제대혈 유래 다 능성 줄기 세포로부터 연골 형성 펠렛 형성

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

여기, 우리는 제대혈 단핵 세포 유래 인간 유도 pluripotent 줄기 세포에서 연골 분화에 대한 프로토콜을 제안합니다.

Cite this Article

Copy Citation | Download Citations

Nam, Y., Rim, Y. A., Ju, J. H. Chondrogenic Pellet Formation from Cord Blood-derived Induced Pluripotent Stem Cells. J. Vis. Exp. (124), e55988, doi:10.3791/55988 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

인간 관절 연골 자체를 복구하는 능력이 부족합니다. 따라서 연골 퇴행은 치유 적 치료가 아니라 보존 적 치료로 치료됩니다. 현재, 생체 외 팽창 된 연골 세포 또는 골수 유래 중간 엽 줄기 세포 (BMSC)로 손상된 연골을 재생시키기위한 노력이 진행되고있다. 그러나, 이들 세포의 생존력 및 불안정성이 제한적이어서 연골 재건에 대한 적용이 제한적이다. 인간 유도 pluripotent 줄기 세포 (hiPSCs) 재생 응용 프로그램에 대한 새로운 대안으로 과학적 관심을 받았다. 무제한자가 재생 능력과 다 기능성을 가진 hiPSCs는 연골 수리를위한 새로운 대체 세포원으로 주목 받았다. 그러나 고품질의 연질 펠릿을 대량으로 얻는 것은 임상 적용에 중요한 과제입니다. 이 연구에서 우리는 연쇄상 구별을 위해 배아 체 (EB) 유래 증식 세포를 사용했다. 성공적인 연골 형성은 PCR 및알 시안 블루, 톨루이딘 블루, 콜라겐 타입 I 및 II에 대한 항체 (각각 COL1A1 및 COL2A1)로 염색 하였다. 우리는 제대혈 단핵 세포 유래 iPSCs (CBMC-hiPSCs)를 연골 알약으로 분화시키는 방법을 상세히 제시한다.

Introduction

hiPSC의 사용은 약물 스크리닝 및 다양한 질병에 대한 기계 론적 연구를위한 새로운 전략을 대표합니다. 재생산 관점에서, hiPSC는 또한 관절 연골 1,2 와 같은 치유력이 제한적인 손상된 조직의 대체를위한 잠재적 인 원천입니다.

네이티브 관절 연골의 재생은 수십 년 동안 도전 과제였습니다. 관절 연골은 부드럽고 하얀 조직으로 뼈의 끝 부분을 덮어 마찰로부터 보호합니다. 그러나 손상시 재생 능력이 제한되어있어자가 수리가 거의 불가능합니다. 따라서 연골 재생에 초점을 맞춘 연구가 수십 년 동안 진행되어왔다.

이전에, 연골 세포 계통으로의 시험 관내 분화는 보통 무릎 관절로부터 분리 된 BMSC 또는 천연 연골 세포로 수행되었다. 원인o 연골 세포의 잠재력, BMSC 및 천연 연골 세포는 연골 형성에서의 사용을 지원하는 많은 장점을 가지고있다. 그러나, 제한된 팽창 및 불안정한 표현형 때문에, 이들 세포는 관절 연골 결손의 재건에 몇 가지 한계점에 직면한다. 시험 관내 배양 조건 하에서,이 세포들은 3-4 계대 후 자신의 특성을 잃어 버리는 경향이 있으며, 결과적으로 분화 능력에 영향을 미친다. 또한, 천연 연골 세포의 경우, 이들 세포를 수득 할 때 무릎 관절에 부가적인 손상이 불가피하다.

BMSC 또는 천연 연골 세포와는 달리, hiPSC 는 시험 관내에서 무한히 확장 될 수있다. 적절한 배양 조건에서, hiPSC는 연골 분화의 대체 원으로서의 큰 가능성을 가지고있다. 그러나 hiPSCs 5 의 본질적인 특성을 변경하는 것은 어렵습니다. 또한, 그것은 몇 가지 복잡한 in vitro steps는 특정 세포 유형으로 hiPSCs의 운명을 지시합니다. 이러한 합병증에도 불구하고, 높은 자체 재생 능력과 chondrocytes 6 을 포함하여 표적화 된 세포로 분화 할 수있는 능력 때문에 hiPSCs의 사용이 권장됩니다.

연골 세포 분화는 일반적으로 펠렛 배양 또는 마이크로 럼 배양과 같은 3 차원 배양 시스템을 사용하여 MSC 유사 전구 세포를 사용하여 수행됩니다. hiPSCs를 사용하는 경우 MSC 유사 전구 세포를 생성하는 프로토콜은 기존 프로토콜과 다릅니다. 일부 그룹에서는 표현형을 MSC 유사 세포로 직접 변환하기 위해 hiPSC의 단일 층 배양액을 사용합니다. 그러나 대부분의 연구에서는 EBs를 사용하여 MSCs 8 , 9 , 10 , 11 과 유사한 세포를 생성합니다.

다양한 형태의 성장 인자가 chondroge 유도에 사용됩니다.네 시스. 일반적으로, BMP 및 TGFβ 계열 단백질은 단독으로 또는 조합하여 사용됩니다. GDF5, FGF2, IGF1 12,13,14,15와 같은 다른 인자들도 분화가 유도되었다. TGFβ1은 MSCs 16 에서 용량 의존적으로 연골 형성을 자극하는 것으로 나타났다. 다른 isotype, TGFβ3와 비교하여, TGFβ1은 연골 전엽 간질 농축을 증가시킴으로써 연골 형성을 유도한다. TGFβ3은 간엽 세포 증식을 유의 적으로 증가시킴으로써 연골 형성을 유도한다. 그러나 TGFβ3은 TGFβ1 7 , 10 , 18 , 19 보다 연구자들에 더 자주 사용된다. BMP2는 인간의 연골 기질 성분과 관련된 유전자 발현을 증가시킨다체외 조건 하에서 관절 연골 세포 20 . BMP2는 TGFβ 단백질 21 과 함께 MSCs에서 연골 형성에 중요한 유전자의 발현을 증가시킵니다. 또한 BMP2가 Smad와 MAPK 경로를 통해 TGFβ3의 효과를 상승적으로 향상 시킨다는 것이 밝혀졌다.

이 연구에서, CBMC-hiPSCs는 낮은 부착 배양 접시에서 EB 배지를 사용하여 EB로 응집되었다. EBs를 젤라틴 코팅 접시에 부착시킴으로써 외생 세포를 유도 하였다. outgrowth 세포를 이용한 연골 세포 분화는 pellet 배양으로 수행 하였다. BMP2와 TGFβ3 모두의 치료는 성공적으로 연축 성 펠렛 형성을 위해 세포를 응축시키고 세포 외 기질 (ECM) 단백질 축적을 유도했다. 이 연구는 CBMC-hiPSCs를 사용하여 간단하지만 효율적인 연골 세포 분화 프로토콜을 제안합니다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

이 프로토콜은 한국 가톨릭 대학교의 기관 검토위원회 (KC12TISI0861)의 승인을 받았습니다. 리 프로그래밍에 사용 된 CBMC는 서울 성모 병원의 코드 혈액 은행에서 직접 입수했습니다.

1. iPSC와의 연동 분화

  1. CBMC-iPSC 세대
    1. 이전 연구에서 보여준 프로토콜을 사용하여 CBMC-hiPSCs를 생성하십시오.
    2. 혈액 세포를 15 ML 원뿔 튜브에 수집하고 hemocytometer를 사용하여 그들을 계산합니다.
    3. 3 x 10 5 세포를 준비하고 515 xg 및 RT에서 5 분간 원심 분리하십시오. 흡인으로 상등액을 버리고 혈액 세포 매체 0.5 ML에 세포를 resuspend.
    4. 세포를 비 코팅 24- 웰 플레이트의 웰에 옮기고 제조자의 권고에 따라 센다이 바이러스 혼합물을 첨가한다.
    5. 1,150 xg 및 30 ° C에서 30 분 동안 플레이트를 원심 분리하십시오.
    6. 후미원심 분리기, 37 ° C에서 5 % CO 2 에서 밤새 세포를 배양하십시오.
    7. 다음날, 형질 도입 된 세포를 매트릭스로 코팅 된 웰로 옮긴다. 30 ℃에서 30 분 동안 1,150 xg에서 플레이트를 원심 분리하십시오.
    8. 원심 분리 후, 상등액을 제거하고, iPSC 배지 1 mL를 첨가하고, 37 ℃에서 5 % CO2에서 세포 O / N을 유지한다.
    9. 첨부 된 세포를 37 ° C 및 5 % CO 2 에서 유지하십시오. 매일 매체를 교체하고 신선한 iPSC 매체로 교체하십시오.
      참고 : 식민지는 형질 도입 후 14-21 일에 나타납니다.
  2. EB 세대
    1. 37 ° C와 5 % CO 2 에서 hiPSC를 유지하십시오. 매일 매체를 교체하여 신선한 Essential 8 (E8) 매체로 교체하십시오.
    2. E8 배지에서 vitronectin 코팅, 100mm 접시에 2 x 10 6 hiPSCs를 준비합니다.
    3. 배양 접시에서 E8 매체를 제거하고 멸균 인산 버퍼 식염수 (PBS)로 씻으십시오.
    4. 1 추가mL의 1 mM ethylenediaminetetraacetic acid (EDTA)에 넣고 2 분 동안 37 ° C 및 5 % CO 2 에서 배양한다.
    5. 세포를 E8 배지 3 mL로 수확하고 새로운 15-mL 원뿔 튜브로 옮긴다. 2 분 동안 실온 (RT)에서 250 XG에서 세포를 원심 분리기.
    6. 세포 펠렛을 방해하지 않고 뜨는을 대기음 E8 매체 5 ML에있는 세포를 resuspend.
    7. hemocytometer를 사용하여 셀을 계산하고 각 100mm 페트리 접시 2 X 10 6 세포를 준비합니다. 10 μM ρ 관련 키나제 (록) 억제제와 E8 및 EB 매체 (1 : 1)의 10 ML 혼합물에 준비 세포를 Resuspend.
    8. 37 ° C와 5 % CO 2 에서 응집에 대한 세포 O / N를 품어.
    9. 다음 날, pipetting하여 집계 된 EB를 수확합니다. 1 분 250 XG에서 세포를 원심 분리기. 뜨는를 제거하고 10 ML의 신선한 E8 매체에 EBs를 resuspend.
    10. 생성 된 EB를 5 일 동안 확대하여 일일 변경을 fres로 수행합니다.h E8 배지. 더 성숙을 위해, E7 매체로 문화 매체를 변경합니다. 새 E7 배지로 매일 중간 배지를 수행하여 37 ℃ 및 5 % CO2에서 EB를 5 일 동안 유지한다.
      참고 : E7 배지는 FGF2가없는 E8 배지입니다.
  3. EBs로부터의 증식 세포 유도
    1. 100 mm 접시에 1 % 젤라틴 6 ML을 추가하고 37에서 품어 ° C와 30 분 5 % CO 2 .
    2. 사용하기 전에 젤라틴을 제거하고 2-3 시간 동안 완전히 건조시킵니다.
    3. EB를 50 mL 원뿔 튜브로 옮긴다. EB가 원추형 튜브의 바닥에 고정되도록하십시오. EB를 방해하지 않고 뜨는 제거.
    4. 20 % 태아 소 혈청 (FBS)과 Dulbecco의 수정 이글의 매체 (DMEM) 10 ML에 EBs Resuspend. EB를 젤라틴 코팅 100mm 접시에 옮깁니다. 10 μM ROCK 억제제를 첨가하십시오.
    5. 37 ° C 및 5 % CO 2 에서 7 일 동안 세포를 인큐베이션하고 유지한다. 나를 바꾸어 라.ROCK 억제제를 첨가하지 않고 매일 격렬히 닦으십시오.
  4. 연골 형성 펠릿 형성
    1. 접시에서 문화 매체를 대기음과 PBS로 세 번 세포를 씻으십시오.
    2. 1 MM EDTA 1 ML을 적용하고 2 분 37 ° C와 5 % CO 2 에서 품어.
    3. 20 % FBS와 DMEM 5 ML을 사용하여 세포를 수확하고 새로운 15 ML 원뿔 튜브로 전송.
    4. 250 XG와 RT에서 2 분 동안 세포를 원심 분리기. 뜨는을 버리고 20 % FBS와 DMEM 10 ML에 펠렛을 resuspend.
    5. 40 μm 셀 스트레이너를 사용하여 셀 덩어리를 걸러 내고 버리고 단일 세포를 수거하십시오. hemocytometer를 사용하여 단일 세포를 센다.
    6. 250 XG와 RT에서 2 분 동안 세포를 원심 분리기. chondrogenic 차별화 매체 (CDM) 300 μL와 15 ML 원추형 튜브에 펠렛 당 상등 및 종자 3 X 10 5 세포를 제거합니다.
    7. 펠렛 형성을 위해 5 분 동안 세포를 원심 분리하십시오.680 xg 및 RT.
      참고 : 펠렛은 연골 펠렛의 분화 동안 15 ML 원뿔 튜브에서 유지됩니다.
    8. 37 밤새 세포를 품어 ° C 5 % CO 2 .
    9. 2-3 일마다 CDM을 변경하십시오. 3 일 이내에, 펠렛은 평평하고 회전 타원체 형태를 나타낼 것이다. 37 ° C 및 5 % CO 2 에서 21 일 동안 알약을 유지하십시오.

2. 염색에 의한 연골 형성 펠렛 특성

  1. 연골 형성 매립
    1. 묻기 전에 58 ° C에서 파라핀을 준비하고 녹여주십시오.
    2. 1.5 ML 튜브에서 RT에서 2 H 4 % paraformaldehyde의 1 ML에 알약을 수정.
      주의 : 파라 포름 알데히드는 매우 독성이 있습니다. 눈, 피부 또는 점막과의 접촉을 피하십시오. 그것을 준비하는 동안 노출을 최소화하고 흡입을 피하십시오.
    3. 카세트에 거즈 한 층을 놓고 피펫을 사용하여 고정 된 알약을 옮깁니다. 접을 때 펠렛을 덮는다.e 거즈를 잡고 카세트 뚜껑을 닫으십시오.
    4. 70 % 에탄올 (EtOH) 100 mL에서 탈수를 2 회, 각각 10 분간 개시한다. 80 % 및 95 % EtOH에서 순차적 10 분 세척을 통해 펠렛을 탈수시킨다.
    5. 펠렛을 10 분 동안 100 % EtOH로 옮긴다. 신선한 EtOH로 3 회 반복한다.
    6. "제거"를 위해 용액을 EtOH와 크실렌의 100 mL, 1 : 1 혼합물에 교환 한 후 EtOH와 크실렌의 1 : 2 혼합물을 각각 10 분 동안 교환하십시오. 펠릿을 100 % 크실렌 (각 10 분)에 두 번 배양하여 남은 EtOH를 제거합니다.
    7. 파라핀 침투 들어, 연속 자일 렌과 파라핀 혼합물에 알약을 품어. 58 ° C에서 전체 파라핀 침투 과정을 수행하십시오. 쥐똥을 자일 렌과 파라핀의 2 : 1 혼합물 100mL에 30 분 동안 품어 둔다.
    8. 100 mL의 크실렌과 파라핀의 1 : 1 혼합물에 대한 용액을 교환하고 30 분 동안 항온 처리한다.
    9. 자일 렌과 파라핀의 1 : 2 혼합물 100mL에 대한 용액을 교환하고 30 분.
    10. 최종 침투 들어, 펠렛을 100 % 파라핀의 첫 목욕에 전송하고 2 시간 품어.
    11. 펠렛을 100 % 파라핀의 두 번째 목욕에 옮기고 58 ° C에서 O / N을 배양합니다.
    12. 다음날, 족집게를 사용하여 펠릿을 몰드에 부드럽게 옮긴다. 파라핀 디스펜서에서 파라핀을 몰드에 첨가하십시오. 4 ° C에서 30 분 동안 파라핀을 고형화하십시오.
    13. 섹션을 7 μm로 슬라이스하고 섹션을 슬라이드로 옮깁니다. 슬라이드를 하룻밤 건조시키고 사용 준비가 될 때까지 실온에서 슬라이드를 보관하십시오.
  2. 슬라이드 준비
    1. 100 %, 90 %, 80 % 및 70 % EtOH를 각각 5 분 동안 순차적으로 이동시켜 슬라이드를 탈 파라핀 화시킵니다.
    2. 유리 항아리에 슬라이드를 놓고 5 분 동안 수돗물로 헹굽니다.
  3. 알 시안 블루 염색
    1. 30 분 동안 1 % alcian 블루 솔루션 50 ML에 슬라이드를 품어.
      아니E : 알 시안 블루를 3 % 아세트산 용액으로 희석한다. 아세트산을 사용하여 pH를 2.5로 조정한다.
    2. 슬라이드를 유리 병에 넣고 2 분 동안 수돗물로 헹굽니다.
    3. 탈 이온수 (DW)에서 슬라이드를 헹구고 2 분 동안 핵 고속 적색 용액으로 대조 염색합니다.
    4. 유리 병에 슬라이드를 놓고 1 분 동안 수돗물로 헹굽니다.
    5. 2.3.5) 단계 2.6에서 슬라이드를 탈수 및 마운트합니다.
  4. 톨루이딘 블루 염색
    1. 슬라이드를 50 mL의 톨루이딘 블루 용액에서 4 분 동안 인큐베이션한다.
    2. 유리 항아리에 슬라이드를 놓고 5 분 동안 수돗물로 헹굽니다.
    3. 단계 2.6에서 슬라이드를 탈수 및 마운트하십시오.
  5. 면역 조직 화학 염색
    1. 내생 peroxidase 차단을 위해 15 분 동안 3 % H 2 O 2 에서 슬라이드를 품어.
    2. 트리스 부에 1 : 100 희석 한 1 차 항체 (anti-COL1A1과 -COL2A1) 200 μL를가한다.슬라이드에 1 % 소 혈청 알부민 (BSA)과 정상 염소 혈청 (NGS) 5 %를 함유 한 생리 식염수 (TBS)를 접종하고 4 ℃에서 O / N을 배양한다.
    3. 다음날, 슬라이드를 유리 병에 넣고 0.1 % 폴리 소르 베이트 20 (TBST)이 함유 된 TBS 50 mL로 5 분씩 각각 3 회 씻어냅니다.
    4. 2 차 항체 (염소 항 토끼 IgG 항체 200 μL를 1 % BSA 및 5 % NGS를 포함하는 TBS에서 1 : 200으로 희석)를 슬라이드에 가하고 40 분 동안 실온에서 배양한다.
    5. 유리 항아리에 슬라이드를 놓고 각각 5 분 50 ML 3 번 그들을 씻으십시오.
    6. 신호 증폭 들어, 슬라이드에 HRP - 복합 streptavidin 솔루션을 적용하고 10 분 동안 품어.
    7. 유리 항아리에 슬라이드를 놓고 각각 5 분 50 ML 3 번 그들을 씻으십시오.
    8. DAB - peroxidase 기판 솔루션을 섞어 각 슬라이드에 솔루션의 200 μL를 적용하고 1 분 동안 품어.
    9. 유리 항아리에 슬라이드를 놓고 5 분 동안 수돗물로 헹굽니다.
    10. 대항균Mayer의 hematoxylin과 1 분간 접촉시켰다.
    11. DW로 슬라이드를 씻으십시오.
    12. 단계 2.6에서 슬라이드를 탈수 및 마운트하십시오.
  6. 탈수 및 장착
    1. 슬라이드를 70 %, 80 %, 90 % 및 100 % EtOH (각각 30 초) 100mL를 통해 순차적으로 이동시켜 탈수합니다.
    2. 슬라이드를 각각 1 분 동안 두 번의 크실렌 변화로 담그십시오.
    3. coverslips에 장착 솔루션 50 μL를 추가하고 상단에 슬라이드를 놓으십시오.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

이 연구에서, 우리는 EBs에서 번식 세포를 유도하여 CBMC - hiPSCs에서 연골 펠렛을 생성했습니다. 연골 형성 분화는 CBMC-hiPSCs를 사용하여 유도되었다. 우리의 프로토콜의 간단한 구성이 그림 1A나와 있습니다. 분화하기 전에 iPSC 콜로니가 확장되었습니다 ( 그림 1B ). 확장 된 iPSCs는 EB로 분화를 시작하기 위해 조립되었습니다 ( 그림 1C ). 생성 된 EBs는 젤라틴 코팅 접시에 첨부되어 ( 그림 1D ) outgrowth 세포를 유도했다. 그런 다음, 성장 세포를 수확하여 연골 성 펠릿을 생성시켰다. 분화 21 일 후 작고 구슬 모양의 연골 형성 펠렛을 얻어 더 특성화를 위해 사용 하였다 ( 그림 1E ). 체외에서 생성 된 촌의 품질drogenic 펠렛은 다양한 assays를 통해 확인되었습니다.

우리는 21 일째 chondrogenic pellets의 품질을 조직 학적으로 평가했다. BMSC 연골 형성 펠릿을 양성 대조군으로 사용했다. 분화 된 연골 세포에 의해 분비 된 ECM 단백질의 축적은 도 2A 에서 알 시안 블루 및 톨루이딘 블루 염색에 의해 확인되었다. lacuna 및 proteoglycan 생산과 같은 건강한 연골의 주요 특징은 분화 과정이 21 일 이상 지속됨에 따라 증가했습니다. CBMC-hiPSC에서 생성 된 연골 형성 펠렛은 건강한 연골에서 주요한 ECM 성분 인 COL2A1을 발현한다 ( 그림 2B ). CBMC-hiPSC- 유도 펠릿의 COL2A1 발현은 BMSC- 유도 쥐보다 높았다. fibrotic 연골에 대한 표지자 인 I 형 콜라겐의 발현은 COL2A1의 발현에 비해 CBMC-hiPSC- 유도 쥐에서 더 낮았다. 21 일 연골 성 펠렛에서 연골 ECM 단백질의 유전자 발현은 실시간 PCR에 의해 확인되었다. CBMC-hiPSC- 유래 쥐똥의 aggrecan (ACAN) 발현은 BMSC- 유래 쥐똥과 유사했다 ( 그림 3A ). COL2A1의 발현은 CBMC-hiPSC- 유도 된 펠렛에서 상당히 더 높았다 ( 도 3B ). 연골 형성 전구체 마커 인 성 결정 부위 Y-box 9 (Sox9)의 발현도 평가되었다. CBMC-hiPSCs에서 생성 된 펠렛은 높은 수준의 Sox9를 발현했다 ( 그림 3C ). 우리는이 유전자가 CBMC-hiPSC 연골 형성 펠릿에서 21 일째 BMSC 대조 펠렛에 비해 유의하게 증가되었음을 확인했다. 비대칭 마커 인 COL1A1의 발현을 평가했다 ( 그림 3D ). CBMC-hiPSC 유래 쥐똥개에서 COL1A1의 발현은 BMSC-deri에서의 발현과 비교하여 감소되었다알약. 분화 효율은 COL2A1 대 COL1A1의 비율로 분석 하였다 ( 도 3E ). CBMC-hiPSC- 유래 쥐똥에서의 비율의 증가는 COL1A1과 비교하여 COL2A1의 상대적으로 높은 발현을 입증 하였다. 결론적으로, 우리는 CBMC-hiPSCs의 연골 분화능을 확인했다. 생성 된 CBMC-hiPSC 유래 연골 형성 펠릿의 품질은 BMSC의 품질과 양립 할 수 있었다.

그림 1
그림 1 : hiPSC의 연골 분화. ( A ) hiPSCs에서 chondrogenic 펠렛 생성의 계획. ( B ) 생성 된 CBMC-hiPSC의 형태. ( C ) 생성 된 EB의 형태. ( D ) 젤라틴 코팅 배양 접시에 부착 된 EB로부터 유래 된 외생 세포. ( E ) 이미지 t 그는 분화 21 일 후에 연골 펠릿을 만든다. 간격 단위는 밀리미터 단위로 표시됩니다. 스케일 바 = 200 μm. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 2
그림 2 : 연골 형성 펠렛의 조직 학적 분석. ( A ) 알칸 블루와 톨루이딘 블루 염색을 사용하여 21 일에 연골 펠릿의 조직 학적 평가. ( B ) COL1A1 및 COL2A1 항체로 염색 한 연골 성 펠렛의 면역 조직 화학적 이미지. 스케일 바 = 100 μm. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

1 "> 그림 3
그림 3 : 연골 형성 펠렛의 유전자 발현. ( A ) ACAN의 상대적인 유전자 발현. ( B ) COL2A1의 상대적인 유전자 발현. ( C ) SOX9의 상대 유전자 발현. ( D ) COL1A1의 상대적인 유전자 발현. ( E ) COL1A1의 유전자 발현. ( F ) COL10A1의 유전자 발현. ( G ) COL2A1 : COL1A1 유전자 발현의 비율. 분화 21 일 후에 펠렛을 수확하고 분석 하였다. 실시간 PCR을 사용하여 데이터를 얻었고 샘플 당 3 회의 실험의 평균 표준 오차로 표시 하였다 (n = 3). 유전자 발현은 내부 통제로서 GAPDH로 정상화되었다. (* p <0.05, ** p <0.01, *** p <0.001).k ">이 그림의 확대 버전을 보려면 여기를 클릭하십시오.

세포 수 외생 세포 수율 펠렛 생산량
hiPSCs 2 x 10 6 2-5 x 10 7 70 ~ 150
MSC 2 x 10 6 - 6

표 1 : MSC와 hiPSCs의 수율 비교.

대상 이름 방향 프라이머 서열 크기
앞으로 TTCCGCGACGTGGACAT 77bp
TCAAACTCGTTGACATCGAAGGT
앞으로 AGCCTGCGCTCCAATGACT 107bp
TAATGGAACACGATGCCTTTCA
COL2A1 앞으로 GGCAATAGCAGGTTCACGTACA 79 bp
CGATAACAGTCTTGCCCCACTTA
COL1A1 앞으로 CCCCTGGAAAGAATGGAGATG 148bp
TCCAAACCACTGAAACCTCTG

표 2 : 실시간 PCR에서 연골 성 마커에 대한 프라이머의 서열.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

이 프로토콜은 CBMC로부터 hiPSCs를 성공적으로 생성했습니다. 야마나카 요인을 포함하는 센다이 바이러스 벡터를 사용하여 CBMCs를 hiPSCs로 재 프로그램 화했다. 세 가지 경우가 분화에 사용되었으며, 모든 실험은 성공적으로이 프로토콜을 사용하여 연골 펠릿을 생성했습니다. 많은 연구에 의해 hiPSC가 연골 세포로 분화되는 프로토콜이보고되었다 25 , 26 , 27 , 28 . 그러나 CBMC-hiPSCs의 연골 재생 및 회복 후보 물질의 사용을 확인하기 위해서는 추가 연구가 필요하다.

연골 형성은 다양한 체세포 유형 11 , 25 , 26 , 27 , 29 로부터 생성 된 hiPSCs를 사용하여 확인되었다. 많은 보고서에서재 프로그래밍에 사용 된 체세포의 기원이 hiPSCs 30 , 31 , 32 , 33 의 분화 결과에 영향을 미칠 수 있음을 밝힙니다. 코드 혈액은 조혈 모세포와 MSC가 풍부한 공급원입니다. 혈액 세포 또는 MSC와 같은 제대혈 유래 세포의 차이에 대한 보고서는 없습니다. 그러나 이전 연구에서는 관절 연골 세포 유래 hiPSC가 제대혈 또는 피부 섬유 아세포에서 생성 된 hiPSC보다 연골 형성을 일으킬 가능성이 높다는 것을 보여 주었다. 섬유 아세포, 심장 선조 세포 및 내피 세포에서 생성 된 hiPSCs를 사용한 내피 세포 분화의 결과는 조직의 기원이 최종 분화 된 iPSC 유도에서 조직 특이성 체세포 기억을 반영 할 수 있음을 보여 주었으며, 특히 초기 계대에서 10에서 20 사이에서 나타났다. hiPSCs의 초기 단계에서, 내피 세포 - derived hiPSCs는 내피 계통으로 더 효율적으로 분화되었다. 그러나, 20 계대 이상의 hiPSCs에서 이들 세포주 사이의 유의 한 차이는 사라졌다. 그러므로 임상 연구에 사용되는 초기 단계에서 hiPSC가 가지고있는 체세포 기억을주의 깊게 고려하는 것이 중요합니다.

최근, 결손 된 관절 연골을 치료하기위한 다양한 방법이 개발되고있다. 미세 붕괴는 뼈에 여러 개의 구멍을 뚫어 자연 복구를위한 골수 유입을 유도합니다 35 . 슬관절 치환술 (knee arthroplasty)은 손상된 연골을 대체하기 위해 사용됩니다. 그러나 미세 골절은 심한 관절 연골 손상에 유용하지 않으며 무릎 보철에 사용되는기구는 10-15 년마다 교체해야합니다.

오늘날 세포 기반 치료법은 연골 치료를위한 유망한 대체 방법입니다. 자가 연골 세포 이식 (ACI)이 넓다.세포 기반 연골 회복에 사용됩니다. ACI는자가 연골 세포를 결함에 직접 주사하여 이루어집니다. 그러나,자가 연골 세포 는 시험 관내 배양 조건 하에서 섬유 아세포 유사 세포로 변한다. 추가 손상은 또한자가 연골 세포의 수확 과정 중에 불가피합니다. MSC는 연골 회복을위한 세포 공급원으로 제안되었습니다. 코드 혈액은 연골 연축을위한 MSC의 유용하고 접근 가능한 세포 공급원입니다. 그러나 탯줄 혈액 MSC를 격리시키는 성공률은 논란의 여지가있다. 수많은 연구가 탯줄 혈관 내 MSC의 성공적인 분리를보고합니다. 여러 연구에 따르면 제대혈 용량은 MSC 분리율에 영향을 줄 수있는 중요한 매개 변수입니다 36 , 39 . 고품질의 MSC를 얻기 위해서는 세포의 통과 또한 중요합니다. 이전 학문은 tha를 나타낸다MSC는 특정 세포 분열 번호 후에 수명이 제한됩니다. 노화로 들어감에 따라 MSC는 정상적인 체세포와 마찬가지로 증식이 감소한다는 특징이 있습니다 40 . 그러므로 세포 분화와 염색체 이상을 피하기 위해 6 차 통과 전에 탯줄 혈액 유래 MSC를 사용해야한다.

이러한 한계를 피하기 위해 인간 iPSCs는 높은 생산성으로 개인화 된 세포 기반 치료를위한 새로운 가능성을 열었습니다. 설립 된 hiPSCs는 이론적으로 무한히 확산 될 수 있습니다. 또한 기증자와 동일한 면역 성질을 지니고 있어 생체 내 이식 시 거부 반응과 부작용을 줄일 수 있습니다. 동종 요법 치료를위한 제대혈 은행의 hiPSC 은행으로의 이전은 엄청난 가능성과 잠재력을 가지고 있습니다. 재 프로그램하기 전에 동형 접합체 인 HLA 형 CBMC를 스크리닝하면 동종 이성질체의 iPSC 라인 fo임상 치료. Homozygous iPSC 라인은 동종 이식 후 면역 반응을 피할 수 있습니다. 이 개념은 또한 HLA- 동형 접합 연골 ( homozygous cartilage ) 11을 생성함으로써 연골 재생에 적용될 수있다.

일반적으로, 연쇄상 구별은 두 가지 중요한 단계를 통해 수행됩니다 : EB 유도 파생 세포의 유도 및 펠렛 형성. EB 유도 파생 세포로의 hiPSCs의 초기 분화는 연골 분화 잠재력을 증가시키는 데 중요합니다. hiPSCs로부터 분화 된 증식 세포는 천연 BMSCs 7 , 43 과 기능적 및 분자 적으로 유사하다. 이전 연구에서는 단엽 배양 또는 EB 배양을 중간 엽 줄기 세포를 유도하기위한 예비 분화 단계로 사용했습니다 10 , 43 . 그러나, 단층 배양에 의한 직접적인 분화는 EB의 사용에 비해 시간 소모적이며, ch ondrogenic 펠릿은 비대화 특성과 fibrocartilage로 차별하는 경향이 있습니다. 생성 된 중간 엽 줄기 세포의 세포 형태와 연골 세포 분화능은 세포 단층의 세포 밀도에 따라 크게 차이가 나는 것으로보고되었다.

우리는 단층 세포 배양과 비교하여 상대적으로 빠르고 간단한 방법 인 증식 세포를 유도하기 위해 EB를 사용했다. 이 프로토콜을 사용하여 비교적 적은 수의 hiPSC를 사용하여 많은 펠렛을 생성 할 수있었습니다 ( 표 1 ). EB의 크기와 개수는 성공적인 연골 펠렛 대량 생산에 중요했습니다. 그 이유 때문에, 우리는 생성 된 EB의 절반 이상이 100μm보다 커질 때까지 E8 배지에서 응집 된 EB를 확대시켰다. EB 확대 후 우리는 FGF2없이 E8 배지에서 EB를 유지했다. 이전 연구자들은 중배엽 계통 유도를 위해 FGF2가없는 생성 된 EB를 유지했다.xref "> 9.

생성 된 증식 세포를 고밀도로 유지하여 더 나은 품질을 유지하려고 시도했지만 몇 가지 한계점이 여전히 남아 있습니다. 생성 된 증식 세포가 유사한 형태를 공유한다는 것을 확인했지만, 세포는 여전히 이질적 일 수 있습니다. 이전 연구에서 특정 세포 유형을 분류하려고 시도했습니다. 그러나이 절차로 인해 적은 수의 세포가 수집되었습니다. 균질 성장 세포를 더 큰 규모로 분리하려는 새로운 시도는 강화 된 특성을 지닌 다량의 연골 형성 펠렛을 생성 할 것이 요구 될 것이다.

다양한 그룹이 단일 층 또는 EB 배양 물을 사용하여 hiPSCs로부터 전구 세포를 유도하고있다. MSC와 높은 유사성을 가진 선조 세포의 유도는 고품질의 연골 형성 펠릿을 얻는 열쇠가 될 수 있습니다. EB에서 유래 한이 전구 세포는 MSC와 유사한 특징을 가지고 있습니다. 그러나 이것은ir fibroblastic nature. 따라서, 증식 세포에 대한 상세한 검증 연구가 필요하다.

이 연구에서는 비교적 많은 양의 연골 펠릿을 생성 할 수있는 프로토콜을 제안합니다. 우리는 CBMC-hiPSCs를 사용하여 재생 된 연골이 건강한 표현형을 나타내 었으며 조직 재생을위한 재료로 사용될 수 있음을 확인했습니다. 그러나, 더 차별화 된 타임 라인을 갖는 개선 된 방법은 추후의 적용을 위해 요구된다. 더 높은 수준의 유리질로 연골을 검증하기위한 품질 관리 표준의 추가 개발은 연골 재생을위한 세포 물질로서 CBMC-hiPSC의 향후 적용에 필요합니다. 이 프로토콜은 간단하면서도 효과적이며 펠릿 형성 전에 추가 정렬 과정이 필요하지 않습니다. 결론적으로,이 프로토콜을 사용하여 고품질의 연골 형성 펠릿을 질병 모델링, 약물 스크리닝 및 재생 의학에 대한 연구를 위해 생성하여 t그 연골의 성격.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자는 공개 할 것이 없습니다.

Acknowledgements

이 연구는 보건 복지 가족부 한국 보건 의료 기술 연구 개발 사업 (HI16C2177)의 지원을 받아 수행되었다.

Materials

Name Company Catalog Number Comments
Plasticware
100 mm Dish TPP 93100
6-well Plate TPP 92006
50 mL Cornical Tube SPL 50050
15 mL Cornical Tube SPL 50015
10 mL Disposable Pipette Falcon 7551
5 mL Disposable Pipette Falcon 7543
12-well Plate TPP 92012
Name Company Catalog Number Description
E8 Medium Materials
DMEM/F12, HEPES Life Technologies 11330-057 E8 Medium (500 mL)
Sodium Bicarbonate Life Technologies 25080-094 E8 Medium (Conc.: 543 μg/mL)
Sodium Selenite Sigma Aldrich S5261 E8 Medium  (Conc.: 14 ng/mL)
Human Transfferin Sigma Aldrich T3705 E8 Medium (Conc.: 10.7 μg/mL)
Basic FGF2 Peprotech 100-18B E8 Medium  (Conc.: 100 ng/mL)
Human Insulin Life Technologies 12585-014 E8 Medium (Conc.: 20 μg/mL)
Human TGFβ1 Peprotech 100-21 E8 Medium (Conc.: 2 ng/mL)
Ascorbic Acid Sigma Aldrich A8960 E8 Medium  (Conc.: 64 μg/mL)
DPBS Life Technologies 14190-144
Vitronectin Life Technologies A14700
ROCK Inhibitor Sigma Aldrich Y0503
Name Company Catalog Number Description
Quality Control Materials
18 mm Cover Glass Superior HSU-0111580
4% Paraformaldyhyde Tech & Innovation BPP-9004
Triton X-100 BIOSESANG 9002-93-1
Bovine Serum Albumin Vector Lab SP-5050
Anti-SSEA4 Antibody Millipore MAB4304
Anti-Oct4 Antibody Santa Cruz SC9081
Anti-TRA-1-60 Antibody Millipore MAB4360
Anti-Sox2 Antibody Biolegend 630801
Anti-TRA-1-81 Antibody Millipore MAB4381
Anti-Klf4 Antibody Abcam ab151733
Alexa Fluor 488 goat anti-mouse IgG (H+L) antibody Molecular Probe A11029
Alexa Fluor 594 goat anti-rabbit IgG (H+L) antibody Molecular Probe A11037
DAPI Molecular Probe D1306
Prolong gold antifade reagent Invitrogen P36934
4% Paraformaldyhyde Tech & Innovation BPP-9004
Tween 20 BIOSESANG T1027
Bovine Serum Albumin Vector Lab SP-5050
Anti-Collagen II antibody abcam  ab34712 1:100
Alcian blue Sigma Aldrich A3157-10G
Fast Green FCF Sigma Aldrich F7252-25G
Safranin O Sigma Aldrich 090m0039v
Nuclear fast red Americanmastertech STNFR100 
xylene Duksan 115 
Ethanol Duksan 64-17-5
Mayer's hematoxylin solution wako pure chemical industries LAK7534
DAP VECTOR LABORATORIES SK-4100
Slide Glass, Coated Hyun Il Lab-Mate HMA-S9914
Trizol Invitrogen 15596-018
Chloroform Sigma Aldrich 366919
Isoprypylalcohol Millipore 109634
Ethanol Duksan 64-17-5
RevertAid First Strand cDNA Synthesis kit Thermo Scientfic K1622
Name Company Catalog Number Description
Chondrogenic Differentiation Materials
DMEM Life Technologies 11885 Chondrogenic media component (500 mL)
Penicilin Streptomycin Life Technologies P4333 Chondrogenic media component (Conc.: 1%)
Ascorbic Acid Sigma Aldrich A8960 Chondrogenic media component (Conc.: 64 μg/mL) 
MEM Non-Essential Amino Acids Solution (100x) Life Technologies 11140-050 Chondrogenic media component (Conc.: 100 mM)
rhBMP-2 R&D 355-BM-050 Chondrogenic media component (Conc.:100 ng/ml)
Recombinant Hman TGF-beta3 R&D 243-B3-002 Chondrogenic media component (Conc.:10 ng/ml)
KnockOut Serum Replacement Life Technologies 10828-028 Chondrogenic media component (Conc.: 1%)
ITS+ Premix BD 354352 Chondrogenic media component (Conc.: 1%)
Dexamethasone-Water Soluble  Sigma Aldrich D2915-100MG Chondrogenic media component (Conc.:10-7 M)
GlutaMAX Supplement Life Technologies 35050-061 Chondrogenic media component (Conc.: 1%)
Sodium pyruvate solution Sigma Aldrich S8636 Chondrogenic media component (Conc.: 1%)
L-Proline Sigma Aldrich P5607-25G Chondrogenic media component (40 μg/ml)

DOWNLOAD MATERIALS LIST

References

  1. van Osch, G. J., et al. Cartilage repair: past and future--lessons for regenerative medicine. J Cell Mol Med. 13, (5), 792-810 (2009).
  2. Ahmed, T. A., Hincke, M. T. Strategies for articular cartilage lesion repair and functional restoration. Tissue Eng Part B Rev. 16, (3), 305-329 (2010).
  3. Diekman, B. O., et al. Cartilage tissue engineering using differentiated and purified induced pluripotent stem cells. Proc Natl Acad Sci USA. 109, (47), 19172-19177 (2012).
  4. Solchaga, L. A., Penick, K., Goldberg, V. M., Caplan, A. I., Welter, J. F. Fibroblast growth factor-2 enhances proliferation and delays loss of chondrogenic potential in human adult bone-marrow-derived mesenchymal stem cells. Tissue Eng Part A. 16, (3), 1009-1019 (2010).
  5. Guzzo, R. M., Drissi, H. Differentiation of Human Induced Pluripotent Stem Cells to Chondrocytes. Methods Mol Biol. 1340, 79-95 (2015).
  6. Drissi, H., Gibson, J. D., Guzzo, R. M., Xu, R. H. Derivation and Chondrogenic Commitment of Human Embryonic Stem Cell-Derived Mesenchymal Progenitors. Methods Mol Biol. 1340, 65-78 (2015).
  7. Nejadnik, H., et al. Improved approach for chondrogenic differentiation of human induced pluripotent stem cells. Stem Cell Rev. 11, (2), 242-253 (2015).
  8. Teramura, T., et al. Induction of mesenchymal progenitor cells with chondrogenic property from mouse-induced pluripotent stem cells. Cell Reprogram. 12, (3), 249-261 (2010).
  9. Koyama, N., et al. Human induced pluripotent stem cells differentiated into chondrogenic lineage via generation of mesenchymal progenitor cells. Stem Cells Dev. 22, (1), 102-113 (2013).
  10. Ko, J. Y., Kim, K. I., Park, S., Im, G. I. In vitro chondrogenesis and in vivo repair of osteochondral defect with human induced pluripotent stem cells. Biomaterials. 35, (11), 3571-3581 (2014).
  11. Nam, Y., Rim, Y. A., Jung, S. M., Ju, J. H. Cord blood cell-derived iPSCs as a new candidate for chondrogenic differentiation and cartilage regeneration. Stem Cell Res Ther. 8, (1), 16 (2017).
  12. Hotten, G. C., et al. Recombinant human growth/differentiation factor 5 stimulates mesenchyme aggregation and chondrogenesis responsible for the skeletal development of limbs. Growth Factors. 13, (1-2), 65-74 (1996).
  13. Murphy, M. K., Huey, D. J., Hu, J. C., Athanasiou, K. A. TGF-beta1, GDF-5, and BMP-2 stimulation induces chondrogenesis in expanded human articular chondrocytes and marrow-derived stromal cells. Stem Cells. 33, (3), 762-773 (2015).
  14. Shintani, N., Siebenrock, K. A., Hunziker, E. B. TGF-ss1 enhances the BMP-2-induced chondrogenesis of bovine synovial explants and arrests downstream differentiation at an early stage of hypertrophy. PLoS One. 8, (1), e53086 (2013).
  15. Fukumoto, T., et al. Combined effects of insulin-like growth factor-1 and transforming growth factor-beta1 on periosteal mesenchymal cells during chondrogenesis in vitro. Osteoarthritis Cartilage. 11, (1), 55-64 (2003).
  16. Worster, A. A., Nixon, A. J., Brower-Toland, B. D., Williams, J. Effect of transforming growth factor beta1 on chondrogenic differentiation of cultured equine mesenchymal stem cells. Am J Vet Res. 61, (9), 1003-1010 (2000).
  17. Knippenberg, M., et al. Differential effects of bone morphogenetic protein-2 and transforming growth factor-beta1 on gene expression of collagen-modifying enzymes in human adipose tissue-derived mesenchymal stem cells. Tissue Eng Part A. 15, (8), 2213-2225 (2009).
  18. Jang, Y., et al. Centrifugal gravity-induced BMP4 induces chondrogenic differentiation of adipose-derived stem cells via SOX9 upregulation. Stem Cell Res Ther. 7, (1), 184 (2016).
  19. Kang, R., et al. Mesenchymal stem cells derived from human induced pluripotent stem cells retain adequate osteogenicity and chondrogenicity but less adipogenicity. Stem Cell Res Ther. 6, 144 (2015).
  20. Tao, H., et al. Biological evaluation of human degenerated nucleus pulposus cells in functionalized self-assembling peptide nanofiber hydrogel scaffold. Tissue Eng Part A. 20, (11-12), 1621-1631 (2014).
  21. Sekiya, I., Larson, B. L., Vuoristo, J. T., Reger, R. L., Prockop, D. J. Comparison of effect of BMP-2, -4, and -6 on in vitro cartilage formation of human adult stem cells from bone marrow stroma. Cell Tissue Res. 320, (2), 269-276 (2005).
  22. Shen, B., Wei, A., Tao, H., Diwan, A. D., Ma, D. D. BMP-2 enhances TGF-beta3-mediated chondrogenic differentiation of human bone marrow multipotent mesenchymal stromal cells in alginate bead culture. Tissue Eng Part A. 15, (6), 1311-1320 (2009).
  23. Rim, Y. A., Nam, Y., Ju, J. H. Induced Pluripotent Stem Cell Generation from Blood Cells Using Sendai Virus and Centrifugation. J Vis Exp. (118), (2016).
  24. Kim, Y., et al. The Generation of Human Induced Pluripotent Stem Cells from Blood Cells: An Efficient Protocol Using Serial Plating of Reprogrammed Cells by Centrifugation. Stem Cells Int. 2016, 1329459 (2016).
  25. Oldershaw, R. A., et al. Directed differentiation of human embryonic stem cells toward chondrocytes. Nat Biotechnol. 28, (11), 1187-1194 (2010).
  26. Toh, W. S., et al. Differentiation and enrichment of expandable chondrogenic cells from human embryonic stem cells in vitro. J Cell Mol Med. 13, (9B), 3570-3590 (2009).
  27. Hwang, N. S., Varghese, S., Elisseeff, J. Derivation of chondrogenically-committed cells from human embryonic cells for cartilage tissue regeneration. PLoS One. 3, (6), e2498 (2008).
  28. Nakagawa, T., Lee, S. Y., Reddi, A. H. Induction of chondrogenesis from human embryonic stem cells without embryoid body formation by bone morphogenetic protein 7 and transforming growth factor beta1. Arthritis Rheum. 60, (12), 3686-3692 (2009).
  29. Guzzo, R. M., Scanlon, V., Sanjay, A., Xu, R. H., Drissi, H. Establishment of human cell type-specific iPS cells with enhanced chondrogenic potential. Stem Cell Rev. 10, (6), 820-829 (2014).
  30. Rim, Y. A., Park, N., Nam, Y., Ju, J. H. Generation of Induced-pluripotent Stem Cells Using Fibroblast-like Synoviocytes Isolated from Joints of Rheumatoid Arthritis Patients. J Vis Exp. (116), (2016).
  31. Pfaff, N., et al. Efficient hematopoietic redifferentiation of induced pluripotent stem cells derived from primitive murine bone marrow cells. Stem Cells Dev. 21, (5), 689-701 (2012).
  32. Xu, H., et al. Highly efficient derivation of ventricular cardiomyocytes from induced pluripotent stem cells with a distinct epigenetic signature. Cell Res. 22, (1), 142-154 (2012).
  33. Lee, S. B., et al. Contribution of hepatic lineage stage-specific donor memory to the differential potential of induced mouse pluripotent stem cells. Stem Cells. 30, (5), 997-1007 (2012).
  34. Hu, S., et al. Effects of cellular origin on differentiation of human induced pluripotent stem cell-derived endothelial cells. JCI Insight. 1, (8), 1-12 (2016).
  35. Vonk, L. A., de Windt, T. S., Slaper-Cortenbach, I. C., Saris, D. B. Autologous, allogeneic, induced pluripotent stem cell or a combination stem cell therapy? Where are we headed in cartilage repair and why: a concise review. Stem Cell Res Ther. 6, (94), 1-11 (2015).
  36. Gomez-Leduc, T., et al. Chondrogenic commitment of human umbilical cord blood-derived mesenchymal stem cells in collagen matrices for cartilage engineering. Sci Rep. 6, 32786 (2016).
  37. Mareschi, K., et al. Isolation of human mesenchymal stem cells: bone marrow versus umbilical cord blood. Haematologica. 86, (10), 1099-1100 (2001).
  38. Wexler, S. A., et al. Adult bone marrow is a rich source of human mesenchymal 'stem' cells but umbilical cord and mobilized adult blood are not. Br J Haematol. 121, (2), 368-374 (2003).
  39. Zhang, X., et al. Isolation and characterization of mesenchymal stem cells from human umbilical cord blood: reevaluation of critical factors for successful isolation and high ability to proliferate and differentiate to chondrocytes as compared to mesenchymal stem cells from bone marrow and adipose tissue. J Cell Biochem. 112, (4), 1206-1218 (2011).
  40. Wagner, W., et al. Replicative senescence of mesenchymal stem cells: a continuous and organized process. PLoS One. 3, (5), e2213 (2008).
  41. Tarte, K., et al. Clinical-grade production of human mesenchymal stromal cells: occurrence of aneuploidy without transformation. Blood. 115, (8), 1549-1553 (2010).
  42. Chen, W. C., et al. Prediction of poor survival by cyclooxygenase-2 in patients with T4 nasopharyngeal cancer treated by radiation therapy: clinical and in vitro studies. Head Neck. 27, (6), 503-512 (2005).
  43. Guzzo, R. M., Gibson, J., Xu, R. H., Lee, F. Y., Drissi, H. Efficient differentiation of human iPSC-derived mesenchymal stem cells to chondroprogenitor cells. J Cell Biochem. 114, (2), 480-490 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics