uden antibiotika (se tabel 2 ). Centrifuge ved stuetemperatur, 5 minutter ved 600 xg, kassér supernatanten og resuspender pelleten i 1 ml reduceret serummedium (se tabel over materialer ).
    5. Tæl antallet af celler med et Bürker-kammer og brug mindst 1 x 10 5 celler pr. Elektroporationsreaktion. Tilsæt 9 ml reduceret serummedium til 15 ml rør og centrifuge ved stuetemperatur, 3 minutter ved 400 x g.
  • elektroporation
    BEMÆRK: Følgende afsnit giver vejledning i, hvordan man udfører elektroporation og for at få organoider til at komme sig efterfølgende.
    1. Fjern alt supernatanten og resuspender pelleten i en elektroporationsopløsning (se tabel over materialer ). Tilsæt en total mængde på 10 μg DNA til cellesuspensionen og tilsæt elektroporationsopløsning til et slutvolumen på 100 μl og hold cellen-DNEn blanding på is. Brug CRISPR-concatamer-vektorer i kombination med et Cas9 ekspressionsplasmid ( fx Addgen # 41815) i et 1: 1 forhold.
      BEMÆRK: Det samlede volumen af ​​det tilsatte DNA skal være mindre end eller lig med 10% af det totale reaktionsvolumen.
    2. Inkluder et separat transfektionsmix indeholdende et GFP-plasmid for at evaluere transfektionseffektivitet ( fx pCMV-GFP, Addgene # 11153 eller et hvilket som helst generisk GFP-eksprimerende plasmid).
    3. Tilsæt celle-DNA-blandingen til elektroporationskuvetten og anbring den i elektroporatorkammeret. Mål impedansen ved at trykke på den relevante knap på elektroporatoren og sørg for at den er 0,030-0,055 Ω. Udfør elektroporation i henhold til indstillingerne vist i tabel 3 .
      BEMÆRK: Hvis impedansværdien falder uden for det tilladte område, skal du justere opløsningsmængden i kuvetten.
    4. Tilsæt 400 μL elektroporationsbuffer + Y-27632 til kuvetten og overfør derefter alle til en 1,5 ml rør. IncubaTe ved stuetemperatur i 30 minutter for at give cellerne mulighed for at genvinde og derefter dreje dem ved stuetemperatur i 3 minutter ved 400 x g.
    5. Fjern supernatanten og resuspender pelleten i 20 μl / brønd i kældermatrixen. Sæd ca. 1 x 10 4 til 1 x 10 5 celler pr. Brønd i en 48-brønds plade og tilsæt EN + CHIR99021 + Y-27632 + 1,25% v / v DMSO-medium. Inkuber ved 37 ° C.
    6. På dag 5 ændres mediet til EN + CHIR99021 + Y-27632, og kontroller transfektionseffektiviteten ved at observere GFP-ekspression ( Figur 2 ). Opbevar organoider ved 37 ° C og opfrisk EN + CHIR99021 + Y-27632 medium efter 2 dage.
    7. På dag 9 ændres mediet til WENR + Nic + Y-27632 og inkuberes ved 37 ° C.
      BEMÆRK: Y-27632 kan fjernes efter 7-10 dage (på dag 16-19).
  • Poring puls Overfør puls
    Spænding 175 V 20V
    Pulslængde 5 ms 50 msek
    Pulseinterval 50 msek 50 msek
    Antal pulser 2 5
    Nedfaldshastighed 10% 40%
    polaritet + +/-

    Tabel 3: Elektroporationsindstillinger.

    4. Vækstfaktor tilbagetrækning

    Bemærk: Her er det eksemplificeret, hvordan man gennemfører et vækstfaktor tilbagetrækningsforsøg, når man slår ud negative regulatorer af Wnt-banen i tarmorganoider.

    1. 10-14 dage afteR elektroporation deles organoiderne i et 1: 3 forhold i en 48-brønds plade efter ovenstående trin (3.2.1 - 3.2.2).
    2. Resuspender organoidpelleten i 20 μl kældermembranmatrix og lad den størkne ved 37 ° C i 10 minutter. Derefter overlejres 250 μL vækstfaktor-berøvet medium ( f.eks. EN) for at teste om knockout af målgenene er opnået 5 .
    3. Del organoiderne under vækstfaktor-berøvede betingelser for mindst 2 - 3 passager for at se forskellen i overlevelse mellem vildtype wildtype (WT) kontrolorganoider og mutantorganoider 5 , 15 .
      BEMÆRK: Wildtype-organoider bør ikke kunne overleve i vækstfaktor-berøvet medium over to passager, mens mutantlinjer skal kunne vokse.

    Representative Results

    For at bekræfte tilstedeværelsen af ​​det korrekte antal gRNA-indsatser i concatemervektoren udføres restriktionsfordøjelse med enzymer ( EcoR I + Bgl II), der flankerer alle gRNA-udtrykkende kassetter (hver kassettestørrelse er ~ 400 bp, figur 1 ). For eksempel, når der genereres en 4 gRNA-concatemer-vektor, er den forventede størrelse af det nedre bånd i agarosegelen ca. 1,6 Kbp; Et hvilket som helst bånd lavere end dette indikerer, at ikke alle 4 gRNA-kassetter indsættes i vektoren ( figur 2A ). Derudover anbefales det altid at kontrollere, at alle Bbs I genkendelsessteder går tabt, og enzymet skærer ikke vektoren ( figur 2B ).

    Når konstruktionerne er blevet bekræftet, kan de leveres til mus-tarmorganoider ved elektroporation for at opnå optimaL-niveauer af transfektionseffektivitet (op til 70%), som det fremgår af GFP-kontrollen ( figur 3 ).

    Endelig for at funktionelt teste effektiviteten af ​​denne strategi blev dyrkede organoider transficeret med Cas9 og concatemervektorer mod Axin1 / 2 og Rnf43 / Znrf3 dyrket i EN (R-spondin-tilbagetrækning) og EN + IWP2 (R-spondin og Wnt-tilbagetrækning, IWP2 : Porcupine hæmmer, 2,5 μM) medier for mindst 3 passager ( Figur 4 ). Mens utransficerede WT-organoider døde under begge betingelser, overlevede Axin1 / 2 knockout-organoider i begge på grund af nedstrøms aktivering af Wnt-banen. Derudover overlever Rnf43 / Znrf3 mutantorganoider i fravær af R-spondin, men kan ikke overleve i nærvær af IWP2, hvilket forårsager udtømning af Wnt, der aktiverer vejen. Samlet set viser disse observationer, at knockout af disse parparoguer er mulig ved at generere tHan forventede organoid fænotype. Oplysninger om disse resultater er blevet offentliggjort i udviklingsbiologi 5 .

    figur 1
    Figur 1: Skematisk repræsentation af CRISPR-concatemeren med 4 kassetter. Skema af 4 gRNA-concatemervektoren med hver 400 bp-kassette indeholdende en U6-promotor, to inverterede gentagne Bbs I-steder (også angivet som BB) og gRNA-stillads i denne rækkefølge. Under den blandede reaktion erstattes Bbs I-steder af gRNA-fragmenter med matchende overhæng og følgelig tabt. Bindingssteder af sekventeringsprimere til kontrol af korrekt insertion af gRNA-oligoer er vist ved de blå pile. Fwd = forward primer, Rev = reverse primer, Link 1/2/3 = linker regioner 1/2/3. Venligst cSlikke her for at se en større version af denne figur.

    Figur 2
    Figur 2: Repræsentative fordøjelsesmønstre af Concatemer Vectors. ( A ) Dobbelt fordøjelse af 3 og 4 gRNA-concatemervektorer med EcoR I og Bgl II. Det korrekte fordøjelsesmønster er markeret med en grøn markering, mens vektorer med kun 1 eller 2 gRNA insertioner er markeret med et rødt kryds. Bane 1 viser fordøjelsen af ​​en 4-gRNA-concatemer-forældelsesvektor anvendt som positiv kontrol (markeret med "+"); På samme måde viser bane 5 fordøjelse af en 3 gRNA-concatemer forældrevektor, markeret med "+". ( B ) Fordøjelse med Bbs I, der viser den korrekte størrelse af ufordøjede concatemervektorer (angivet af de grønne flåter). Fordøjelse af en gRNA-holdig concatemervektor, der har tabt Bbs I-steder, anvendes som en positiv kontrol anD er markeret med "+". Klik her for at se en større version af denne figur.

    Figur 3
    Figur 3: Repræsentativt billede af succesfuldt elektroporerede tarmorganoider. Transfektion af et GFP-plasmid er instrumental til at evaluere transfektionseffektivitet. Ca. 24 timer efter elektroporation er organoider indeholdende et lille antal celler allerede synlige, og hvis elektroporationsproceduren var vellykket, viser op til 70% af dem grøn fluorescens. BF = lystfelt, GFP = grønt fluorescerende protein. Målestang = 2.000 μm. Klik her for at se en større version af denne figur.


    Figur 4: Repræsentative billeder af mutant tarmorganoider. Knockout af de negative regulatorer af Wnt-banen Axin1 og Rnf43, sammen med deres paraloguer, gør tarmorganoiderne resistente over for vækstfaktorer. Især kan Axin1 / 2 knockout-organoider (Axin1 / 2 KO) vokse i fravær af både R-spondin (EN: EGF + Noggin) og Wnt (EN + IWP2: EN + Porcupine-hæmmer), mens Rnf43 / Znrf3 mutantorganoider (R & Z KO) kan kun overleve i fravær af R-spondin (EN). I modsætning hertil kan WT-organoider kun overleve i kontrolkulturtilstanden WENR + Nic (Wnt + EGF + Noggin + R-spondin + Nicotinamid). Skalestænger = 1000 μm. Klik her for at se en større version af denne figur.

    Basal medium Kommentarer
    Opbevares ved 4 ° C i 4 uger
    Cellekulturmedium 500 ml Se tabel over materialer
    L-Glutamin 100x 5 ml
    Buffermiddel 1 M 5 ml Se tabel over materialer
    Penicillin Streptomycin 100x 5 ml
    WENR + Nic (Wnt + EGF + Noggin + R-spondin + Nicotinamid)
    Opbevares ved 4 ° C i 2 uger
    Basal medium Op til 50 ml
    Neuronalcelle serumfrit supplement (50x) 1 ml Se tabel over marialer
    Neuronalcelle serumfrit supplement (100x) 500 μl Se tabel over materialer
    N-acetylcystein (500 mM) 125 μl
    Mus EGF (100 μg / ml) 25 μl
    Mus Noggin (100 μg / ml) 50 μl
    R-Spondin-konditioneret medium 5 ml
    Wnt3a konditioneret medium 25 ml
    Nicotinamid (1 M) 250 μl
    EN + CHIR + Y-27632 (EGF + Noggin + CHIR + Y-27632)
    Opbevares ved 4 ° C i 2 uger
    Basal medium uden Penicillin Streptomycin Op til 20 ml
    Neuronalcelle serumfrit supplement (50x) 400 μl Se tabel over materialer
    Neuronalcelle serumfrit supplement (100x) 200 μl Se tabel over materialer
    N-acetylcystein (500 mM) 50 μl
    Mus EGF (100 μg / ml) 10 μl
    Mus Noggin (100 μg / ml) 20 μl
    Y-27632 (10 μM) 20 μl
    CHIR99021 (8 μM) 10 μl
    EN (EGF + Noggin)
    Opbevares ved 4 ° C i 4 uger
    Basal medium Op til 50 ml
    Neuronalcelle serumfrit supplement (50x) Se Materialebeskrivelse
    Neuronalcelle serumfrit supplement (100x) 500 μl Se Materialebeskrivelse
    N-acetylcystein (500 mM) 125 μl
    Mus EGF (100 μg / ml) 25 μl
    Mus Noggin (100 μg / ml) 50 μl

    Tabel 2: Organoid Mediekomposition.

    Discussion

    I denne protokol beskriver vi alle de trin, der er nødvendige for at generere CRISPR-concatemers og at anvende CRISPR-concatemers i musedarmorganoider for samtidig at slå flere gener ud. Som tidligere nævnt har denne strategi flere fordele, såsom hastighed, høj effektivitet og omkostningseffektivitet.

    For at kunne gennemføre hele proceduren er der et par kritiske aspekter at overveje. For det første er det afgørende, at alle gRNA-oligos er korrekt annealeret og phosphoryleret, da de repræsenterer udgangsmaterialet til Bbs I-kloningsreaktionen, der i sig selv er meget effektivt. For det andet, når de elektroporerende organoider, jo flere celler der anvendes pr. Tilstand, jo højere er den maksimale mulige transfektionseffektivitet. Derudover er det også vigtigt, at celleklynger efter celledissociation dominerer over enkeltceller.

    Ikke desto mindre er det muligt at støde på teknisk probLems når man prøver enten kloning eller transfektion for første gang; I tilfælde af problemer under gRNA-kloning anbefales det at dobbeltsjekke gRNA-oligosekvensen og, hvis det er korrekt, vælge yderligere bakteriekolonier til screening af restriktionsfordøjelse. Hvis transfektionseffektivitet og cellelevedygtighed er lav efter elektroporering, er det tilrådeligt at gentage protokollen ved hjælp af flere celler pr. Tilstand og reducere tiden for celledissociation til 3 minutter.

    Skønt genereringen af ​​CRISPR-concatemers er forholdsvis billig og nem, er det ikke muligt at udføre større skala genetiske skærme i organoider, da skalaen er begrænset af omkostningerne forbundet med organoid kultur og af dets arbejdskrævende karakter. Det er værd at nævne i dette tilfælde, at CRISPR-concatemer-metoden også er kompatibel med cellelinjer, såsom HEK293 og musembryoniske stamceller.

    Uanset cellesystemet er en anden potentiel ulempe ved denne sTrategy kan opstå, når man sigter mod samtidig udfald af tre eller fire forskellige gener. For eksempel vil hver gRNA have en anden målretningseffektivitet, og ændringerne i at ramme alle generne på samme tid kan være relativt lave; Af denne grund er det tilrådeligt at anvende concatemer-systemet til at styre mere end et gRNA mod det samme gen.

    Alternative strategier baseret på Golden Gate-shuffling er blevet foreslået gennem årene for at generere multiplex-gRNA-vektorer 7 , 8 . Imidlertid er det i vores metode muligt at montere flere gRNA'er direkte i en enkelt retroviral vektor i en enkelt kloningsrunde, hvilket gør den egnet til at generere gRNA-biblioteker for at målrette paraloger.

    Vores CRISPR-concatemer er bygget i den MSCV retrovirale vektor backbone. Således kan gRNA-concatemer-holdigt retrovirus anvendes til at generere stabile cellelinier, der overexplodererRess gRNA'er. Når det kombineres med et Cas9-inducerbart system, kan man udføre inducerbare paralogue knockouts ved hjælp af vores system.

    Sammenfattende beskriver vi her hvordan man klonrer op til fire forskellige gRNA'er i samme vektor i et trin og hvordan man anvender denne strategi for organoidkultur med en høj transfektionseffektivitet. Derudover giver vi nyttige forslag til at maksimere chancerne for succes gennem hele proceduren.

    Disclosures

    Forfatterne har intet at afsløre. Forfatterne har ingen interessekonflikt erklæret.

    Acknowledgments

    Vi takker Christopher Hindley for den kritiske læsning af manuskriptet. AM understøttes af Wntsapp (Marie Curie ITN), AA-R. Støttes af Medical Research Council (MRC) og BK.K. Og RM støttes af en Sir Henry Dale Fellowship fra Wellcome Trust og Royal Society [101241 / Z / 13 / Z] og modtager støtte gennem et kernetilskud fra Wellcome Trust og MRC til Wellcome Trust - MRC Cambridge Stem Cell Institute .

    Materials

    Name Company Catalog Number Comments
    Optimized CRISPR Design Tool Feng Zhang group CRISPR gRNA design tool; http://crispr.mit.edu/
    Webcutter 2.0 restriction mapping tool; http://rna.lundberg.gu.se/cutter2/
    T4 PNK (Polynucleotide Kinase) New England Biolabs M0201L
    T4 DNA ligase buffer New England Biolabs M0202S
    T7 DNA Ligase New England Biolabs M0318L
    DTT (dithiothreitol) Promega P1171
    ATP (adenosine triphosphate) New England Biolabs P0756S
    FastDigest BbsI (BpiI) Thermo Fisher FD1014
    Tango buffer (BSA-containing restriction enzyme buffer) Thermo Fisher BY5
    BglII New England Biolabs R0144
    EcoRI New England Biolabs R0101
    Plasmid-safe exonuclease Cambio E3101K
    Thermal cycler Applied biosystems 4359659
    10G competent E. coli bacteria Cambridge Bioscience 60108-1
    Plasmid mini kit Qiagen 12125
    Table top microcentrifuge Eppendorf UY-02580-01
    Inoculating loops Microspec PLS5
    Bacteria incubator Sanyo MIR-262
    Luria-Bertani broth (LB) Sigma-Aldrich L3522
    Agarose Sigma-Aldrich A4718
    Agarose gel electrophoresis apparatus Bioneer A-7020
    Advanced DMEM/F12(cell culture medium) Invitrogen 12634-034
    Glutamax (L-Glutamine) 100x Invitrogen 35050-068
    HEPES 1 M (buffering agent) Invitrogen 15630-056
    Penicillin-streptomycin 100x Invitrogen 15140-122
    B27 supplement (Neuronal cell serum-free supplement) 50x Invitrogen 17504-044
    N2 supplement (Neuronal cell serum-free supplement) 100x Invitrogen 17502-048
    n-Acetylcysteine 500 mM Sigma-Aldrich A9165-5G
    Mouse EGF 500 µg/mL Invitrogen Biosource PMG8043
    Mouse Noggin 100 µg/mL Peprotech 250-38
    Nicotinamide 1 M Sigma N0636
    R-Spondin conditioned medium n.a. n.a. Produced in house from HEK293 cells, for details see Sato and Clevers 2013
    Wnt conditioned medium n.a. n.a. Produced in house from HEK293 cells, for details see Sato and Clevers 2013
    Y-27632 10 µM Sigma-Aldrich Y0503-1MG
    Standard BD Matrigel matrix BD Biosciences 356231
    48-well Plate Greiner Bio One 677980
    CHIR99021 Sigma-Aldrich A3734-1MG
    IWP-2 Cell Guidance Systems SM39-10
    TrypLE (recombinant protease) Invitrogen 12605-010
    Opti-MEM (reduced serum medium ) Life technologies 51985-034
    Electroporation Cuvettes 2 mm gap NepaGene EC-002S
    Low binding 15 mL tubes Sigma-Aldrich CLS430791
    Bürker’s chamber Sigma-Aldrich BR719520-1EA
    NEPA21 Super Electroporator NepaGene contact supplier
    Protein LoBind tubes low binding Thermo Fisher 10708704
    BTXpress electroporation buffer Harvard Apparatus 45-0805
    DMSO (Dimethyl sulfoxide) AppliChem A3672

    DOWNLOAD MATERIALS LIST

    References

    1. Mali, P., et al. RNA-Guided Human Genome Engineering via Cas9. Science. 339, (6121), 823-826 (2013).
    2. Koike-Yusa, H., Li, Y., Tan, E. -P., Velasco-Herrera, M. D. C., Yusa, K. Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library. Nat Biotech. 32, (3), 267-273 (2014).
    3. Bassett, A. R., Kong, L., Liu, J. L. A Genome-Wide CRISPR Library for High-Throughput Genetic Screening in Drosophila Cells. J Genet Genomics. 42, (6), 301-309 (2015).
    4. Diss, G., Ascencio, D., DeLuna, A., Landry, C. R. Molecular mechanisms of paralogous compensation and the robustness of cellular networks. J Exp Zool B Mol Dev Evol. 322, (7), 488-499 (2014).
    5. Andersson-Rolf, A., Merenda, A., Mustata, R. C., Li, T., Dietmann, S., Koo, B. -K. Simultaneous paralogue knockout using a CRISPR-concatemer in mouse small intestinal organoids. Dev Biol. 420, (2), 1-7 (2016).
    6. Ran, F. A., Hsu, P. P. D., Wright, J., Agarwala, V., Scott, D., Zhang, F. Genome engineering using the CRISPR-Cas9 system. Nat Protoc. 8, (11), 2281-2308 (2013).
    7. Engler, C., Gruetzner, R., Kandzia, R., Marillonnet, S. Golden gate shuffling: A one-pot DNA shuffling method based on type IIs restriction enzymes. PLoS ONE. 4, (5), (2009).
    8. Sakuma, T., Nishikawa, A., Kume, S., Chayama, K., Yamamoto, T. Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 4, (5), 5400 (2014).
    9. Kabadi, A. M., Ousterout, D. G., Hilton, I. B., Gersbach, C. A. Multiplex CRISPR/Cas9-based genome engineering from a single lentiviral vector. Nucleic Acids Res. 42, (19), 1-11 (2014).
    10. Yin, L., et al. Multiplex Conditional Mutagenesis Using Transgenic Expression of Cas9 and sgRNAs. Genetics. 200, (2), 431-441 (2015).
    11. Cress, B. F., Toparlak, O. D., et al. CRISPathBrick: Modular Combinatorial Assembly of Type II-A CRISPR Arrays for dCas9-Mediated Multiplex Transcriptional Repression in E. coli. ACS Synth Biol. 4, (9), 987-1000 (2015).
    12. Froger, A., Hall, J. E. Transformation of plasmid DNA into E. coli using the heat shock method. J Vis Exp. (6), e253 (2007).
    13. Zimmermann, J., Voss, H., Schwager, C., Stegemann, J., Ansorge, W. Automated Sanger dideoxy sequencing reaction protocol. FEBS Letters. 233, (2), 432-436 (1988).
    14. Fujii, M., Matano, M., Nanki, K., Sato, T. Efficient genetic engineering of human intestinal organoids using electroporation. Nat. Protoc. 10, (10), 1474-1485 (2015).
    15. Andersson-Rolf, A., Fink, J., Mustata, R. C., Koo, B. -K. A video protocol of retroviral infection in primary intestinal organoid culture. J Vis Exp. (90), e51765 (2014).

    Erratum

    Formal Correction: Erratum: A Protocol for Multiple Gene Knockout in Mouse Small Intestinal Organoids Using a CRISPR-concatemer
    Posted by JoVE Editors on 01/02/2018. Citeable Link.

    An erratum was issued for: A Protocol for Multiple Gene Knockout in Mouse Small Intestinal Organoids Using a CRISPR-concatemer. There was a typo in step 3.3 of the Protocol.

    Step 3.3 was corrected from:

    Add the cell-DNA mixture to the electroporation cuvette and place it in the electroporator chamber. Measure the impedance by pushing the appropriate button on the electroporator and ensure that it is 0.030-0.055 Ω

    to:

    Add the cell-DNA mixture to the electroporation cuvette and place it in the electroporator chamber. Measure the impedance by pushing the appropriate button on the electroporator and ensure that it is 0.030-0.055 kΩ

    Comments

    0 Comments


      Post a Question / Comment / Request

      You must be signed in to post a comment. Please or create an account.

      Usage Statistics