تشكيل بيليه غضروفي من الخلايا الجذعية المحفزة المستمدة من الدم الحبلية

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

هنا، نقترح بروتوكولا للتمايز غضروفي من خلايا الدم الجذعية المحفزة التي يسببها الإنسان الخلايا الجذعية المحفزة.

Cite this Article

Copy Citation | Download Citations

Nam, Y., Rim, Y. A., Ju, J. H. Chondrogenic Pellet Formation from Cord Blood-derived Induced Pluripotent Stem Cells. J. Vis. Exp. (124), e55988, doi:10.3791/55988 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

الغضروف المفصلي الإنسان يفتقر إلى القدرة على إصلاح نفسها. وبالتالي يتم علاج انحطاط الغضروف ليس عن طريق العلاجية ولكن عن طريق العلاجات المحافظة. حاليا، تبذل جهود لتجديد الغضروف التالفة مع السابقين فيفو توسيع غضروفية أو الخلايا الجذعية الوسيطة المستمدة من نخاع العظم (بمسك). ومع ذلك، فإن قابلية محدودة وعدم استقرار هذه الخلايا تحد تطبيقها في إعادة بناء الغضروف. وقد تلقت الخلايا الجذعية المحفزة البشرية (هيبسس) اهتماما علميا كبديل جديد للتطبيقات التجدد. مع القدرة على التجديد الذاتي غير محدود والتعدد، وقد تم تسليط الضوء على هيبسس كمصدر بديل خلية جديدة لإصلاح الغضاريف. ومع ذلك، والحصول على كمية عالية من الكريات تشوندروجيك عالية الجودة هو التحدي الرئيسي لتطبيق السريري. في هذه الدراسة، استخدمنا الخلايا الجنينية (إب) - خلايا النمو المكتشفة للتمايز غضروفي. وأكدت تشوندروجينيسيس الناجحة عن طريق ير أد تلطيخ مع الأزرق ألسيان، الأزرق تولويدين، والأجسام المضادة ضد أنواع الكولاجين الأول والثاني (COL1A1 و COL2A1، على التوالي). نحن نقدم طريقة مفصلة لتفريق الدم الحبل النوى أحادي النواة إيبسس المستمدة من الخلايا (كبمك-هيبسس) في الكريات تشوندروجينيك.

Introduction

استخدام هيبسس يمثل استراتيجية جديدة لفحص المخدرات والدراسات الميكانيكية من مختلف الأمراض. من منظور التجدد، هيبسس هي أيضا مصدر محتمل لاستبدال الأنسجة التالفة التي لديها القدرة على الشفاء محدودة، مثل الغضروف المفصلي 1 ، 2 .

كان تجديد الغضروف المفصلي الأصلي تحديا لعدة عقود. غضروف المفصلي هو لينة، والأنسجة البيضاء التي تغلف نهاية العظام، وحمايتها من الاحتكاك. ومع ذلك، فقد قدرة التجدد محدودة عندما تضررت، الأمر الذي يجعل إصلاح الذاتي يكاد يكون من المستحيل. ولذلك، فإن الأبحاث التي تركز على تجديد الغضروف مستمرة منذ عدة عقود.

سابقا، في التمايز المختبر في النسب غضروفية عادة ما يتم تنفيذ مع بمسكس أو غضروفية الأصلي معزولة من مفصل الركبة 3 . بسبب tس إمكانات تشوندروجينيك، بمسكس والغضروفية الأصلية لديها العديد من المزايا دعم استخدامها في تشوندروجينيسيس. ومع ذلك، بسبب التوسع المحدود والنمط الظاهري غير المستقر، تواجه هذه الخلايا عدة قيود في إعادة بناء عيوب الغضروف المفصلي. تحت ظروف الثقافة في المختبر ، وهذه الخلايا تميل إلى فقدان خصائصها بعد 3-4 الممرات، والتي تؤثر في نهاية المطاف قدراتهم التمايز 4 . أيضا، في حالة غضروفية محلية، أضرار إضافية إلى مفصل الركبة أمر لا مفر منه عند الحصول على هذه الخلايا.

على عكس بمسكس أو غضروفية الأم، يمكن هبسس توسيع إلى أجل غير مسمى في المختبر . مع ظروف الثقافة المناسبة، هبسس لديها إمكانات كبيرة كمصدر بديل للتمايز غضروفي. ومع ذلك، فإنه من الصعب تغيير الخصائص الجوهرية لل هيبس 5 . وعلاوة على ذلك، فإنه يأخذ عدة تعقيدا في المختبر ستيبس لتوجيه مصير هيبس إلى نوع خلية محددة. على الرغم من هذه المضاعفات، لا يزال ينصح باستخدام هيبسس بسبب قدراتهم الذاتية التجديد الذاتي وقدرتها على التفريق في الخلايا المستهدفة، بما في ذلك غضروفية 6 .

وعادة ما يتم التمايز غضروفية مع نظم الثقافة ثلاثية الأبعاد، مثل ثقافة بيليه أو الثقافة ميكروماس، وذلك باستخدام الخلايا السلف مثل مسك. إذا كان استخدام هيبس، بروتوكول لتوليد الخلايا السلف مثل مسك يختلف عن البروتوكولات الموجودة. بعض المجموعات تستخدم ثقافة أحادي الطبقة من هبسس لتحويل مباشرة النمط الظاهري إلى الخلايا مثل مسك 7 . ومع ذلك، فإن معظم الدراسات تستخدم إبس لتوليد خلايا النمو التي تشبه مسس 8 ، 9 ، 10 ، 11 .

وتستخدم أنواع مختلفة من عوامل النمو للحث على تشوندروجnesis. عادة، يتم استخدام البروتينات الأسرة بمب و TGF،، وحدها أو في تركيبة. وقد تم تحفيز التمايز أيضا مع عوامل أخرى، مثل GDF5، FGF2، و IGF1 12 ، 13 ، 14 ، 15 . وقد تبين TGFβ1 لتحفيز غضروفية في طريقة تعتمد على الجرعة في اللجان الدائمة 16 . بالمقارنة مع النمط النظري الآخر، TGFβ3، TGFβ1 يدفع تشوندروجينيسيس عن طريق زيادة الغضروف الخلية الوسيطة التكثيف.TGFβ3 يدفع تشوندروجينيسيس عن طريق زيادة كبيرة في انتشار الخلايا الوسيطة 17 . ومع ذلك، TGFβ3 يستخدم بشكل متكرر أكثر من الباحثين من TGFβ1 7 ، 10 ، 18 ، 19 . BMP2 يعزز التعبير عن الجينات المتعلقة مكونات مصفوفة غضروفية في الإنسانغضروفي مفصلي تحت ظروف المختبر 20 . BMP2 يزيد من التعبير عن الجينات الحيوية لتشكيل الغضروف في اللجان الدائمة في تركيبة مع البروتينات TGF 21 21 . وقد تبين أيضا أن PMP2 يعزز بشكل تعاوني تأثير TGFβ3 من خلال مسارات سماد و مابك 22 .

في هذه الدراسة، تم تجميع كبمك-هيبسس في إبس باستخدام المتوسطة إب في طبق بتري منخفضة المرفقات. وكانت الخلايا الناتجة عن إرفاق إبس إلى طبق المغلفة الجيلاتين. تم إجراء تمايز غضروفي باستخدام خلايا النمو بواسطة ثقافة بيليه. العلاج مع كل من BMP2 و TGFβ3 تكثف بنجاح الخلايا وتسببها المصفوفة خارج الخلية (إسم) تراكم البروتين لتشكيل بيليه تشوندروجينيك. وتقترح هذه الدراسة بروتوكول التمايز تشوندروجيك بسيطة ولكنها فعالة باستخدام كبمك-هيبسس.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

تمت الموافقة على هذا البروتوكول من قبل مجلس الاستعراض المؤسسي للجامعة الكاثوليكية في كوريا (KC12TISI0861). تم الحصول على كبمكس المستخدمة لإعادة البرمجة مباشرة من بنك الدم الحبل في مستشفى سانت سانت ماري.

1. تشوندروجينيك التمايز من إيبسس

  1. كبمك-إبسك جيل
    1. توليد كبمك-هيبسس باستخدام بروتوكول هو مبين في عملنا السابق 23 .
    2. جمع خلايا الدم في أنبوب مخروطي 15 مل وتحسب لهم باستخدام عدادة الكريات.
    3. إعداد 3 × 10 5 خلايا وأجهزة الطرد المركزي لهم لمدة 5 دقائق في 515 زغ و رت. تجاهل طاف عن طريق الشفط و ريسوسبيند الخلايا في 0.5 مل من وسط خلية الدم.
    4. نقل الخلايا إلى بئر لوحة غير المغلفة 24 جيدا وإضافة خليط فيروس سنداي، في أعقاب توصيات الشركة الصانعة.
    5. أجهزة الطرد المركزي لوحة لمدة 30 دقيقة في 1،150 x ج و 30 درجة مئوية.
    6. الخلفإير الطرد المركزي، احتضان الخلايا بين عشية وضحاها (O / N) عند 37 درجة مئوية في 5٪ كو 2 .
    7. في اليوم التالي، نقل الخلايا ترانزدوسد إلى مصفوفة المغلفة جيدا. أجهزة الطرد المركزي لوحة في 1،150 x ج لمدة 30 دقيقة في 30 درجة مئوية.
    8. بعد الطرد المركزي، وإزالة طاف، إضافة 1 مل من المتوسطة إيبسك، والحفاظ على الخلايا O / N عند 37 درجة مئوية في 5٪ كو 2 .
    9. الحفاظ على الخلايا المرفقة عند 37 درجة مئوية و 5٪ كو 2 . تغيير المتوسطة يوميا، لتحل محله مع المتوسطة إيبسك الطازجة.
      ملاحظة: ستظهر المستعمرات في يوم 14-21 بعد التنبيب.
  2. إب
    1. الحفاظ على هيبسس عند 37 درجة مئوية و 5٪ كو 2 . تغيير المتوسطة يوميا، لتحل محلها الأساسية الأساسية 8 (E8) المتوسطة.
    2. إعداد 2 × 10 6 هيبسس في فيترونكتين المغلفة، طبق 100 ملم في المتوسط ​​E8.
    3. إزالة المتوسطة E8 من طبق الثقافة وغسل مع المالحة الفوسفات مخزنة المالحة (بس).
    4. إضافة 1مل من 1 ملي إثيلينديامينتيتراسيتيك حمض (إدتا) واحتضان عند 37 درجة مئوية و 5٪ كو 2 لمدة 2 دقيقة.
    5. حصاد الخلايا مع 3 مل من E8 المتوسطة ونقلها إلى أنبوب مخروطي 15 مل جديد. أجهزة الطرد المركزي الخلايا في 250 x ج في درجة حرارة الغرفة (رت) لمدة 2 دقيقة.
    6. نضح طاف دون إزعاج بيليه الخلية و ريسوسبيند الخلايا في 5 مل من E8 المتوسطة.
    7. عد الخلايا باستخدام عدادة الكريات وإعداد 2 × 10 6 خلايا لكل طبق بتري 100 ملم. ريسوسبيند الخلايا المعدة في خليط 10 مل من E8 و إب المتوسطة (1: 1) مع 10 ميكرومتر الكيناز المرتبطة روك (روك) المانع.
    8. احتضان الخلايا O / N للتجميع عند 37 درجة مئوية و 5٪ كو 2 .
    9. في اليوم التالي، حصاد إبس المجمعة عن طريق بيبتينغ. أجهزة الطرد المركزي الخلايا في 250 x ج لمدة 1 دقيقة. إزالة طاف و ريسوسبيند إبس في 10 مل من E8 الطازجة المتوسطة.
    10. تكبير إبس ولدت لمدة 5 أيام، وأداء التغييرات اليومية مع فريسساعة E8 المتوسطة. لمزيد من النضج، تغيير الوسط الثقافي إلى E7 المتوسطة. الحفاظ على إبس عند 37 درجة مئوية و 5٪ كو 2 لمدة 5 أيام أخرى، وإجراء تغييرات متوسطة يوميا مع المتوسطة E7 الطازجة.
      ملاحظة: متوسط ​​E7 هو E8 المتوسطة دون FGF2.
  3. نمو الخلايا الاستقراء من إبس
    1. إضافة 6 مل من 1٪ الجيلاتين إلى طبق 100 ملم واحتضان عند 37 درجة مئوية و 5٪ كو 2 لمدة 30 دقيقة.
    2. إزالة الجيلاتين وتجفيف طبق تماما لمدة 2-3 ساعة قبل الاستخدام.
    3. نقل إبس إلى أنبوب مخروطي 50 مل. السماح إبس لتسوية في الجزء السفلي من أنبوب مخروطي الشكل. إزالة طاف دون إزعاج إبس.
    4. ريسوسبيند إبس في 10 مل من دولبيكو في تعديل النسر المتوسطة (دمم) مع 20٪ مصل بقري الجنين (فبس). نقل إبس إلى الجيلاتين المغلفة، طبق 100 ملم. إضافة 10 ميكرو متر روك المانع.
    5. احتضان والحفاظ على الخلايا عند 37 درجة مئوية و 5٪ كو 2 لمدة 7 أيام. غير الخلفيةديوم كل يوم دون إضافة المانع روك.
  4. تشكيل بيليه تشوندروجينيك
    1. نضح وسط الثقافة من الطبق وغسل الخلايا ثلاث مرات مع برنامج تلفزيوني.
    2. تطبيق 1 مل من 1 ملي إدتا واحتضان عند 37 درجة مئوية و 5٪ كو 2 لمدة 2 دقيقة.
    3. حصاد الخلايا باستخدام 5 مل من دمم مع 20٪ فبس ونقلها إلى أنبوب مخروطي 15 مل جديد.
    4. أجهزة الطرد المركزي الخلايا لمدة 2 دقيقة في 250 x ج و رت. تجاهل طاف و ريسوسبيند بيليه في 10 مل من دمم مع 20٪ فبس.
    5. تصفية وتجاهل كتل الخلايا باستخدام مصفاة الخلية 40 ميكرون وحصاد الخلايا واحدة. عد الخلايا واحدة باستخدام عدادة الكريات.
    6. أجهزة الطرد المركزي الخلايا لمدة 2 دقيقة في 250 x ج و رت. إزالة طاف والبذور 3 × 10 5 خلايا لكل بيليه في أنبوب مخروطي 15 مل مع 300 ميكرولتر من وسط التمايز غضروفية (سدم).
    7. لتكوين بيليه، أجهزة الطرد المركزي الخلايا لمدة 5 دقائق في680 زغ و رت.
      ملاحظة: يتم الاحتفاظ الكريات في 15 مل أنابيب مخروطية خلال التمايز الكريات تشوندروجينيك.
    8. احتضان الخلايا بين عشية وضحاها في 37 درجة مئوية و 5٪ كو 2 .
    9. تغيير آلية التنمية النظيفة كل 2-3 أيام. في غضون 3 أيام، الكريات سوف تظهر بالارض، مورفولوجيز كروي. الحفاظ على الكريات لمدة 21 يوما عند 37 درجة مئوية و 5٪ كو 2 .

2. تشوندروجينيك بيليه توصيف بواسطة تلطيخ

  1. تشوندروجينيك التضمين
    1. قبل التضمين، وإعداد وتذوب البارافين عند 58 درجة مئوية.
    2. إصلاح الكريات في 1 مل من بارافورمالدهيد 4٪ لمدة 2 ساعة في رت في أنبوب 1.5 مل.
      الحذر: بارافورمالدهيد سامة للغاية. تجنب ملامسة العينين أو الجلد أو الأغشية المخاطية. تقليل التعرض وتجنب الاستنشاق أثناء إعداده.
    3. وضع طبقة واحدة من الشاش على كاسيت ونقل الكريات الثابتة باستخدام ماصة. تغطية بيليه بواسطة للطي ثe الشاش وإغلاق غطاء كاسيت.
    4. الشروع في الجفاف في 100 مل من الايثانول 70٪ (إتوه) مرتين، 10 دقيقة لكل منهما. يذوى الكريات من خلال تسلسلي 10 دقيقة يغسل في 80٪ و 95٪ إتوه.
    5. نقل الكريات إلى إتوه 100٪ لمدة 10 دقيقة. كرر ثلاث مرات مع إتوه جديدة.
    6. ل "المقاصة"، وتبادل الحل ل 100 مل، 1: 1 خليط من إتوه و زيلين، تليها خليط 1: 2 من إتوه و زيلين لمدة 10 دقيقة لكل منهما. مسح إتوه المتبقية من خلال احتضان الكريات مرتين في 100٪ زيلين، 10 دقيقة لكل منهما.
    7. لتسلل البارافين، احتضان الكريات في متسلسلة زيلين وخليط البارافين. أداء عملية تسلل البارافين كلها عند 58 درجة مئوية. احتضان الكريات في 100 مل من 2: 1 خليط من الزيلين والبارافين لمدة 30 دقيقة.
    8. تبادل الحل ل 100 مل من 1: 1 خليط من الزيلين والبارافين واحتضان لمدة 30 دقيقة.
    9. تبادل الحل ل 100 مل من 1: 2 خليط من الزيلين والبارافين واحتضان لمدة 30 دقيقة.
    10. للتسلل النهائي، ونقل الكريات إلى الحمام الأول من 100٪ البارافين واحتضان لمدة 2 ساعة.
    11. نقل الكريات إلى الحمام الثاني من 100٪ البارافين واحتضان O / N عند 58 درجة مئوية.
    12. في اليوم التالي، نقل بلطف الكريات إلى قالب باستخدام الملقط. إضافة البارافين إلى القالب من موزع البارافين. صلابة البارافين لمدة 30 دقيقة في 4 درجات مئوية.
    13. شريحة المقاطع في 7 ميكرون ونقل المقاطع على الشريحة. السماح للشرائح لتجف بين عشية وضحاها وتخزين الشرائح في رت حتى تكون جاهزة للاستخدام.
  2. إعداد الشرائح
    1. ديبارافينيز الشرائح عن طريق نقلها من خلال 100 مل من 100٪، 90٪، 80٪، و 70٪ إتوه بالتتابع لمدة 5 دقائق لكل منهما.
    2. وضع الشرائح في جرة زجاجية وشطف مع ماء الصنبور لمدة 5 دقائق.
  3. ألسيان الأزرق، تلطيخ
    1. احتضان الشرائح في 50 مل من 1٪ ألسيان حل الأزرق لمدة 30 دقيقة.
      ليسE: أسيان الأزرق المخفف في 3٪ محلول حمض الخليك. ضبط درجة الحموضة إلى 2.5 باستخدام حمض الخليك.
    2. وضع الشرائح في جرة زجاجية وشطف مع ماء الصنبور لمدة 2 دقيقة.
    3. شطف الشرائح في الماء منزوع الأيونات (دو) و كونتيرستين مع النووية حل سريع الأحمر لمدة 2 دقيقة.
    4. وضع الشرائح في جرة زجاجية وشطف مع ماء الصنبور لمدة 1 دقيقة.
    5. 2.3.5) المضي قدما في يذوى وتركيب الشرائح في الخطوة 2.6.
  4. تلويدين الأزرق تلطيخ
    1. احتضان الشرائح في 50 مل من محلول الأزرق تولويدين لمدة 4 دقائق.
    2. وضع الشرائح في جرة زجاجية وشطف مع ماء الصنبور لمدة 5 دقائق.
    3. انتقل إلى يذوى وجبل الشرائح في الخطوة 2.6.
  5. تلطيخ المناعية
    1. احتضان الشرائح في 3٪ H 2 O 2 لمدة 15 دقيقة لحظر البيروكسيديز الذاتية.
    2. تطبيق 200 ميكرولتر من الأجسام المضادة الأولية (مكافحة COL1A1 و -COL2A1) المخفف 1: 100 في تريس-بو(تبس) تحتوي على 1٪ ألبومين المصل البقري (بسا) و 5٪ مصل الماعز العادي (نغس) إلى الشرائح واحتضان O / N عند 4 درجات مئوية.
    3. في اليوم التالي، وضع الشرائح في جرة زجاجية وغسلها مع 50 مل من تبس تحتوي على 0.1٪ بوليسوربات 20 (تبست) ثلاث مرات لمدة 5 دقائق لكل منهما.
    4. تطبيق 200 ميكرولتر من الأجسام المضادة الثانوية (الماعز المضادة للأرنب إيغ الأجسام المضادة، المخفف 1: 200 في تبس تحتوي على 1٪ بسا و 5٪ نغس) إلى الشرائح واحتضان في رت لمدة 40 دقيقة.
    5. وضع الشرائح في جرة زجاجية وغسلها ثلاث مرات مع 50 مل، 5 دقائق لكل منهما.
    6. لتضخيم إشارة، وتطبيق هرب-مترافق ستريبتافيدين الحل إلى الشرائح واحتضان لمدة 10 دقيقة.
    7. وضع الشرائح في جرة زجاجية وغسلها ثلاث مرات مع 50 مل، 5 دقائق لكل منهما.
    8. خلط داب-بيروكسيداز حل الركيزة، وتطبيق 200 ميكرولتر من الحل لكل شريحة، واحتضان لمدة 1 دقيقة.
    9. وضع الشرائح في جرة زجاجية وشطف مع ماء الصنبور لمدة 5 دقائق.
    10. مباينمع الهيماتوكسيلين ماير لمدة 1 دقيقة.
    11. غسل الشرائح مع دو.
    12. انتقل إلى يذوى وجبل الشرائح في الخطوة 2.6.
  6. الجفاف وتصاعد
    1. يذوى الشرائح عن طريق تحريكها بالتتابع من خلال 100 مل من 70٪، 80٪، 90٪، و 100٪ إتوه، 30 ثانية لكل منهما.
    2. تراجع الشرائح في تغييرين من الزيلين لمدة 1 دقيقة لكل منهما.
    3. إضافة 50 ميكرولتر من تصاعد حل ل كوفرسليبس ووضع الشرائح على القمة.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

في هذه الدراسة، ولدت لدينا الكريات تشوندروجيك من كبمك-هيبسس عن طريق حفز خلايا نمو من إبس. تم التسبب في التمايز غضروفية باستخدام كبمك-هيبسس مع ارتفاع القدرة على التحمل عالية 11 . ويرد مخطط بسيط للبروتوكول لدينا في الشكل 1A . قبل التمايز، تم توسيع المستعمرات إبسك ( الشكل 1B ). تم تجميع إيبسس موسعة كما إبس لبدء التمايز ( الشكل 1C ). تم إرفاق إبس ولدت إلى أطباق المغلفة الجيلاتين للحث على خلايا فاكهة ( الشكل 1D ). ثم، تم حصاد خلايا نمو وتستخدم لتوليد الكريات تشوندروجيك. بعد 21 يوما من التمايز، تم الحصول على صغيرة، حبة تشبه الكريات تشوندروجينيك وتستخدم لمزيد من توصيف ( الشكل 1E ). جودة تشون في المختبر ولدتتم تأكيد الكريات دروجينيك من خلال مختلف المقايسات.

نحن نسيجيا تقييم نوعية الكريات غضروفية في يوم 21. تم استخدام بمسك الكريات الغضروفية باعتبارها السيطرة الإيجابية. وتأكد من تراكم البروتينات إسم يفرزها غضروفية متباينة من قبل الأزرق ألسيان وتلويدين الأزرق تلطيخ في الشكل 2A . وازدادت الخصائص الرئيسية لغضروف صحي، مثل الثغرة وإنتاج بروتيوغليكان مع استمرار عملية التمايز أكثر من 21 يوما. الكريات تشوندروجينيك ولدت من كبمك-هيبسس أعرب COL2A1، وهو عنصر إسم الرئيسي في الغضروف صحية ( الشكل 2B ). كان التعبير COL2A1 من الكريات المشتقة من كبمك-هيبسك أعلى من الكريات المشتقة من بمسك. كان التعبير عن نوع الكولاجين I، علامة غضروف متليف، أقل في الكريات المشتقة كبمك-هيبسك بالمقارنة مع التعبير عن COL2A1. تم تأكيد التعبير الجيني من البروتينات الغضروف إسم في اليوم 21 الكريات تشوندروجينيك عن طريق ير في الوقت الحقيقي. وكان أغريكان (أكان) التعبير عن الكريات المشتقة كبمك-هيبسك مماثلة لتلك التي من الكريات المشتقة من بمسك ( الشكل 3A ). كان التعبير عن COL2A1 أعلى بكثير في الكريات المشتقة كبمك-هيبسك ( الشكل 3B ). كما تم تقييم التعبير عن المنطقة التي تحدد الجنس Y- مربع 9 (Sox9)، علامة السلف الغضروفية. الكريات ولدت من كبمك-هيبسس أعرب عن مستويات عالية من Sox9 ( الشكل 3C ). وأكدنا أن هذه الجينات كانت أوبريغولاتد بشكل كبير في كبك-هيبسك الكريات تشوندروجيك مقارنة بكريات التحكم بمسك في يوم 21. تم تقييم التعبير عن علامة الضخامي، COL1A1، ( الشكل 3D ). تم تخفيض التعبير عن COL1A1 في الكريات المشتقة من كبمك-هيبسك مقارنة مع في بمسك-ديريفيد الكريات. تم تحليل كفاءة التمايز بنسبة COL2A1 إلى COL1A1 ( الشكل 3E ). أظهرت الزيادة في نسبة في الكريات المشتقة من كبمك-هيبسك التعبير عالية نسبيا من COL2A1 مقارنة COL1A1. في الختام، لقد أكدنا قدرة التمايز غضروفية من كبمك-هيبسس. كانت نوعية الكريات المستمدة من كبمك-هيبسك المستمدة من نوعية متوافقة مع تلك من بمسك.

شكل 1
الشكل 1: التمايز غضروفية من هبسس. ( A ) مخطط توليد بيليه تشوندروجينيك من هيبسس. ( B ) مورفولوجيا ولدت كبمك-هيبسك. ( C ) مورفولوجيا من إبس ولدت. ( D ) خلايا نمو مستمدة من إبس تعلق على طبق الثقافة المغلفة الجيلاتين. ( E ) صورة t انه كوندروجينيك بيليه بعد 21 يوما من التمايز. وتظهر وحدات الفواصل بالملليمتر. مقياس الحانات = 200 ميكرون. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الشكل 2
الشكل 2: التحليل النسيجي للبيليه تشوندروجيك. ( A ) تقييم النسيجي من الكريات تشوندروجينيك في يوم 21 باستخدام ألسيان الأزرق والتلوين الأزرق تلطيخ. ( B ) صورة المناعية من الكريات تشوندروجينيك ملطخة COL1A1 و COL2A1 الأجسام المضادة. مقياس الحانات = 100 ميكرون. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

1 "> الشكل 3
الشكل 3: التعبير الجيني من بيليه تشوندروجينيك. ( A ) التعبير الجيني النسبية من أكان. ( ب ) التعبير الجيني النسبية من COL2A1. ( C ) التعبير الجيني النسبية من SOX9. ( D ) التعبير الجيني النسبية من COL1A1. ( E ) التعبير الجيني COL1A1. ( F ) التعبير الجيني من COL10A1. ( G ) نسبة COL2A1: COL1A1 التعبير الجيني. تم حصاد الكريات وتحليلها بعد 21 يوما من التمايز. تم الحصول على البيانات باستخدام ير في الوقت الحقيقي وعرضها على أنها متوسط ​​الخطأ القياسي من التجارب الثلاثية لكل عينة (ن = 3). تم تطبيع التعبير الجيني إلى غابد كرقابة داخلية. (* p <0.05، ** p <0.01، *** p <0.001).k "> الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

رقم الخلوي محصول خلية النمو بيليه العائد
hiPSCs 2 × 10 6 2-5 × 10 7 70-150
MSC 2 × 10 6 - 6

الجدول 1: مقارنة الغلة بين مسك و هيبس.

اسم الهدف اتجاه التمهيدي تسلسل بحجم
إلى الأمام TTCCGCGACGTGGACAT 77 بب
عكسي TCAAACTCGTTGACATCGAAGGT
ACAN إلى الأمام AGCCTGCGCTCCAATGACT 107 بب
عكسي TAATGGAACACGATGCCTTTCA
COL2A1 إلى الأمام GGCAATAGCAGGTTCACGTACA 79 ب
عكسي CGATAACAGTCTTGCCCCACTTA
COL1A1 إلى الأمام CCCCTGGAAAGAATGGAGATG 148 بب
عكسي TCCAAACCACTGAAACCTCTG

الجدول 2: تسلسل الاشعال ضد علامات غضروفية في الوقت الحقيقي ير.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

هذا البروتوكول ولدت بنجاح هيبسس من كبمس. نحن إعادة برمجة كبمكس ل هبسس باستخدام ناقلات الفيروسية سينداي التي تحتوي على عوامل ياماناكا 24 . تم استخدام ثلاث حالات في التمايز، وجميع التجارب ولدت بنجاح الكريات تشوندروجيك باستخدام هذا البروتوكول. وقد ذكرت العديد من الدراسات بروتوكولات للتمايز هيبس في غضروفية 25 ، 26 ، 27 ، 28 . ومع ذلك، هناك حاجة إلى مزيد من البحوث للتأكد من استخدام كبمك-هيبسس مرشح لتجديد الغضروف والانتعاش.

تم تأكيد تشوندروجينيسيس باستخدام هيبسس ولدت من مختلف أنواع الخلايا الجسدية 11 ، 25 ، 26 ، 27 ، 29 . وتظهر العديد من التقاريرأن أصل الخلية الجسدية المستخدمة في إعادة البرمجة يمكن أن يؤثر على نتائج التمايز لل هيبس 30 ، 31 ، 32 ، 33 . دم الحبل هو مصدر إثراء مع هسس و مسس. لا يوجد تقرير عن الفرق بين الخلايا المستمدة من الدم الحبل السري، مثل خلايا الدم أو اللجان الدائمة. ومع ذلك، فقد أظهرت الدراسات السابقة أن هيبسك المستقيمة المفصل غضروفي هي أكثر عرضة للذهاب من خلال غضروفية من هيبسس ولدت من دم الحبل السري أو الخلايا الليفية الجلد 29 . وأظهرت النتائج من التمايز البطانية باستخدام هيبسس ولدت من الخلايا الليفية والخلايا السلف القلب والخلايا البطانية أن الأنسجة من أصل يمكن أن تعكس الذاكرة الجسدية الأنسجة محددة في اشتقاق متباينة إيبسك، وخاصة في المقاطع المبكرة، بين 10 و 20 34 . في المقاطع الأولى من هيبس، البطانية الخلية ديريفيبس هيبس متباينة أكثر كفاءة في النسب البطانية. ومع ذلك، اختلفت الفرق الكبير بين خطوط الخلايا هذه في هيبس أكثر من 20 المقاطع. لذلك، من المهم أن ننظر بعناية في الذاكرة الجسدية التي تحملها هيبسس في المقاطع الأولى عندما يتم استخدامها في البحوث السريرية.

في الآونة الأخيرة، وقد وضعت إجراءات مختلفة لإصلاح الغضروف المفصلي المنشق. يتم ميكروفراكتور عن طريق حفر ثقوب متعددة في العظام للحث على تدفق نخاع العظام لإصلاح الطبيعية 35 . استبدال الركبة، المعروف أيضا باسم تقويم مفاصل الركبة، ويستخدم لتحل محل الغضروف التالفة. ومع ذلك، ميكروفراكتور ليست مفيدة لضرر المفاصل الغضروف الشديد، ويجب أن يتم تغيير الصك المستخدمة لاستبدال الركبة كل 10-15 سنة.

في هذه الأيام، العلاجات القائمة على الخلايا هي طريقة بديلة واعدة لإصلاح الغضاريف. زرع خلية غضروفي ذاتي (إسي) واسعلي المستخدمة لاستعادة الغضروف القائم على الخلية. يتم إسي عن طريق الحقن مباشرة غضروفية في عيب. ومع ذلك، تشوندروسيتس ذاتية تتحول إلى خلايا تشبه الخلايا الليفية تحت ظروف الزراعة في المختبر . ضرر إضافي هو أيضا لا مفر منه خلال عملية الحصاد من غضروفية ذاتي. وقد اقترح اللجان الدائمة كمصدر خلية لاستعادة الغضاريف. الدم الحبل هو مصدر خلية مفيدة ويمكن الوصول إليها من اللجان الدائمة لالغضروف الهندسة 36 . ومع ذلك، فإن معدل النجاح لعزل مسكات الدم الحبل السري، أمر مثير للجدل 37 ، 38 . العديد من الدراسات تقرير العزلة الناجحة من مسك الدم الحبل السري. وقد أظهرت العديد من الدراسات أن حجم الدم الحبل هو المعلمة الحرجة التي يمكن أن تؤثر على معدل العائد من العزلة مسك 36 ، 39 . للحصول على مسس ذات جودة عالية، مرور الخلايا أمر بالغ الأهمية أيضا. وتشير الدراسات السابقة ثاt مسس لها فترة حياة مقيدة بعد عدد انقسام خلية معينة. عن طريق إدخال الشيخوخة، وتتميز اللجان الدائمة عن طريق انخفاض الانتشار، كما هو الحال مع أي خلية جسدية طبيعية 40 . لذلك، يجب استخدام مسك مشتقة من الدم الحبل السري قبل مرور السادس لتجنب الشيخوخة الخلية والشذوذ الكروموسومات 41 .

لتجنب هذه القيود، فتحت إبس الإنسان إمكانية جديدة ل، العلاج القائم على الخلية شخصية مع إنتاجية عالية 11 . يمكن أن تتطور هبسس أنشئت نظريا دون حدود. أيضا، مع نفس الهوية المناعية كما المانحة، فإنها يمكن تجنب الرفض وانخفاض الآثار الجانبية عند زرعها في الجسم الحي . إن انتقال بنوك دم الحبل السري إلى بنوك هيبسك للعلاج الطبي الخيفي له إمكانيات هائلة وإمكانات 42 . ويمكن أن يؤدي فحص مرآز كبمك المتماثل متماثل ال هلا قبل إعادة البرمجة إلى استخدام خطوط إيبسك الخيفي ة على نطاق واسع فوr العلاج السريري. خطوط إيبسك متماثل يمكن تجنب ردود الفعل المناعية بعد زرع المغروسة. هذا المفهوم يمكن أيضا أن تطبق على تجديد الغضاريف من خلال توليد هلا-غضروف متماثل 11 .

عادة، يتم تنفيذ التمايز غضروفية من خلال اثنين من الخطوات الحاسمة: تحريض الخلايا المستمدة إب المستمدة وتكوين بيليه. التمايز الأولي من هبسس في خلايا النمو المستمدة من إب أمر بالغ الأهمية لزيادة إمكانات التمايز غضروفية. خلايا نمو متباينة من هيبسس هي وظيفيا وجزيئيا مشابهة لمسك الأصلية 7 ، 43 . الدراسات السابقة تستخدم ثقافة أحادي الطبقة أو ثقافة إب كخطوة ما قبل التمايز للحث على خلايا مثل الوسيطة 10 ، 43 . ومع ذلك، التمايز المباشر من قبل ثقافة أحادية الطبقة تستغرق وقتا طويلا بالمقارنة مع استخدام إبس، و تش الكريات أوندروجينيك تميل إلى التفريق في الغضروف الليفي مع الخصائص الضخامية. وأفيد أن مورفولوجيا الخلية وإمكانية التمايز تشوندروجيك من خلايا السلف مثل اللحمة المتوسطة تختلف اختلافا كبيرا وفقا لكثافة الخلية من أحادي الطبقة الخلية 9 .

استخدمنا إبس للحث على خلايا النمو، وهي طريقة سريعة وبسيطة نسبيا مقارنة مع ثقافة أحادي الطبقة. باستخدام هذا البروتوكول، كنا قادرين على توليد العديد من الكريات باستخدام عدد قليل نسبيا من هيبسس ( الجدول 1 ). كان حجم وعدد من إبس حاسمة لنجاح الإنتاج الشامل بيليه تشوندروجيك. لهذا السبب، قمنا بتوسيع إبس الكلي في المتوسط ​​E8، حتى أكثر من نصف إبس ولدت أكبر من 100 ميكرون. بعد إب التوسيع، حافظنا على إبس في E8 المتوسطة دون FGF2. في السابق، حافظ الباحثون على إبس ولدت دون FGF2 للسطح الحث الأديم المتوسطكريف "> 9.

على الرغم من أننا حاولنا الحفاظ على خلايا النمو ولدت في كثافة عالية للحصول على نوعية أفضل، لا تزال هناك العديد من القيود. في حين أكدنا أن الخلايا الناتجة ولدت تشترك مورفولوجيا مماثلة، قد تكون الخلايا لا تزال غير متجانسة. وقد حاولت دراسات سابقة لفرز لنوع معين من الخلايا. ومع ذلك، أدى هذا الإجراء في جمع عدد قليل من الخلايا. وهناك حاجة إلى محاولة جديدة لعزل خلايا النمو متجانسة على نطاق أوسع لتوليد كمية كبيرة من الكريات تشوندروجينيك مع خصائص محسنة.

مجموعات مختلفة تحفز الخلايا السلف من هيبس باستخدام ثقافة أحادي الطبقة أو إب. تحريض الخلايا السلف مع تشابه عالية ل مسس يمكن أن يكون المفتاح للحصول على الكريات تشوندروجينيك من أعلى جودة. هذه الخلايا السلف المستمدة من إبس لها خصائص مماثلة لتلك التي من اللجان الدائمة. ومع ذلك، قد يكون هذا بسببإر فيبروبلاستيك الطبيعة. لذلك، هناك حاجة إلى دراسة التحقق من صحة مفصلة على خلايا فاكهة.

في هذه الدراسة، نقترح بروتوكول يمكن أن تولد كمية كبيرة نسبيا من الكريات تشوندروجينيك. وأكدنا أن الغضروف تجديد باستخدام كبمك-هيبسس أظهرت النمط الظاهري صحي ويمكن استخدامها كمواد لتجديد الأنسجة. ومع ذلك، هناك حاجة إلى طريقة محسنة مع جدول زمني التمايز أقصر لمزيد من التطبيق. ويلزم أيضا مواصلة تطوير معايير مراقبة الجودة للتحقق من صحة الغضروف مع مستوى أعلى من هيالين للتطبيقات المستقبلية من كبمك-هيبسس كمادة الخلية لتجديد الغضاريف. بروتوكول بسيط لكنها فعالة ولا تتطلب أي عمليات فرز إضافية قبل تشكيل بيليه. في الختام، وباستخدام هذا البروتوكول، يمكن توليد كريات تشوندروجينيك عالية الجودة للدراسات عن النمذجة المرض، وفحص المخدرات، والطب التجديدي لزيادة فهمنا ل tهو طبيعة الغضروف.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

الكتاب ليس لديهم ما يكشف.

Acknowledgements

وأيد هذا العمل منحة من مشروع البحث والتطوير في مجال الرعاية الصحية الكورية، وزارة الصحة والرعاية الاجتماعية وشؤون الأسرة، جمهورية كوريا (HI16C2177).

Materials

Name Company Catalog Number Comments
Plasticware
100 mm Dish TPP 93100
6-well Plate TPP 92006
50 mL Cornical Tube SPL 50050
15 mL Cornical Tube SPL 50015
10 mL Disposable Pipette Falcon 7551
5 mL Disposable Pipette Falcon 7543
12-well Plate TPP 92012
Name Company Catalog Number Description
E8 Medium Materials
DMEM/F12, HEPES Life Technologies 11330-057 E8 Medium (500 mL)
Sodium Bicarbonate Life Technologies 25080-094 E8 Medium (Conc.: 543 μg/mL)
Sodium Selenite Sigma Aldrich S5261 E8 Medium  (Conc.: 14 ng/mL)
Human Transfferin Sigma Aldrich T3705 E8 Medium (Conc.: 10.7 μg/mL)
Basic FGF2 Peprotech 100-18B E8 Medium  (Conc.: 100 ng/mL)
Human Insulin Life Technologies 12585-014 E8 Medium (Conc.: 20 μg/mL)
Human TGFβ1 Peprotech 100-21 E8 Medium (Conc.: 2 ng/mL)
Ascorbic Acid Sigma Aldrich A8960 E8 Medium  (Conc.: 64 μg/mL)
DPBS Life Technologies 14190-144
Vitronectin Life Technologies A14700
ROCK Inhibitor Sigma Aldrich Y0503
Name Company Catalog Number Description
Quality Control Materials
18 mm Cover Glass Superior HSU-0111580
4% Paraformaldyhyde Tech & Innovation BPP-9004
Triton X-100 BIOSESANG 9002-93-1
Bovine Serum Albumin Vector Lab SP-5050
Anti-SSEA4 Antibody Millipore MAB4304
Anti-Oct4 Antibody Santa Cruz SC9081
Anti-TRA-1-60 Antibody Millipore MAB4360
Anti-Sox2 Antibody Biolegend 630801
Anti-TRA-1-81 Antibody Millipore MAB4381
Anti-Klf4 Antibody Abcam ab151733
Alexa Fluor 488 goat anti-mouse IgG (H+L) antibody Molecular Probe A11029
Alexa Fluor 594 goat anti-rabbit IgG (H+L) antibody Molecular Probe A11037
DAPI Molecular Probe D1306
Prolong gold antifade reagent Invitrogen P36934
4% Paraformaldyhyde Tech & Innovation BPP-9004
Tween 20 BIOSESANG T1027
Bovine Serum Albumin Vector Lab SP-5050
Anti-Collagen II antibody abcam  ab34712 1:100
Alcian blue Sigma Aldrich A3157-10G
Fast Green FCF Sigma Aldrich F7252-25G
Safranin O Sigma Aldrich 090m0039v
Nuclear fast red Americanmastertech STNFR100 
xylene Duksan 115 
Ethanol Duksan 64-17-5
Mayer's hematoxylin solution wako pure chemical industries LAK7534
DAP VECTOR LABORATORIES SK-4100
Slide Glass, Coated Hyun Il Lab-Mate HMA-S9914
Trizol Invitrogen 15596-018
Chloroform Sigma Aldrich 366919
Isoprypylalcohol Millipore 109634
Ethanol Duksan 64-17-5
RevertAid First Strand cDNA Synthesis kit Thermo Scientfic K1622
Name Company Catalog Number Description
Chondrogenic Differentiation Materials
DMEM Life Technologies 11885 Chondrogenic media component (500 mL)
Penicilin Streptomycin Life Technologies P4333 Chondrogenic media component (Conc.: 1%)
Ascorbic Acid Sigma Aldrich A8960 Chondrogenic media component (Conc.: 64 μg/mL) 
MEM Non-Essential Amino Acids Solution (100x) Life Technologies 11140-050 Chondrogenic media component (Conc.: 100 mM)
rhBMP-2 R&D 355-BM-050 Chondrogenic media component (Conc.:100 ng/ml)
Recombinant Hman TGF-beta3 R&D 243-B3-002 Chondrogenic media component (Conc.:10 ng/ml)
KnockOut Serum Replacement Life Technologies 10828-028 Chondrogenic media component (Conc.: 1%)
ITS+ Premix BD 354352 Chondrogenic media component (Conc.: 1%)
Dexamethasone-Water Soluble  Sigma Aldrich D2915-100MG Chondrogenic media component (Conc.:10-7 M)
GlutaMAX Supplement Life Technologies 35050-061 Chondrogenic media component (Conc.: 1%)
Sodium pyruvate solution Sigma Aldrich S8636 Chondrogenic media component (Conc.: 1%)
L-Proline Sigma Aldrich P5607-25G Chondrogenic media component (40 μg/ml)

DOWNLOAD MATERIALS LIST

References

  1. van Osch, G. J., et al. Cartilage repair: past and future--lessons for regenerative medicine. J Cell Mol Med. 13, (5), 792-810 (2009).
  2. Ahmed, T. A., Hincke, M. T. Strategies for articular cartilage lesion repair and functional restoration. Tissue Eng Part B Rev. 16, (3), 305-329 (2010).
  3. Diekman, B. O., et al. Cartilage tissue engineering using differentiated and purified induced pluripotent stem cells. Proc Natl Acad Sci USA. 109, (47), 19172-19177 (2012).
  4. Solchaga, L. A., Penick, K., Goldberg, V. M., Caplan, A. I., Welter, J. F. Fibroblast growth factor-2 enhances proliferation and delays loss of chondrogenic potential in human adult bone-marrow-derived mesenchymal stem cells. Tissue Eng Part A. 16, (3), 1009-1019 (2010).
  5. Guzzo, R. M., Drissi, H. Differentiation of Human Induced Pluripotent Stem Cells to Chondrocytes. Methods Mol Biol. 1340, 79-95 (2015).
  6. Drissi, H., Gibson, J. D., Guzzo, R. M., Xu, R. H. Derivation and Chondrogenic Commitment of Human Embryonic Stem Cell-Derived Mesenchymal Progenitors. Methods Mol Biol. 1340, 65-78 (2015).
  7. Nejadnik, H., et al. Improved approach for chondrogenic differentiation of human induced pluripotent stem cells. Stem Cell Rev. 11, (2), 242-253 (2015).
  8. Teramura, T., et al. Induction of mesenchymal progenitor cells with chondrogenic property from mouse-induced pluripotent stem cells. Cell Reprogram. 12, (3), 249-261 (2010).
  9. Koyama, N., et al. Human induced pluripotent stem cells differentiated into chondrogenic lineage via generation of mesenchymal progenitor cells. Stem Cells Dev. 22, (1), 102-113 (2013).
  10. Ko, J. Y., Kim, K. I., Park, S., Im, G. I. In vitro chondrogenesis and in vivo repair of osteochondral defect with human induced pluripotent stem cells. Biomaterials. 35, (11), 3571-3581 (2014).
  11. Nam, Y., Rim, Y. A., Jung, S. M., Ju, J. H. Cord blood cell-derived iPSCs as a new candidate for chondrogenic differentiation and cartilage regeneration. Stem Cell Res Ther. 8, (1), 16 (2017).
  12. Hotten, G. C., et al. Recombinant human growth/differentiation factor 5 stimulates mesenchyme aggregation and chondrogenesis responsible for the skeletal development of limbs. Growth Factors. 13, (1-2), 65-74 (1996).
  13. Murphy, M. K., Huey, D. J., Hu, J. C., Athanasiou, K. A. TGF-beta1, GDF-5, and BMP-2 stimulation induces chondrogenesis in expanded human articular chondrocytes and marrow-derived stromal cells. Stem Cells. 33, (3), 762-773 (2015).
  14. Shintani, N., Siebenrock, K. A., Hunziker, E. B. TGF-ss1 enhances the BMP-2-induced chondrogenesis of bovine synovial explants and arrests downstream differentiation at an early stage of hypertrophy. PLoS One. 8, (1), e53086 (2013).
  15. Fukumoto, T., et al. Combined effects of insulin-like growth factor-1 and transforming growth factor-beta1 on periosteal mesenchymal cells during chondrogenesis in vitro. Osteoarthritis Cartilage. 11, (1), 55-64 (2003).
  16. Worster, A. A., Nixon, A. J., Brower-Toland, B. D., Williams, J. Effect of transforming growth factor beta1 on chondrogenic differentiation of cultured equine mesenchymal stem cells. Am J Vet Res. 61, (9), 1003-1010 (2000).
  17. Knippenberg, M., et al. Differential effects of bone morphogenetic protein-2 and transforming growth factor-beta1 on gene expression of collagen-modifying enzymes in human adipose tissue-derived mesenchymal stem cells. Tissue Eng Part A. 15, (8), 2213-2225 (2009).
  18. Jang, Y., et al. Centrifugal gravity-induced BMP4 induces chondrogenic differentiation of adipose-derived stem cells via SOX9 upregulation. Stem Cell Res Ther. 7, (1), 184 (2016).
  19. Kang, R., et al. Mesenchymal stem cells derived from human induced pluripotent stem cells retain adequate osteogenicity and chondrogenicity but less adipogenicity. Stem Cell Res Ther. 6, 144 (2015).
  20. Tao, H., et al. Biological evaluation of human degenerated nucleus pulposus cells in functionalized self-assembling peptide nanofiber hydrogel scaffold. Tissue Eng Part A. 20, (11-12), 1621-1631 (2014).
  21. Sekiya, I., Larson, B. L., Vuoristo, J. T., Reger, R. L., Prockop, D. J. Comparison of effect of BMP-2, -4, and -6 on in vitro cartilage formation of human adult stem cells from bone marrow stroma. Cell Tissue Res. 320, (2), 269-276 (2005).
  22. Shen, B., Wei, A., Tao, H., Diwan, A. D., Ma, D. D. BMP-2 enhances TGF-beta3-mediated chondrogenic differentiation of human bone marrow multipotent mesenchymal stromal cells in alginate bead culture. Tissue Eng Part A. 15, (6), 1311-1320 (2009).
  23. Rim, Y. A., Nam, Y., Ju, J. H. Induced Pluripotent Stem Cell Generation from Blood Cells Using Sendai Virus and Centrifugation. J Vis Exp. (118), (2016).
  24. Kim, Y., et al. The Generation of Human Induced Pluripotent Stem Cells from Blood Cells: An Efficient Protocol Using Serial Plating of Reprogrammed Cells by Centrifugation. Stem Cells Int. 2016, 1329459 (2016).
  25. Oldershaw, R. A., et al. Directed differentiation of human embryonic stem cells toward chondrocytes. Nat Biotechnol. 28, (11), 1187-1194 (2010).
  26. Toh, W. S., et al. Differentiation and enrichment of expandable chondrogenic cells from human embryonic stem cells in vitro. J Cell Mol Med. 13, (9B), 3570-3590 (2009).
  27. Hwang, N. S., Varghese, S., Elisseeff, J. Derivation of chondrogenically-committed cells from human embryonic cells for cartilage tissue regeneration. PLoS One. 3, (6), e2498 (2008).
  28. Nakagawa, T., Lee, S. Y., Reddi, A. H. Induction of chondrogenesis from human embryonic stem cells without embryoid body formation by bone morphogenetic protein 7 and transforming growth factor beta1. Arthritis Rheum. 60, (12), 3686-3692 (2009).
  29. Guzzo, R. M., Scanlon, V., Sanjay, A., Xu, R. H., Drissi, H. Establishment of human cell type-specific iPS cells with enhanced chondrogenic potential. Stem Cell Rev. 10, (6), 820-829 (2014).
  30. Rim, Y. A., Park, N., Nam, Y., Ju, J. H. Generation of Induced-pluripotent Stem Cells Using Fibroblast-like Synoviocytes Isolated from Joints of Rheumatoid Arthritis Patients. J Vis Exp. (116), (2016).
  31. Pfaff, N., et al. Efficient hematopoietic redifferentiation of induced pluripotent stem cells derived from primitive murine bone marrow cells. Stem Cells Dev. 21, (5), 689-701 (2012).
  32. Xu, H., et al. Highly efficient derivation of ventricular cardiomyocytes from induced pluripotent stem cells with a distinct epigenetic signature. Cell Res. 22, (1), 142-154 (2012).
  33. Lee, S. B., et al. Contribution of hepatic lineage stage-specific donor memory to the differential potential of induced mouse pluripotent stem cells. Stem Cells. 30, (5), 997-1007 (2012).
  34. Hu, S., et al. Effects of cellular origin on differentiation of human induced pluripotent stem cell-derived endothelial cells. JCI Insight. 1, (8), 1-12 (2016).
  35. Vonk, L. A., de Windt, T. S., Slaper-Cortenbach, I. C., Saris, D. B. Autologous, allogeneic, induced pluripotent stem cell or a combination stem cell therapy? Where are we headed in cartilage repair and why: a concise review. Stem Cell Res Ther. 6, (94), 1-11 (2015).
  36. Gomez-Leduc, T., et al. Chondrogenic commitment of human umbilical cord blood-derived mesenchymal stem cells in collagen matrices for cartilage engineering. Sci Rep. 6, 32786 (2016).
  37. Mareschi, K., et al. Isolation of human mesenchymal stem cells: bone marrow versus umbilical cord blood. Haematologica. 86, (10), 1099-1100 (2001).
  38. Wexler, S. A., et al. Adult bone marrow is a rich source of human mesenchymal 'stem' cells but umbilical cord and mobilized adult blood are not. Br J Haematol. 121, (2), 368-374 (2003).
  39. Zhang, X., et al. Isolation and characterization of mesenchymal stem cells from human umbilical cord blood: reevaluation of critical factors for successful isolation and high ability to proliferate and differentiate to chondrocytes as compared to mesenchymal stem cells from bone marrow and adipose tissue. J Cell Biochem. 112, (4), 1206-1218 (2011).
  40. Wagner, W., et al. Replicative senescence of mesenchymal stem cells: a continuous and organized process. PLoS One. 3, (5), e2213 (2008).
  41. Tarte, K., et al. Clinical-grade production of human mesenchymal stromal cells: occurrence of aneuploidy without transformation. Blood. 115, (8), 1549-1553 (2010).
  42. Chen, W. C., et al. Prediction of poor survival by cyclooxygenase-2 in patients with T4 nasopharyngeal cancer treated by radiation therapy: clinical and in vitro studies. Head Neck. 27, (6), 503-512 (2005).
  43. Guzzo, R. M., Gibson, J., Xu, R. H., Lee, F. Y., Drissi, H. Efficient differentiation of human iPSC-derived mesenchymal stem cells to chondroprogenitor cells. J Cell Biochem. 114, (2), 480-490 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics