Хондрогенное образование гранул из индуцированных пуповинной клеткой флуоресцентных стволовых клеток

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Здесь мы предлагаем протокол для хондрогенной дифференцировки из пуповинной крови, индуцированной человеческими клетками, плюрипотентных стволовых клеток.

Cite this Article

Copy Citation | Download Citations

Nam, Y., Rim, Y. A., Ju, J. H. Chondrogenic Pellet Formation from Cord Blood-derived Induced Pluripotent Stem Cells. J. Vis. Exp. (124), e55988, doi:10.3791/55988 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Человеческий суставной хрящ не обладает способностью к самовосстановлению. Таким образом, дегенерация хряща обрабатывается не лечебными, а консервативными методами. В настоящее время предпринимаются усилия по восстановлению поврежденного хряща с эксфорированными хондроцитами ex vivo или мезенхимальными стволовыми клетками, полученными из костного мозга (BMSCs). Однако ограниченная жизнеспособность и нестабильность этих клеток ограничивают их применение при реконструкции хряща. Человеческие индуцированные плюрипотентные стволовые клетки (hiPSCs) получили научное внимание в качестве новой альтернативы регенеративным применениям. Обладая неограниченной способностью к самообновлению и мультипотентностью, hiPSC были выделены в качестве нового источника сменных клеток для восстановления хряща. Однако получение большого количества высококачественных хондрогенных гранул является серьезной проблемой для их клинического применения. В этом исследовании мы использовали клетки эмбрионального тела (EB), которые были выделены для хондрогенной дифференцировки. Успешный хондрогенез был подтвержден ПЦРD, окрашивание синим алкалоидом, толуидиновым синим и антителами против коллагена I и II (COL1A1 и COL2A1, соответственно). Мы предоставляем подробный метод для дифференциации iPSCs (CBMC-hiPSCs), полученных из мононуклеарных клеток пуповинной крови, в хондрогенные гранулы.

Introduction

Использование hiPSC представляет собой новую стратегию скрининга наркотиков и механистических исследований различных заболеваний. С точки зрения регенерации hiPSCs также являются потенциальным источником для замены поврежденных тканей с ограниченной лечебной способностью, таких как суставной хрящ 1 , 2 .

Регенерация нативного суставного хряща была проблемой в течение нескольких десятилетий. Суставной хрящ представляет собой мягкую белую ткань, которая покрывает конец костей, защищая их от трения. Однако при повреждении он обладает ограниченной регенеративной способностью, что делает самовосстановление практически невозможным. Поэтому исследования, посвященные регенерации хряща, продолжаются в течение нескольких десятилетий.

Раньше дифференцировку in vitro в хондрогенную линию обычно проводили с BMSCs или нативными хондроцитами, выделенными из коленного сустава 3 . Из-за tO их хондрогенный потенциал, BMSCs и родные хондроциты имеют многочисленные достоинства, поддерживающие их использование в хондрогенезе. Однако из-за их ограниченного расширения и нестабильного фенотипа эти клетки сталкиваются с несколькими ограничениями в восстановлении дефектов суставного хряща. В условиях культивирования in vitro эти клетки, как правило, теряют свои характеристики после 3-4 проходов, что в конечном итоге влияет на их способности к дифференциации 4 . Кроме того, в случае местных хондроцитов дополнительный ущерб коленному суставу неизбежен при получении этих клеток.

В отличие от BMSC или родных хондроцитов hiPSCs могут неограниченно расширяться in vitro . При надлежащих условиях культивирования hiPSCs обладают большим потенциалом в качестве источника замены хондрогенной дифференциации. Тем не менее, сложно изменить внутренние характеристики hiPSCs 5 . Кроме того, требуется несколько сложных in vitro stePs, чтобы направить судьбу hiPSCs на определенный тип ячейки. Несмотря на эти осложнения, использование hiPSC по-прежнему рекомендуется из-за их высоких способностей к самообновлению и их способности дифференцироваться в целевые клетки, включая хондроциты.

Хондрогенную дифференцировку обычно проводят с помощью трехмерных систем культивирования, таких как культура гранул или культура микромассы, с использованием MSC-подобных клеток-предшественников. При использовании hiPSC протокол для генерации MSC-подобных клеток-предшественников отличается от существующих протоколов. Некоторые группы используют монослойную культуру hiPSCs для прямого преобразования фенотипа в MSC-подобные клетки 7 . Тем не менее, в большинстве исследований используется EB для генерации клеток выроста, которые напоминают MSC 8 , 9 , 10 , 11 .

Различные типы факторов роста используются для индуцирования хондрогаНесис. Обычно белки семейства BMP и TGFβ используются отдельно или в комбинации. Дифференциация также была вызвана другими факторами, такими как GDF5, FGF2 и IGF1 12 , 13 , 14 , 15 . Показано, что TGFβ1 стимулирует хондрогенез дозозависимым образом в MSC 16 . По сравнению с другим изотипом TGFβ3, TGFβ1 индуцирует хондрогенез путем увеличения консиляции мезенхимальных клеток перед хрящами. TGFβ3 индуцирует хондрогенез путем значительного увеличения пролиферации мезенхимных клеток 17 . Однако TGFβ3 чаще используется исследователями, чем TGFβ1 7 , 10 , 18 , 19 . BMP2 усиливает экспрессию генов, связанных с компонентами хондрогенной матрицы у человекаСуставные хондроциты в условиях in vitro 20 . BMP2 увеличивает экспрессию генов, критически важных для образования хряща в MSC, в комбинации с белками TGFβ 21 . Было также показано, что BMP2 синергически усиливает действие TGFβ3 через пути Smad и MAPK 22 .

В этом исследовании CBMC-hiPSCs были объединены в EBs с использованием EB-среды в чашке Petri с низким прилеганием. Клетки отростков индуцировали присоединением EBs к тарелке, покрытой желатином. Хондрогенную дифференцировку с использованием клеток выроста проводили культурой гранул. Обработка как BMP2, так и TGFβ3 успешно конденсировала клетки и индуцировала накопление белка внеклеточного матрикса (ECM) для образования хондрогенных гранул. В этом исследовании предлагается простой, но эффективный протокол хондрогенной дифференцировки с использованием CBMC-hiPSC.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Этот протокол был одобрен институциональным наблюдательным советом Католического университета Кореи (KC12TISI0861). CBMCs, используемые для перепрограммирования, были получены непосредственно из банка пуповинной крови в больнице Сеула Св. Марии.

1. Хондрогенная дифференциация от iPSCs

  1. Генерация CBMC-iPSC
    1. Создайте CBMC-hiPSCs, используя протокол, показанный в нашей предыдущей работе 23 .
    2. Соберите клетки крови в 15-миллилитровой конической трубке и подсчитайте их с помощью гемоцитометра.
    3. Подготовьте 3 × 10 5 клеток и центрифугируйте их в течение 5 мин при 515 × g и RT. Удалите супернатант всасыванием и ресуспендируйте клетки в 0,5 мл среды клеток крови.
    4. Перенесите клетки в лунку 24-луночного планшета без покрытия и добавьте смесь вируса Сендай, следуя рекомендациям производителя.
    5. Центрифугируйте планшет в течение 30 минут при 1150 xg и 30 ° C.
    6. кормовойЦентрифугируют, инкубируют клетки в течение ночи (O / N) при 37 ° С в 5% CO 2 .
    7. На следующий день перенесите трансдуцированные клетки в лунку с матричным покрытием. Центрифугируйте планшет при 1,150 xg в течение 30 минут при 30 ° C.
    8. После центрифугирования удаляют супернатант, добавляют 1 мл среды iPSC и поддерживают ячейки O / N при 37 ° C в 5% CO 2 .
    9. Поддерживайте прикрепленные ячейки при 37 ° C и 5% CO 2 . Ежедневно меняйте носитель, заменяя его свежей средой iPSC.
      ПРИМЕЧАНИЕ. Колонии появятся на 14-21 день после трансдукции.
  2. Генерация EB
    1. Поддерживайте hiPSC при температуре 37 ° C и 5% CO 2 . Ежедневно меняйте среду, заменив ее свежей средой Essential 8 (E8).
    2. Подготовьте 2 x 10 6 hiPSCs в покрытом витронектином 100-миллиметровом блюде в среде E8.
    3. Удалите среду E8 из чашки для культивирования и промыть стерильным фосфатным буферным раствором (PBS).
    4. Добавить 1Мл 1 мМ этилендиаминтетрауксусной кислоты (ЭДТА) и инкубируют при 37 ° С и 5% СО 2 в течение 2 мин.
    5. Убирают клетки с 3 мл среды E8 и переносят их в новую 15-мл коническую трубку. Центрифугируют клетки при 250 × g при комнатной температуре (RT) в течение 2 мин.
    6. Аспирируйте супернатант, не нарушая осадок клеток, и повторно суспендируйте клетки в 5 мл среды E8.
    7. Подсчитайте клетки с помощью гемоцитометра и подготовьте 2 × 10 6 клеток для каждой 100-миллиметровой чашки Петри. Ресуспендируют полученные клетки в 10-мл смеси среды E8 и EB (1: 1) с 10 мкМ ингибитора ро-ассоциированной киназы (ROCK).
    8. Инкубируйте клетки O / N для агрегации при 37 ° C и 5% CO 2 .
    9. На следующий день собирайте агрегированные ЭП путем пипетирования. Центрифугировать клетки при 250 мкг в течение 1 мин. Удалите супернатант и ресуспендируйте EB в 10 мл свежей среды E8.
    10. Увеличьте генерируемые EB в течение 5 дней, выполняя ежедневные изменения с помощью fresH E8. Для дальнейшего созревания измените культуральную среду на среду E7. Поддержание EBs при 37 ° C и 5% CO 2 в течение еще 5 дней, ежедневное изменение среды со свежей средой E7.
      ПРИМЕЧАНИЕ: среда E7 - среда E8 без FGF2.
  3. Индуцирование клеток клеток из EBs
    1. Добавить 6 мл 1% желатина в 100-миллиметровую чашку и инкубировать при 37 ° С и 5% СО 2 в течение 30 мин.
    2. Удалите желатин и полностью высушите блюдо в течение 2-3 часов перед использованием.
    3. Перенесите EB в 50-миллилитровую коническую трубку. Позвольте EB разойтись до нижней части конической трубки. Удалите супернатант, не нарушая EB.
    4. Ресуспендируют ЭБ в 10 мл модифицированной Дульбекко среды Игла (DMEM) с 20% фетальной бычьей сывороткой (FBS). Перенесите EB на желатиновое покрытие, 100-миллиметровое блюдо. Добавить 10 мкМ ингибитор ROCK.
    5. Инкубируйте и поддерживайте клетки при 37 ° C и 5% CO 2 в течение 7 дней. Менять темуТри раза в день без добавления ингибитора ROCK.
  4. Хондрогенное образование гранул
    1. Аспирируйте культуральную среду из тарелки и три раза промывайте клетки PBS.
    2. Применяют 1 мл 1 мМ ЭДТА и инкубируют при 37 ° С и 5% СО 2 в течение 2 мин.
    3. Убирают клетки, используя 5 мл DMEM с 20% FBS и переносят их в новую 15-мл коническую трубку.
    4. Центрифугировать клетки в течение 2 мин при 250 мкг и RT. Удалите супернатант и ресуспендируйте гранулу в 10 мл DMEM с помощью 20% FBS.
    5. Отфильтруйте и выбросьте клеточные глыбы с помощью 40 мкм клеточного фильтра и уберите отдельные клетки. Подсчитайте отдельные клетки, используя гемоцитометр.
    6. Центрифугировать клетки в течение 2 мин при 250 мкг и RT. Удалите супернатант и семена 3 × 10 5 клеток на гранулу в 15 мл конической пробирке с 300 мкл среды хондрогенной дифференцировки (CDM).
    7. Для образования гранул центрифугируют клетки в течение 5 мин при680 xg и RT.
      ПРИМЕЧАНИЕ. Гранулы выдерживают в 15 мл конических пробирках во время дифференциации хондрогенных гранул.
    8. Инкубируйте клетки в течение ночи при 37 ° С и 5% СО 2 .
    9. Измените МЧР каждые 2-3 дня. В течение 3 дней гранулы будут иметь сплющенные, сфероидальные морфологии. Поддерживайте гранулы в течение 21 дня при 37 ° C и 5% CO 2 .

2. Характеристика хондрогенных гранул путем окрашивания

  1. Хондрогенное вложение
    1. Перед введением, подготовьте и расплавьте парафин при 58 ° C.
    2. Закрепите гранулы в 1 мл 4% параформальдегида в течение 2 ч при комнатной температуре в пробирке объемом 1,5 мл.
      Предостережение: Параформальдегид является высокотоксичным. Избегать контакта с глазами, кожей или слизистыми оболочками. Сведите к минимуму воздействие и избегайте вдыхания при его приготовлении.
    3. Поместите один слой марли на кассету и перенесите фиксированные гранулы с помощью пипетки. Закройте гранулу, складываяE и закройте крышку кассеты.
    4. Инициировать обезвоживание в 100 мл 70% этанола (EtOH) дважды, по 10 минут каждый. Обезвоживают гранулы через последовательные 10-минутные промывки в 80% и 95% EtOH.
    5. Перенесите гранулы в 100% EtOH в течение 10 мин. Повторите три раза со свежим EtOH.
    6. Для «очистки», обменивают раствор на 100 мл, 1: 1 смесь EtOH и ксилола, а затем смесь EtOH и ксилола 1: 1 в течение 10 минут каждый. Очистите оставшийся EtOH путем инкубирования гранул дважды в 100% ксилоле, по 10 минут каждый.
    7. Для инфильтрации парафина инкубируйте гранулы в последовательных ксилолевых и парафиновых смесях. Проведите весь процесс инфильтрации парафина при 58 ° C. Инкубируйте гранулы в 100 мл смеси 2: 1 ксилола и парафина в течение 30 мин.
    8. Обменивают раствор на 100 мл 1: 1 смеси ксилола и парафина и инкубируют в течение 30 мин.
    9. Обменивают раствор на 100 мл 1: 2 смеси ксилола и парафина и инкубируют в течение 30 мин.
    10. Для окончательной инфильтрации перенесите гранулы в первую ванну с 100% парафином и инкубируйте в течение 2 часов.
    11. Перенесите гранулы во вторую ванну из 100% парафина и инкубируйте O / N при 58 ° C.
    12. На следующий день осторожно перенесите гранулы в пресс-форму, используя пинцет. Добавьте парафин в форму из парафинового дозатора. Затвердить парафин в течение 30 минут при 4 ° C.
    13. Нарежьте секции на 7 мкм и перенесите секции на предмет слайда. Дайте слайдам высохнуть всю ночь и сохраните слайды при комнатной температуре до тех пор, пока они не будут готовы к использованию.
  2. Подготовка слайдов
    1. Депарафинизировать слайды, перемещая их через 100 мл 100%, 90%, 80% и 70% EtOH последовательно в течение 5 минут каждый.
    2. Поместите слайды в стеклянную банку и смойте водопроводной водой в течение 5 минут.
  3. Алкогольное синее окрашивание
    1. Инкубируйте слайды в 50 мл 1% раствора синего голубого цвета в течение 30 мин.
      НЕE: Синий алканий разбавляют 3% раствором уксусной кислоты. Отрегулируйте pH до 2,5 с помощью уксусной кислоты.
    2. Поместите слайды в стеклянную банку и смойте водопроводной водой в течение 2 мин.
    3. Промойте слайды в деионизированной воде (DW) и контрастируйте с ядерным быстрым красным раствором в течение 2 мин.
    4. Поместите слайды в стеклянную банку и промойте водой с краном в течение 1 минуты.
    5. 2.3.5) Продолжайте обезвоживать и монтировать слайды на шаге 2.6.
  4. Толуидин-синий окрашивание
    1. Инкубируйте слайды в 50 мл толуидинового синего раствора в течение 4 мин.
    2. Поместите слайды в стеклянную банку и смойте водопроводной водой в течение 5 минут.
    3. Продолжайте обезвоживать и монтировать слайды на шаге 2.6.
  5. Иммуногистохимическое окрашивание
    1. Инкубируйте слайды в 3% H 2 O 2 в течение 15 минут для блокирования эндогенной пероксидазы.
    2. Нанесите 200 мкл первичного антитела (анти-COL1A1 и -COL2A1), разбавленного 1: 100 в трисбу(TBS), содержащего 1% бычьего сывороточного альбумина (BSA) и 5% нормальной сыворотки коз (NGS), до ползунов и инкубирования O / N при 4 ° C.
    3. На следующий день поместите слайды в стеклянную банку и промойте их 50 мл TBS, содержащего 0,1% полисорбата 20 (TBST) три раза в течение 5 минут каждый.
    4. Нанесите 200 мкл вторичного антитела (козье антитело против кроликов IgG, разведенное 1: 200 в TBS, содержащем 1% BSA и 5% NGS) на слайды и инкубируйте при комнатной температуре в течение 40 минут.
    5. Поместите слайды в стеклянную банку и промойте их три раза 50 мл, по 5 минут каждый.
    6. Для усиления сигнала нанесите HRP-конъюгат раствора стрептавидина на слайды и инкубируйте в течение 10 мин.
    7. Поместите слайды в стеклянную банку и промойте их три раза 50 мл, по 5 минут каждый.
    8. Смешайте раствор субстрата DAB-пероксидазы, нанесите 200 мкл раствора на каждый слайд и инкубируйте в течение 1 мин.
    9. Поместите слайды в стеклянную банку и смойте водопроводной водой в течение 5 минут.
    10. контрастирующая окраскаС гематоксилином Майера в течение 1 мин.
    11. Вымойте слайды с помощью DW.
    12. Продолжайте обезвоживать и монтировать слайды на шаге 2.6.
  6. Обезвоживание и монтаж
    1. Обезвоживайте слайды, перемещая их последовательно через 100 мл 70%, 80%, 90% и 100% EtOH, по 30 с каждый.
    2. Опустите слайды на два изменения ксилола в течение 1 мин каждый.
    3. Добавьте 50 мкл монтажного раствора к покровным стеклам и поместите слайды сверху.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

В этом исследовании мы создали хондрогенные гранулы из CBMC-hiPSCs, индуцируя клетки выроста из EB. Хондрогенную дифференцировку индуцировали с использованием CBMC-hiPSC с подтвержденным высоким плюрипотентностью 11 . Простая схема нашего протокола показана на рисунке 1A . До дифференциации колонии iPSC были расширены ( рисунок 1B ). Расширенные iPSC были собраны как EB для инициирования дифференцирования ( рисунок 1C ). Сгенерированные EB были прикреплены к таблеткам, покрытым желатином, для индуцирования клеток разрастания ( фиг. 1D ). Затем клетки отростков собирали и использовали для получения хондрогенных гранул. После 21 дня дифференцировки получали небольшие шариковые хондрогенные гранулы и использовали для дальнейшей характеристики ( рисунок 1Е ). Качество порошка, полученного in vitroДрогенные гранулы были подтверждены с помощью различных анализов.

Мы гистологически оценивали качество хондрогенных гранул на 21 день. В качестве положительного контроля использовали хондрогенные гранулы BMSC. Накопление белков ECM, секретируемых дифференцированными хондроцитами, было подтверждено окрашиванием синего голубого и толуидинового синего на рис. 2А . Основные характеристики здорового хряща, такие как лакуна и протеогликан, увеличились по мере того, как процесс дифференциации продолжался в течение 21 дня. Хондрогенные гранулы, полученные из CBMC-hiPSCs, выражали COL2A1, который является основным компонентом ECM в здоровом хряще ( рисунок 2B ). Экспрессия COL2A1 гранул, полученных из CBMC-hiPSC, была выше, чем гранулы, полученные из BMSC. Экспрессия коллагена I типа, маркера фиброзного хряща, была ниже в гранулах, полученных из CBMC-hiPSC, по сравнению с выражением COL2A1. Экспрессия гена белков ECM хряща в хондрогенных гранулах 21-го дня подтверждена ПЦР в реальном времени. Экспрессия aggrecan (ACAN) гранул, полученных из CBMC-hiPSC, была подобна таковой из гранул, полученных из BMSC ( фиг. 3A ). Экспрессия COL2A1 была значительно выше в гранулах, полученных из CBMC-hiPSC ( фиг. 3B ). Было также оценено выражение определяющего пола участка Y-box 9 (Sox9), хондрогенного маркера предшественника. Пеллеты, полученные из CBMC-hiPSCs, выражают высокие уровни Sox9 ( рисунок 3C ). Мы подтвердили, что эти гены были значительно повышены в хондрогенных гранулах CBMC-hiPSC по сравнению с контрольными таблетками BMSC на 21-й день. Была оценена экспрессия гипертрофического маркера COL1A1 ( рисунок 3D ). Экспрессия COL1A1 в гранулах, полученных из CBMC-hiPSC, была уменьшена по сравнению с экспрессией в BMSC-deriГранулы. Эффективность дифференцирования анализировали соотношением COL2A1 к COL1A1 ( рисунок 3E ). Приращение отношения в гранулах, полученных из CBMC-hiPSC, продемонстрировало относительно высокую экспрессию COL2A1 по сравнению с COL1A1. В заключение мы подтвердили способность хондрогенной дифференциации CBMC-hiPSC. Качество полученных хондрогенных гранул, полученных из CBMC-hiPSC, было качественно совместимо с качеством BMSC.

Рисунок 1
Рисунок 1: Хондрогенная дифференциация hiPSC. ( A ) Схема получения хондрогенной гранулы из hiPSC. ( B ) Морфология порожденного CBMC-hiPSC. ( C ) Морфология генерируемых EB. ( D ) клетки размножения, полученные из EBs, прикрепленных к блюду культуры, покрытому желатином. ( E ) Изображение t Он хондрогенный осадок после 21 дня дифференцировки. Единицы интервалов показаны в миллиметрах. Шкала шкалы = 200 мкм. Нажмите здесь, чтобы просмотреть увеличенную версию этого рисунка.

фигура 2
Рисунок 2: Гистологический анализ хондрогенной гранулы. ( A ) Гистологическая оценка хондрогенных гранул на 21 день с использованием синего и толуидинового синего окрашивания. ( B ) Иммуногистохимическое изображение хондрогенных гранул, окрашенных антителами COL1A1 и COL2A1. Шкала шкалы = 100 мкм. Нажмите здесь, чтобы просмотреть увеличенную версию этого рисунка.

1" > Рисунок 3
Рисунок 3: Экспрессия гена хондрогенной гранулы. ( A ) Относительная экспрессия гена ACAN. ( B ) Относительная экспрессия гена COL2A1. ( C ) Относительная экспрессия гена SOX9. ( D ) Относительная экспрессия гена COL1A1. ( E ) Экспрессия гена COL1A1. ( F ) экспрессия гена COL10A1. ( G ) Отношение выражения COL2A1: COL1A1. Гранулы собирали и анализировали после 21 дня дифференциации. Данные были получены с использованием ПЦР в реальном времени и отображены в виде средней стандартной ошибки трехкратных экспериментов на образец (n = 3). Выражение гена было нормировано на GAPDH в качестве внутреннего контроля. (* P <0,05, ** p <0,01, *** p <0,001).K "> Нажмите здесь, чтобы просмотреть увеличенную версию этого рисунка.

Номер мобильного Выход клеток отростков Выход гранул
hiPSCs 2 x 10 6 2-5 x 10 7 70-150
MSC 2 x 10 6 - 6

Таблица 1: Сравнение производительности MSC и hiPSC.

Название цели направление Последовательность праймера Размер
Вперед TTCCGCGACGTGGACAT 77 bp
Задний ход TCAAACTCGTTGACATCGAAGGT
БАНКА Вперед AGCCTGCGCTCCAATGACT 107 б.п.
Задний ход TAATGGAACACGATGCCTTTCA
COL2A1 Вперед GGCAATAGCAGGTTCACGTACA 79 б.п.
Задний ход CGATAACAGTCTTGCCCCACTTA
COL1A1 Вперед CCCCTGGAAAGAATGGAGATG 148 bp
Задний ход TCCAAACCACTGAAACCTCTG

Таблица 2: Последовательности праймеров против хондрогенных маркеров в ПЦР в режиме реального времени.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Этот протокол успешно сгенерировал hiPSCs из CBMC. Мы перепрограммировали CBMCs на hiPSC с использованием вирусного вектора Сендай, содержащего факторы Яманаки 24 . Три случая использовались при дифференцировке, и все эксперименты успешно генерировали хондрогенные гранулы, используя этот протокол. В многочисленных исследованиях были представлены протоколы для дифференциации hiPSCs в хондроциты 25 , 26 , 27 , 28 . Однако необходимы дополнительные исследования для подтверждения использования CBMC-hiPSCs кандидатом на регенерацию и восстановление хряща.

Хондрогенез был подтвержден с использованием hiPSCs, полученных из различных типов соматических клеток 11 , 25 , 26 , 27 , 29 . Многие отчеты демонстрируютЧто происхождение соматической клетки, используемой при перепрограммировании, может влиять на результат дифференциации hiPSCs 30 , 31 , 32 , 33 . Пуповинная кровь является источником, обогащенным HSC и MSC. Нет отчета о различии между клетками, полученными из пуповинной крови, такими как клетки крови или MSC. Однако предыдущие исследования показали, что hiPSC с сухожильным хондроцитом чаще протекают через хондрогенез, чем hiPSCs, образующиеся из пуповинной крови или фибробластов кожи 29 . Результаты эндотелиальной дифференцировки с использованием hiPSCs, образованных из фибробластов, клеток сердечных предшественников и эндотелиальных клеток, показали, что ткань происхождения может отражать тканеспецифическую соматическую память в терминально дифференцированном дифференцировании iPSC, особенно на ранних проходах, между 10 и 20 34 . В ранних проходах hiPSCs эндотелиальная клетка-deriVed hiPSCs более эффективно дифференцировались в эндотелиальную линию. Однако значительная разница между этими клеточными линиями исчезла в hiPSCs более чем в 20 проходах. Поэтому важно внимательно рассмотреть соматическую память, переносимую hiPSC в ранних проходах, когда они используются в клинических исследованиях.

Недавно были разработаны различные процедуры для восстановления дефектного суставного хряща. Микроразрушение осуществляется путем сверления нескольких отверстий в кости, чтобы вызвать приток костного мозга для естественного ремонта 35 . Замена коленного сустава, также известная как артропластика коленного сустава, используется для замены поврежденного хряща. Тем не менее, микроразрушение не полезно при тяжелом повреждении суставного хряща, а инструмент, используемый для замены коленного сустава, должен меняться каждые 10-15 лет.

В наши дни клеточные терапии являются перспективным альтернативным методом для восстановления хряща. Аутологичная имплантация хондроцитов (ACI) широко распространенаИспользуется для восстановления хряща на основе клеток. ACI осуществляется путем непосредственного введения аутологичных хондроцитов в дефект. Однако аутологичные хондроциты превращаются в фибробластоподобные клетки в условиях культивирования in vitro . Дополнительный ущерб также неизбежен в процессе уборки аутологичных хондроцитов. MSC были предложены в качестве источника клеток для восстановления хряща. Пуповинная кровь является полезным и доступным источником клеток MSC для инженерного хряща 36 . Тем не менее, вероятность успеха для выделения MSC с сердечной кровью является спорной 37 , 38 . В многочисленных исследованиях сообщается об успешной изоляции МСЦ кордовой крови. В нескольких исследованиях показано, что объем пуповинной крови является критическим параметром, который может влиять на скорость выхода изоляции MSC 36 , 39 . Для получения высококачественных MSC, прохождение клеток также имеет решающее значение. Предыдущие исследования показывают, чтоT MSC имеют ограниченный срок службы после определенного номера ячейки. Вводя старение, MSC характеризуются уменьшенной пролиферацией, как и с любой нормальной соматической клеткой 40 . Поэтому необходимо, чтобы корни крови, полученные MSC, использовались до шестого прохода, чтобы избежать старения клеток и хромосомных аномалий 41 .

Чтобы избежать этих ограничений, человеческие iPSC открыли новую возможность для персонализированной, клеточной терапии с высокой производительностью 11 . Установленные hiPSCs теоретически могут размножаться безгранично. Кроме того, с такой же иммунной идентичностью, что и донор, они могут избежать отторжения и снижения побочных эффектов при имплантировании in vivo . Переход банков пуповинной крови в банки hiPSC для аллогенного лечения имеет огромную возможность и потенциал 42 . Скрининг гомозиготных ОУВ-типизированных CBMC перед перепрограммированием может широко использовать аллогенные линии iPSC дляR клиническое лечение. Гомозиготные линии iPSC могут избежать иммунологических реакций после трансплантации аллотрансплантата. Эта концепция также может быть применена к регенерации хряща путем образования HLA-гомозиготного хряща 11 .

Обычно хондрогенную дифференцировку проводят через две критические стадии: индукцию выведенных из EB клеток клеток и образования гранул. Первоначальное дифференцирование hiPSCs в клетки, полученные из EB-клеток, имеет решающее значение для увеличения их потенциала хондрогенной дифференцировки. Отростки клеток, дифференцированные от hiPSCs, функционально и молекулярно сходны с нативными BMSCs 7 , 43 . В предыдущих исследованиях использовали монослойную культуру или ЭБ-культуру в качестве стадии предварительной дифференцировки для индуцирования мезенхимальноподобных клеток 10 , 43 . Тем не менее, прямая дифференциация монослойной культурой занимает много времени по сравнению с использованием EB, а ch Ондрогенные гранулы имеют тенденцию дифференцироваться в фиброкардит с гипертрофическими характеристиками. Сообщалось, что морфология клеток и потенциал хондрогенной дифференциации генерируемых мезенхимальноподобных клеток-предшественников сильно различаются в зависимости от плотности клеток монослоя клеток 9 .

Мы использовали EB, чтобы индуцировать клетки выроста, что является относительно быстрым и простым методом по сравнению с монослойной культурой. Используя этот протокол, мы смогли генерировать много гранул с использованием относительно небольшого числа hiPSC ( таблица 1 ). Размер и количество ЭБ были критическими для успешного производства хондрогенной массы гранул. По этой причине мы увеличили агрегированные EB в среде E8, пока более половины генерируемых EB не превышали 100 мкм. После расширения EB мы поддерживали EB в среде E8 без FGF2. Ранее исследователи поддерживали генерируемые EB без FGF2 для индукции мезодермальной линииXref "> 9.

Несмотря на то, что мы пытались поддерживать сгенерированные клетки выроста с высокой плотностью для лучшего качества, остается несколько ограничений. Хотя мы подтвердили, что сгенерированные клетки выроста имеют сходную морфологию, клетки могут быть все еще гетерогенными. Предыдущие исследования пытались сортировать по определенному типу клеток; Однако эта процедура привела к сбору небольшого количества ячеек. Новая попытка изолировать гомогенные клетки выроста в большем масштабе потребуетс генерировать большое количество хондрогенных гранул с улучшенными характеристиками.

Различные группы индуцируют клетки-предшественники из hiPSCs с использованием монослойной или EB-культуры. Индукция клеток-предшественников с высоким сходством с MSC может быть ключом к получению хондрогенных гранул более высокого качества. Эти клетки-предшественники, полученные из EB, имеют характеристики, аналогичные характеристикам MSC. Однако это может быть из-заИ фибробластическая природа. Поэтому требуется подробное исследование валидации на клетках выроста.

В этом исследовании мы предлагаем протокол, который может генерировать относительно большое количество хондрогенных гранул. Мы подтвердили, что хрящ, регенерированный с использованием CBMC-hiPSCs, показал здоровый фенотип и может быть использован в качестве материала для регенерации тканей. Однако для дальнейшего применения требуется усовершенствованный метод с более коротким временным интервалом дифференциации. Дальнейшее развитие стандартов контроля качества для проверки хряща с более высоким уровнем гиалина также необходимо для будущих применений CBMC-hiPSCs в качестве клеточного материала для регенерации хряща. Протокол прост, но эффективен и не требует каких-либо дополнительных процессов сортировки до образования гранул. В заключение, используя этот протокол, высококачественные хондрогенные гранулы могут быть получены для исследований моделирования заболеваний, скрининга лекарств и регенеративной медицины для дальнейшего пониманияОн характер хряща.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторам нечего раскрывать.

Acknowledgements

Эта работа была поддержана грантом от проекта исследований и разработок в области технологий здравоохранения в Корее, Министерства здравоохранения, социального обеспечения и по делам семьи, Республика Корея (HI16C2177).

Materials

Name Company Catalog Number Comments
Plasticware
100 mm Dish TPP 93100
6-well Plate TPP 92006
50 mL Cornical Tube SPL 50050
15 mL Cornical Tube SPL 50015
10 mL Disposable Pipette Falcon 7551
5 mL Disposable Pipette Falcon 7543
12-well Plate TPP 92012
Name Company Catalog Number Description
E8 Medium Materials
DMEM/F12, HEPES Life Technologies 11330-057 E8 Medium (500 mL)
Sodium Bicarbonate Life Technologies 25080-094 E8 Medium (Conc.: 543 μg/mL)
Sodium Selenite Sigma Aldrich S5261 E8 Medium  (Conc.: 14 ng/mL)
Human Transfferin Sigma Aldrich T3705 E8 Medium (Conc.: 10.7 μg/mL)
Basic FGF2 Peprotech 100-18B E8 Medium  (Conc.: 100 ng/mL)
Human Insulin Life Technologies 12585-014 E8 Medium (Conc.: 20 μg/mL)
Human TGFβ1 Peprotech 100-21 E8 Medium (Conc.: 2 ng/mL)
Ascorbic Acid Sigma Aldrich A8960 E8 Medium  (Conc.: 64 μg/mL)
DPBS Life Technologies 14190-144
Vitronectin Life Technologies A14700
ROCK Inhibitor Sigma Aldrich Y0503
Name Company Catalog Number Description
Quality Control Materials
18 mm Cover Glass Superior HSU-0111580
4% Paraformaldyhyde Tech & Innovation BPP-9004
Triton X-100 BIOSESANG 9002-93-1
Bovine Serum Albumin Vector Lab SP-5050
Anti-SSEA4 Antibody Millipore MAB4304
Anti-Oct4 Antibody Santa Cruz SC9081
Anti-TRA-1-60 Antibody Millipore MAB4360
Anti-Sox2 Antibody Biolegend 630801
Anti-TRA-1-81 Antibody Millipore MAB4381
Anti-Klf4 Antibody Abcam ab151733
Alexa Fluor 488 goat anti-mouse IgG (H+L) antibody Molecular Probe A11029
Alexa Fluor 594 goat anti-rabbit IgG (H+L) antibody Molecular Probe A11037
DAPI Molecular Probe D1306
Prolong gold antifade reagent Invitrogen P36934
4% Paraformaldyhyde Tech & Innovation BPP-9004
Tween 20 BIOSESANG T1027
Bovine Serum Albumin Vector Lab SP-5050
Anti-Collagen II antibody abcam  ab34712 1:100
Alcian blue Sigma Aldrich A3157-10G
Fast Green FCF Sigma Aldrich F7252-25G
Safranin O Sigma Aldrich 090m0039v
Nuclear fast red Americanmastertech STNFR100 
xylene Duksan 115 
Ethanol Duksan 64-17-5
Mayer's hematoxylin solution wako pure chemical industries LAK7534
DAP VECTOR LABORATORIES SK-4100
Slide Glass, Coated Hyun Il Lab-Mate HMA-S9914
Trizol Invitrogen 15596-018
Chloroform Sigma Aldrich 366919
Isoprypylalcohol Millipore 109634
Ethanol Duksan 64-17-5
RevertAid First Strand cDNA Synthesis kit Thermo Scientfic K1622
Name Company Catalog Number Description
Chondrogenic Differentiation Materials
DMEM Life Technologies 11885 Chondrogenic media component (500 mL)
Penicilin Streptomycin Life Technologies P4333 Chondrogenic media component (Conc.: 1%)
Ascorbic Acid Sigma Aldrich A8960 Chondrogenic media component (Conc.: 64 μg/mL) 
MEM Non-Essential Amino Acids Solution (100x) Life Technologies 11140-050 Chondrogenic media component (Conc.: 100 mM)
rhBMP-2 R&D 355-BM-050 Chondrogenic media component (Conc.:100 ng/ml)
Recombinant Hman TGF-beta3 R&D 243-B3-002 Chondrogenic media component (Conc.:10 ng/ml)
KnockOut Serum Replacement Life Technologies 10828-028 Chondrogenic media component (Conc.: 1%)
ITS+ Premix BD 354352 Chondrogenic media component (Conc.: 1%)
Dexamethasone-Water Soluble  Sigma Aldrich D2915-100MG Chondrogenic media component (Conc.:10-7 M)
GlutaMAX Supplement Life Technologies 35050-061 Chondrogenic media component (Conc.: 1%)
Sodium pyruvate solution Sigma Aldrich S8636 Chondrogenic media component (Conc.: 1%)
L-Proline Sigma Aldrich P5607-25G Chondrogenic media component (40 μg/ml)

DOWNLOAD MATERIALS LIST

References

  1. van Osch, G. J., et al. Cartilage repair: past and future--lessons for regenerative medicine. J Cell Mol Med. 13, (5), 792-810 (2009).
  2. Ahmed, T. A., Hincke, M. T. Strategies for articular cartilage lesion repair and functional restoration. Tissue Eng Part B Rev. 16, (3), 305-329 (2010).
  3. Diekman, B. O., et al. Cartilage tissue engineering using differentiated and purified induced pluripotent stem cells. Proc Natl Acad Sci USA. 109, (47), 19172-19177 (2012).
  4. Solchaga, L. A., Penick, K., Goldberg, V. M., Caplan, A. I., Welter, J. F. Fibroblast growth factor-2 enhances proliferation and delays loss of chondrogenic potential in human adult bone-marrow-derived mesenchymal stem cells. Tissue Eng Part A. 16, (3), 1009-1019 (2010).
  5. Guzzo, R. M., Drissi, H. Differentiation of Human Induced Pluripotent Stem Cells to Chondrocytes. Methods Mol Biol. 1340, 79-95 (2015).
  6. Drissi, H., Gibson, J. D., Guzzo, R. M., Xu, R. H. Derivation and Chondrogenic Commitment of Human Embryonic Stem Cell-Derived Mesenchymal Progenitors. Methods Mol Biol. 1340, 65-78 (2015).
  7. Nejadnik, H., et al. Improved approach for chondrogenic differentiation of human induced pluripotent stem cells. Stem Cell Rev. 11, (2), 242-253 (2015).
  8. Teramura, T., et al. Induction of mesenchymal progenitor cells with chondrogenic property from mouse-induced pluripotent stem cells. Cell Reprogram. 12, (3), 249-261 (2010).
  9. Koyama, N., et al. Human induced pluripotent stem cells differentiated into chondrogenic lineage via generation of mesenchymal progenitor cells. Stem Cells Dev. 22, (1), 102-113 (2013).
  10. Ko, J. Y., Kim, K. I., Park, S., Im, G. I. In vitro chondrogenesis and in vivo repair of osteochondral defect with human induced pluripotent stem cells. Biomaterials. 35, (11), 3571-3581 (2014).
  11. Nam, Y., Rim, Y. A., Jung, S. M., Ju, J. H. Cord blood cell-derived iPSCs as a new candidate for chondrogenic differentiation and cartilage regeneration. Stem Cell Res Ther. 8, (1), 16 (2017).
  12. Hotten, G. C., et al. Recombinant human growth/differentiation factor 5 stimulates mesenchyme aggregation and chondrogenesis responsible for the skeletal development of limbs. Growth Factors. 13, (1-2), 65-74 (1996).
  13. Murphy, M. K., Huey, D. J., Hu, J. C., Athanasiou, K. A. TGF-beta1, GDF-5, and BMP-2 stimulation induces chondrogenesis in expanded human articular chondrocytes and marrow-derived stromal cells. Stem Cells. 33, (3), 762-773 (2015).
  14. Shintani, N., Siebenrock, K. A., Hunziker, E. B. TGF-ss1 enhances the BMP-2-induced chondrogenesis of bovine synovial explants and arrests downstream differentiation at an early stage of hypertrophy. PLoS One. 8, (1), e53086 (2013).
  15. Fukumoto, T., et al. Combined effects of insulin-like growth factor-1 and transforming growth factor-beta1 on periosteal mesenchymal cells during chondrogenesis in vitro. Osteoarthritis Cartilage. 11, (1), 55-64 (2003).
  16. Worster, A. A., Nixon, A. J., Brower-Toland, B. D., Williams, J. Effect of transforming growth factor beta1 on chondrogenic differentiation of cultured equine mesenchymal stem cells. Am J Vet Res. 61, (9), 1003-1010 (2000).
  17. Knippenberg, M., et al. Differential effects of bone morphogenetic protein-2 and transforming growth factor-beta1 on gene expression of collagen-modifying enzymes in human adipose tissue-derived mesenchymal stem cells. Tissue Eng Part A. 15, (8), 2213-2225 (2009).
  18. Jang, Y., et al. Centrifugal gravity-induced BMP4 induces chondrogenic differentiation of adipose-derived stem cells via SOX9 upregulation. Stem Cell Res Ther. 7, (1), 184 (2016).
  19. Kang, R., et al. Mesenchymal stem cells derived from human induced pluripotent stem cells retain adequate osteogenicity and chondrogenicity but less adipogenicity. Stem Cell Res Ther. 6, 144 (2015).
  20. Tao, H., et al. Biological evaluation of human degenerated nucleus pulposus cells in functionalized self-assembling peptide nanofiber hydrogel scaffold. Tissue Eng Part A. 20, (11-12), 1621-1631 (2014).
  21. Sekiya, I., Larson, B. L., Vuoristo, J. T., Reger, R. L., Prockop, D. J. Comparison of effect of BMP-2, -4, and -6 on in vitro cartilage formation of human adult stem cells from bone marrow stroma. Cell Tissue Res. 320, (2), 269-276 (2005).
  22. Shen, B., Wei, A., Tao, H., Diwan, A. D., Ma, D. D. BMP-2 enhances TGF-beta3-mediated chondrogenic differentiation of human bone marrow multipotent mesenchymal stromal cells in alginate bead culture. Tissue Eng Part A. 15, (6), 1311-1320 (2009).
  23. Rim, Y. A., Nam, Y., Ju, J. H. Induced Pluripotent Stem Cell Generation from Blood Cells Using Sendai Virus and Centrifugation. J Vis Exp. (118), (2016).
  24. Kim, Y., et al. The Generation of Human Induced Pluripotent Stem Cells from Blood Cells: An Efficient Protocol Using Serial Plating of Reprogrammed Cells by Centrifugation. Stem Cells Int. 2016, 1329459 (2016).
  25. Oldershaw, R. A., et al. Directed differentiation of human embryonic stem cells toward chondrocytes. Nat Biotechnol. 28, (11), 1187-1194 (2010).
  26. Toh, W. S., et al. Differentiation and enrichment of expandable chondrogenic cells from human embryonic stem cells in vitro. J Cell Mol Med. 13, (9B), 3570-3590 (2009).
  27. Hwang, N. S., Varghese, S., Elisseeff, J. Derivation of chondrogenically-committed cells from human embryonic cells for cartilage tissue regeneration. PLoS One. 3, (6), e2498 (2008).
  28. Nakagawa, T., Lee, S. Y., Reddi, A. H. Induction of chondrogenesis from human embryonic stem cells without embryoid body formation by bone morphogenetic protein 7 and transforming growth factor beta1. Arthritis Rheum. 60, (12), 3686-3692 (2009).
  29. Guzzo, R. M., Scanlon, V., Sanjay, A., Xu, R. H., Drissi, H. Establishment of human cell type-specific iPS cells with enhanced chondrogenic potential. Stem Cell Rev. 10, (6), 820-829 (2014).
  30. Rim, Y. A., Park, N., Nam, Y., Ju, J. H. Generation of Induced-pluripotent Stem Cells Using Fibroblast-like Synoviocytes Isolated from Joints of Rheumatoid Arthritis Patients. J Vis Exp. (116), (2016).
  31. Pfaff, N., et al. Efficient hematopoietic redifferentiation of induced pluripotent stem cells derived from primitive murine bone marrow cells. Stem Cells Dev. 21, (5), 689-701 (2012).
  32. Xu, H., et al. Highly efficient derivation of ventricular cardiomyocytes from induced pluripotent stem cells with a distinct epigenetic signature. Cell Res. 22, (1), 142-154 (2012).
  33. Lee, S. B., et al. Contribution of hepatic lineage stage-specific donor memory to the differential potential of induced mouse pluripotent stem cells. Stem Cells. 30, (5), 997-1007 (2012).
  34. Hu, S., et al. Effects of cellular origin on differentiation of human induced pluripotent stem cell-derived endothelial cells. JCI Insight. 1, (8), 1-12 (2016).
  35. Vonk, L. A., de Windt, T. S., Slaper-Cortenbach, I. C., Saris, D. B. Autologous, allogeneic, induced pluripotent stem cell or a combination stem cell therapy? Where are we headed in cartilage repair and why: a concise review. Stem Cell Res Ther. 6, (94), 1-11 (2015).
  36. Gomez-Leduc, T., et al. Chondrogenic commitment of human umbilical cord blood-derived mesenchymal stem cells in collagen matrices for cartilage engineering. Sci Rep. 6, 32786 (2016).
  37. Mareschi, K., et al. Isolation of human mesenchymal stem cells: bone marrow versus umbilical cord blood. Haematologica. 86, (10), 1099-1100 (2001).
  38. Wexler, S. A., et al. Adult bone marrow is a rich source of human mesenchymal 'stem' cells but umbilical cord and mobilized adult blood are not. Br J Haematol. 121, (2), 368-374 (2003).
  39. Zhang, X., et al. Isolation and characterization of mesenchymal stem cells from human umbilical cord blood: reevaluation of critical factors for successful isolation and high ability to proliferate and differentiate to chondrocytes as compared to mesenchymal stem cells from bone marrow and adipose tissue. J Cell Biochem. 112, (4), 1206-1218 (2011).
  40. Wagner, W., et al. Replicative senescence of mesenchymal stem cells: a continuous and organized process. PLoS One. 3, (5), e2213 (2008).
  41. Tarte, K., et al. Clinical-grade production of human mesenchymal stromal cells: occurrence of aneuploidy without transformation. Blood. 115, (8), 1549-1553 (2010).
  42. Chen, W. C., et al. Prediction of poor survival by cyclooxygenase-2 in patients with T4 nasopharyngeal cancer treated by radiation therapy: clinical and in vitro studies. Head Neck. 27, (6), 503-512 (2005).
  43. Guzzo, R. M., Gibson, J., Xu, R. H., Lee, F. Y., Drissi, H. Efficient differentiation of human iPSC-derived mesenchymal stem cells to chondroprogenitor cells. J Cell Biochem. 114, (2), 480-490 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics