Chondrogene Pelletbildung aus Cord Blut-induzierten induzierten pluripotenten Stammzellen

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Hier schlagen wir ein Protokoll für die chondrogene Differenzierung von Nervenblut mononuklearen Zell-abgeleiteten menschlichen induzierten pluripotenten Stammzellen vor.

Cite this Article

Copy Citation | Download Citations

Nam, Y., Rim, Y. A., Ju, J. H. Chondrogenic Pellet Formation from Cord Blood-derived Induced Pluripotent Stem Cells. J. Vis. Exp. (124), e55988, doi:10.3791/55988 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Der menschliche Knorpelknorpel fehlt die Fähigkeit, sich selbst zu reparieren. Knorpeldegeneration wird also nicht durch kurative, sondern durch konservative Behandlungen behandelt. Derzeit werden Anstrengungen unternommen, um beschädigten Knorpel mit ex vivo expandierten Chondrozyten oder Knochenmark-abgeleiteten mesenchymalen Stammzellen (BMSCs) zu regenerieren. Die eingeschränkte Lebensfähigkeit und Instabilität dieser Zellen begrenzen jedoch ihre Anwendung bei der Knorpelrekonstruktion. Menschliche induzierte pluripotenten Stammzellen (hiPSCs) haben wissenschaftliche Aufmerksamkeit als neue Alternative für regenerative Anwendungen erhalten. Mit unbegrenzter Selbsterneuerungsfähigkeit und Multipotenz wurden hiPSCs als neue Ersatzzellenquelle für die Knorpelreparatur hervorgehoben. Allerdings ist die Erlangung einer hohen Menge an hochwertigen chondrogenen Pellets eine große Herausforderung für ihre klinische Anwendung. In dieser Studie verwendeten wir Embryoidkörper (EB) -geleitete Auswuchszellen für die chondrogene Differenzierung. Die erfolgreiche Chondrogenese wurde durch PCR undD-Färbung mit alcianblauem, Toluidinblau und Antikörpern gegen Kollagenarten I und II (COL1A1 bzw. COL2A1). Wir bieten eine detaillierte Methode zur Differenzierung von Nervenblutmononukleären Zellen-abgeleiteten iPSCs (CBMC-hiPSCs) in chondrogene Pellets.

Introduction

Die Verwendung von hiPSCs stellt eine neue Strategie für Arzneimittel-Screening und mechanistische Studien verschiedener Krankheiten dar. Aus einer regenerativen Perspektive sind hiPSCs auch eine potentielle Quelle für den Ersatz von beschädigten Geweben, die eine begrenzte Heilfähigkeit aufweisen, wie z.B. Gelenkknorpel 1 , 2 .

Die Regeneration des nativen Knorpelknorpels ist seit Jahrzehnten eine Herausforderung. Gelenkknorpel ist ein weiches, weißes Gewebe, das das Ende der Knochen beschichtet und sie vor Reibung schützt. Allerdings hat es begrenzte regenerative Fähigkeit, wenn beschädigt, die Selbst-Reparatur fast unmöglich macht. Daher ist die Forschung über die Knorpelregeneration seit mehreren Jahrzehnten im Gange.

Bisher wurde in vitro die Differenzierung in die chondrogene Linie üblicherweise mit BMSCs oder nativen Chondrozyten durchgeführt, die aus dem Kniegelenk isoliert wurden 3 . Fällig tO ihr chondrogenes Potenzial, BMSCs und native Chondrozyten haben zahlreiche Verdienste, die ihre Verwendung in der Chondrogenese unterstützen. Wegen ihrer begrenzten Ausdehnung und ihres instabilen Phänotyps stehen diese Zellen jedoch vor einer Einschränkung bei der Rekonstruktion von Gelenkknorpeldefekten. Unter in vitro- Kulturbedingungen neigen diese Zellen dazu, ihre eigenen Eigenschaften nach 3-4 Passagen zu verlieren, was schließlich ihre Differenzierungsfähigkeit beeinflusst 4 . Auch bei nativen Chondrozyten ist bei der Gewinnung dieser Zellen eine zusätzliche Schädigung des Kniegelenks unvermeidlich.

Im Gegensatz zu BMSCs oder nativen Chondrozyten können sich hiPSCs in vitro unendlich erweitern. Mit den richtigen Kulturbedingungen haben hiPSCs ein großes Potenzial als Ersatzquelle für die chondrogene Differenzierung. Allerdings ist es schwierig, die intrinsischen Eigenschaften von hiPSCs 5 zu ändern. Darüber hinaus dauert es mehrere komplizierte in vitro stePs, um das Schicksal von hiPSCs auf einen bestimmten Zelltyp zu lenken. Trotz dieser Komplikationen wird die Verwendung von hiPSCs aufgrund ihrer hohen Selbsterneuerungsfähigkeiten und ihrer Fähigkeit, in zielgerichtete Zellen, einschließlich Chondrozyten, zu differenzieren, noch empfohlen.

Die chondrogene Differenzierung erfolgt üblicherweise mit dreidimensionalen Kultursystemen wie der Pelletkultur oder der Mikromassenkultur unter Verwendung von MSC-ähnlichen Progenitorzellen. Bei der Verwendung von hiPSCs unterscheidet sich das Protokoll zur Erstellung von MSC-ähnlichen Progenitorzellen von den vorhandenen Protokollen. Einige Gruppen verwenden eine Monolayer-Kultur von hiPSCs, um den Phänotyp direkt in MSC-ähnliche Zellen umzuwandeln 7 . Allerdings verwenden die meisten Studien EBs, um Auswuchszellen zu erzeugen, die den MSCs 8 , 9 , 10 , 11 ähneln.

Verschiedene Arten von Wachstumsfaktoren werden verwendet, um Chondroge zu induzierenNesis Normalerweise werden BMP- und TGF & bgr; -Familie-Proteine ​​allein oder in Kombination verwendet. Die Differenzierung wurde auch mit anderen Faktoren wie GDF5, FGF2 und IGF1 12 , 13 , 14 , 15 induziert. Es wurde gezeigt, dass TGFβ1 die Chondrogenese dosisabhängig in MSCs 16 stimuliert. Im Vergleich zum anderen Isotyp induziert TGF & bgr; 3, TGF & bgr; 1 die Chondrogenese durch Erhöhung der Mortochymal-Zellkondensation vor dem Knorpel. TGF & bgr; 3 induziert die Chondrogenese durch signifikante Erhöhung der mesenchymalen Zellproliferation 17 . Allerdings wird TGFβ3 häufiger von Forschern als TGFβ1 7 , 10 , 18 , 19 verwendet. BMP2 verstärkt die Expression von Genen, die mit den chondrogenen Matrixkomponenten im Menschen zusammenhängenArtikuläre Chondrozyten unter in vitro Bedingungen 20 . BMP2 erhöht die Expression von Genen, die für die Knorpelbildung in MSCs in Kombination mit TGFβ-Proteinen kritisch sind. Es wurde auch gezeigt, dass BMP2 die Wirkung von TGF & bgr; 3 durch die Smad- und MAPK-Wege 22 synergistisch verstärkt.

In dieser Studie wurden CBMC-hiPSCs in EBs unter Verwendung von EB-Medium in einer Petrischale mit geringer Anlagerung aggregiert. Auswuchszellen wurden durch Anbringen der EBs an eine mit Gelatine beschichtete Schale induziert. Die chondrogene Differenzierung unter Verwendung von Auswuchszellen wurde durch Pelletkultur durchgeführt. Die Behandlung mit sowohl BMP2 als auch TGFβ3 kondensierte erfolgreich die Zellen und induzierte extrazelluläre Matrix (ECM) Protein-Akkumulation für die chondrogene Pelletbildung. Diese Studie schlägt ein einfaches, aber effizientes chondrogenes Differenzierungsprotokoll unter Verwendung von CBMC-hiPSCs vor.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Dieses Protokoll wurde vom institutionellen Überprüfungsausschuss der katholischen Universität von Korea (KC12TISI0861) genehmigt. CBMCs, die für die Umprogrammierung verwendet wurden, wurden direkt von der Cord Blood Bank des Seoul St. Mary's Hospital erhalten.

1. Chondrogene Differenzierung von iPSCs

  1. CBMC-iPSC Generation
    1. Generiere CBMC-hiPSCs mit dem in unserer vorherigen Arbeit gezeigten Protokoll 23 .
    2. Sammle die Blutzellen in einem 15 ml konischen Röhrchen und zähle sie mit einem Hämocytometer.
    3. 3 x 10 5 Zellen vorbereiten und 5 min bei 515 xg und RT zentrifugieren. Verwerfen Sie den Überstand durch Absaugen und resuspendieren die Zellen in 0,5 ml Blutzellmedium.
    4. Übertragen Sie die Zellen auf eine Vertiefung einer nicht beschichteten 24-Well-Platte und fügen Sie die Sendai-Virus-Mischung hinzu, nach den Empfehlungen des Herstellers.
    5. Zentrifugieren Sie die Platte für 30 min bei 1.150 xg und 30 ° C.
    6. AchternEr zentrifugieren, die Zellen über Nacht (O / N) bei 37 ° C in 5% CO 2 inkubieren.
    7. Am nächsten Tag übertragen Sie die transduzierten Zellen in eine Matrix-beschichtete Quelle. Zentrifugieren Sie die Platte bei 1.150 xg für 30 min bei 30 ° C.
    8. Nach der Zentrifugation den Überstand entfernen, 1 ml iPSC-Medium zugeben und die Zellen O / N bei 37 ° C in 5% CO 2 aufbewahren.
    9. Halten Sie die angehefteten Zellen bei 37 ° C und 5% CO 2 . Ändern Sie das Medium täglich und ersetzen Sie es mit frischem iPSC-Medium.
      ANMERKUNG: Kolonien erscheinen am Tag 14-21 nach der Transduktion.
  2. EB-Erzeugung
    1. Halten Sie die HIPSCs bei 37 ° C und 5% CO 2 . Ändern Sie das Medium täglich und ersetzen Sie es mit frischem Essential 8 (E8) Medium.
    2. 2 x 10 6 hiPSCs in einer vitronectinbeschichteten, 100-mm-Schale in E8-Medium vorbereiten.
    3. Das E8-Medium aus der Kulturschale nehmen und mit steriler phosphatgepufferter Kochsalzlösung (PBS) waschen.
    4. Hinzufügen 1Ml 1 mM Ethylendiamintetraessigsäure (EDTA) gelöst und bei 37 ° C und 5% CO 2 für 2 min inkubiert.
    5. Die Zellen mit 3 ml E8-Medium ernten und in ein neues 15-ml-Kegelrohr überführen. Die Zellen bei 250 xg bei Raumtemperatur (RT) für 2 min zentrifugieren.
    6. Ansaugen des Überstandes, ohne das Zellpellet zu stören und die Zellen in 5 ml E8-Medium zu resuspendieren.
    7. Zählen Sie die Zellen mit einem Hämocytometer und bereiten 2 x 10 6 Zellen für jede 100 mm Petrischale vor. Die vorbereiteten Zellen in einer 10-ml-Mischung aus E8- und EB-Medium (1: 1) mit 10 μM Rho-assoziiertem Kinase (ROCK) -Inhibitor resuspendieren.
    8. Inkubieren der Zellen O / N für die Aggregation bei 37 ° C und 5% CO 2 .
    9. Am nächsten Tag ernten Sie die aggregierten EBs durch Pipettieren. Zentrifugieren Sie die Zellen bei 250 xg für 1 min. Den Überstand entfernen und die EBs in 10 ml frischem E8-Medium resuspendieren.
    10. Vergrößere die erzeugten EBs für 5 Tage, tägliche Änderungen mit fresH E8 mittel. Zur weiteren Reifung wechseln Sie das Kulturmedium auf E7-Medium. Halten Sie die EBs bei 37 ° C und 5% CO 2 für weitere 5 Tage, wobei täglich mittlere Veränderungen mit frischem E7-Medium durchgeführt werden.
      HINWEIS: E7-Medium ist E8-Medium ohne FGF2.
  3. Auswuchszell-Induktion von EBs
    1. Füge 6 ml 1% ige Gelatine zu einer 100-mm-Schale hinzu und inkubiere bei 37 ° C und 5% CO 2 für 30 min.
    2. Entfernen Sie die Gelatine und trocknen Sie die Schale für 2-3 Stunden vor Gebrauch.
    3. Übertragen Sie die EBs auf ein 50-ml-Kegelrohr. Lassen Sie die EBs auf den Boden des konischen Rohres absetzen. Entfernen Sie den Überstand, ohne die EBs zu stören.
    4. Die EBs in 10 ml Dulbecco's Modified Eagle's Medium (DMEM) mit 20% fötalem Rinderserum (FBS) resuspendieren. Übertragen Sie die EBs auf die Gelatine-beschichtete, 100-mm-Schale. 10 μM ROCK-Inhibitor hinzufügen.
    5. Inkubieren und pflegen die Zellen bei 37 ° C und 5% CO 2 für 7 Tage. Ändere michDium jeden zweiten Tag ohne Zugabe von ROCK-Inhibitor.
  4. Chondrogene Pelletbildung
    1. Das Kulturmedium aus der Schale einatmen und die Zellen dreimal mit PBS waschen.
    2. 1 ml 1 mM EDTA auftragen und bei 37 ° C und 5% CO 2 für 2 min inkubieren.
    3. Die Zellen mit 5 ml DMEM mit 20% FBS ernten und in ein neues 15-ml-Kegelrohr überführen.
    4. Die Zellen für 2 min bei 250 xg und RT zentrifugieren. Den Überstand verwerfen und das Pellet in 10 ml DMEM mit 20% FBS resuspendieren.
    5. Filter und entsorgen Sie die Zellklumpen mit einem 40 μm Zellsieb und ernten Sie die einzelnen Zellen. Zähle die einzelnen Zellen mit einem Hämocytometer.
    6. Die Zellen für 2 min bei 250 xg und RT zentrifugieren. Entfernen Sie den Überstand und säen Sie 3 x 10 5 Zellen pro Pellet in einem 15 ml konischen Röhrchen mit 300 μl chondrogenem Differenzierungsmedium (CDM).
    7. Zur Pelletbildung zentrifugieren die Zellen für 5 min bei680 xg und RT.
      ANMERKUNG: Pellets werden in 15 ml konischen Rohren während der Differenzierung der chondrogenen Pellets gehalten.
    8. Inkubieren der Zellen über Nacht bei 37 ° C und 5% CO 2 .
    9. Ändern Sie das CDM alle 2-3 Tage. Innerhalb von 3 Tagen werden Pellets abgeflachte, sphäroidische Morphologien aufweisen. Halten Sie die Pellets für 21 Tage bei 37 ° C und 5% CO 2 .

2. Chondrogene Pelletcharakterisierung durch Färbung

  1. Chondrogene Einbettung
    1. Vor dem Einbetten, Vorbereiten und Schmelzen von Paraffin bei 58 ° C.
    2. Fixieren Sie die Pellets in 1 ml 4% Paraformaldehyd für 2 h bei RT in einem 1,5 ml-Röhrchen.
      Achtung: Paraformaldehyd ist hochgiftig. Vermeiden Sie Kontakt mit Augen, Haut oder Schleimhäuten. Minimieren Sie die Belichtung und vermeiden Sie das Einatmen bei der Vorbereitung.
    3. Legen Sie eine Schicht Gaze auf die Kassette und übertragen Sie die festen Pellets mit einer Pipette. Decken Sie das Pellet durch FaltenE gauze und den Kassettendeckel schließen.
    4. Die Dehydratation in 100 ml 70% igem Ethanol (EtOH) zweimal, jeweils 10 min, einleiten. Dehydrieren der Pellets durch aufeinanderfolgende 10-minütige Waschungen in 80% und 95% EtOH.
    5. Übertragen Sie die Pellets auf 100% EtOH für 10 min. Wiederholen Sie dreimal mit frischem EtOH.
    6. Zur "Klärung" wird die Lösung für eine 100 ml, 1: 1 Mischung aus EtOH und Xylol ausgetauscht, gefolgt von einem 1: 2-Gemisch aus EtOH und Xylol für jeweils 10 min. Das restliche EtOH durch zweimaliges Inkubieren der Pellets in 100% Xylol, jeweils 10 min, abkühlen lassen.
    7. Zur Paraffininfiltration inkubieren die Pellets in aufeinanderfolgenden Xylol- und Paraffingemischen. Führen Sie den gesamten Paraffin-Infiltrationsprozess bei 58 ° C durch. Inkubieren Sie die Pellets in 100 ml einer 2: 1 Mischung aus Xylol und Paraffin für 30 min.
    8. Austausch der Lösung für 100 ml einer 1: 1 Mischung aus Xylol und Paraffin und inkubieren für 30 min.
    9. Austausch der Lösung für 100 ml einer 1: 2-Mischung aus Xylol und Paraffin und inkubieren für 30 min.
    10. Für die endgültige Infiltration, übertragen Sie die Pellets auf das erste Bad von 100% Paraffin und inkubieren für 2 h.
    11. Übertragen Sie die Pellets auf das zweite Bad von 100% Paraffin und inkubieren Sie O / N bei 58 ° C.
    12. Am nächsten Tag transportiere man die Pellets sanft mit einer Pinzette in eine Form. Fügen Sie Paraffin der Form aus dem Paraffinspender hinzu. Das Paraffin für 30 min bei 4 ° C festigen.
    13. Die Abschnitte auf 7 μm schneiden und die Abschnitte auf die Folie überführen. Lassen Sie die Objektträger über Nacht trocknen und lagern Sie die Folien auf RT, bis sie gebrauchsfertig sind.
  2. Folienvorbereitung
    1. Deparaffinieren Sie die Objektträger, indem Sie sie durch 100 ml von 100%, 90%, 80% und 70% EtOH nacheinander für jeweils 5 min bewegen.
    2. Legen Sie die Objektträger in ein Glasgefäß und spülen Sie mit Leitungswasser für 5 min.
  3. Alcian blaue Färbung
    1. Inkubieren Sie die Objektträger in 50 ml einer 1% alcianblauen Lösung für 30 min.
      NICHTE: Alcianblau wird in 3% iger Essigsäurelösung verdünnt. Den pH-Wert mit Acetinsäure auf 2,5 einstellen.
    2. Legen Sie die Objektträger in ein Glasglas und spülen Sie mit Leitungswasser für 2 min.
    3. Spülen Sie die Folien in deionisiertem Wasser (DW) und Gegenfärbung mit nuklearer schneller roter Lösung für 2 min.
    4. Legen Sie die Objektträger in ein Glasgefäß und spülen Sie mit Leitungswasser für 1 min.
    5. 2.3.5) Um die Folien in Schritt 2.6 zu dehydrieren und zu montieren,
  4. Toluidin-Blau-Färbung
    1. Inkubieren von Objektträgern in 50 ml Toluidinblau-Lösung für 4 min.
    2. Legen Sie die Objektträger in ein Glasgefäß und spülen Sie mit Leitungswasser für 5 min.
    3. Fahren Sie mit der Entwässerung und Montage der Folien in Schritt 2.6 fort.
  5. Immunhistochemische Färbung
    1. Inkubieren Sie die Objektträger in 3% H 2 O 2 für 15 min für endogene Peroxidase-Blockierung.
    2. Tragen Sie 200 μl Primärantikörper (anti-COL1A1 und -COL2A1), verdünnt 1: 100 in Tris-bu(TBS), enthaltend 1% Rinderserumalbumin (BSA) und 5% normales Ziegenserum (NGS) zu den Objektträgern und inkubieren O / N bei 4 ° C.
    3. Am nächsten Tag legen Sie die Objektträger in ein Glasgefäß und waschen sie mit 50 ml TBS, die 0,1% Polysorbat 20 (TBST) dreimal für jeweils 5 min enthält.
    4. Tragen Sie 200 μl Sekundärantikörper (Ziegen-Anti-Kaninchen-IgG-Antikörper, verdünnt 1: 200 in TBS mit 1% BSA und 5% NGS) auf die Objektträger und inkubieren bei RT für 40 min.
    5. Legen Sie die Objektträger in ein Glasgefäß und waschen Sie sie dreimal mit 50 ml, jeweils 5 min.
    6. Zur Signalverstärkung die HRP-konjugierte Streptavidin-Lösung auf die Objektträger auftragen und 10 min inkubieren.
    7. Legen Sie die Objektträger in ein Glasgefäß und waschen Sie sie dreimal mit 50 ml, jeweils 5 min.
    8. Die DAB-Peroxidase-Substratlösung mischen, 200 μl Lösung auf jede Folie auftragen und 1 min inkubieren.
    9. Legen Sie die Objektträger in ein Glasgefäß und spülen Sie mit Leitungswasser für 5 min.
    10. GegenschlagMit Mayers Hämatoxylin für 1 min.
    11. Waschen Sie die Folien mit DW.
    12. Fahren Sie mit der Entwässerung und Montage der Folien in Schritt 2.6 fort.
  6. Dehydrierung und Montage
    1. Dehydrieren Sie die Objektträger, indem Sie sie nacheinander durch 100 ml 70%, 80%, 90% und 100% EtOH, jeweils 30 s, bewegen.
    2. Tauchen Sie die Folien in zwei Änderungen von Xylol für jeweils 1 min.
    3. Fügen Sie 50 μl Montagelösung zu den Deckgläsern hinzu und legen Sie die Folien auf die Oberseite.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

In dieser Studie erzeugten wir chondrogene Pellets aus CBMC-hiPSCs, indem sie Auswuchszellen aus EBs induzierten. Die chondrogene Differenzierung wurde mit CBMC-hiPSCs mit bestätigter hoher Pluripotenz induziert 11 . Ein einfaches Schema unseres Protokolls ist in Fig. 1A gezeigt . Vor der Differenzierung wurden iPSC-Kolonien erweitert (Abbildung 1B ). Die erweiterten iPSCs wurden als EBs zusammengesetzt, um die Differenzierung zu initiieren (Abbildung 1C ). Die erzeugten EBs wurden an Gelatine-beschichtete Schalen befestigt, um Auswuchszellen zu induzieren (Abbildung 1D ). Dann wurden die Auswuchszellen geerntet und zur Erzeugung von chondrogenen Pellets verwendet. Nach 21 Tagen der Differenzierung wurden kleine, perlenartige chondrogene Pellets erhalten und zur weiteren Charakterisierung verwendet (Abbildung 1E ). Die Qualität des in vitro erzeugten ChonsDrogene Pellets wurde durch verschiedene Assays bestätigt.

Wir haben die Qualität der chondrogenen Pellets am Tag 21 histologisch ausgewertet. BMSC-Chondrogenpellets wurden als Positivkontrolle verwendet. Die Akkumulation von ECM-Proteinen, die durch die differenzierten Chondrozyten sezerniert wurden, wurde durch alcianblau und Toluidin-Blau-Färbung in Fig. 2A bestätigt. Die Hauptmerkmale des gesunden Knorpels, wie die Lovuna und die Proteoglykanproduktion, stiegen, da der Differenzierungsprozess über 21 Tage fortgesetzt wurde. Chondrogene Pellets, die aus CBMC-hiPSCs erzeugt wurden, exprimierten COL2A1, welches die Haupt-ECM-Komponente im gesunden Knorpel ist (Abbildung 2B ). Die COL2A1-Expression von CBMC-hiPSC-abgeleiteten Pellets war höher als die von BMSC-abgeleiteten Pellets. Die Expression von Kollagen Typ I, ein Marker für fibrotischen Knorpel, war in CBMC-hiPSC-abgeleiteten Pellets im Vergleich zur Expression von COL2A1 niedriger. Die Genexpression von Knorpel-ECM-Proteinen in Tag-21-chondrogenen Pellets wurde durch Echtzeit-PCR bestätigt. Die Aggrecan (ACAN) -Expression von CBMC-hiPSC-abgeleiteten Pellets war ähnlich der von BMSC-abgeleiteten Pellets ( 3A ). Die Expression von COL2A1 war in CBMC-hiPSC-abgeleiteten Pellets signifikant höher (Abbildung 3B ). Der Ausdruck der sexbestimmenden Region Y-Box 9 (Sox9), ein chondrogener Progenitor-Marker, wurde ebenfalls ausgewertet. Pellets, die aus CBMC-hiPSCs erzeugt wurden, zeigten ein hohes Maß an Sox9 (Abbildung 3C ). Wir bestätigten, dass diese Gene in CBMC-hiPSC-chondrogenen Pellets im Vergleich zu BMSC-Kontrollpellets am Tag 21 signifikant hochreguliert wurden. Die Expression eines hypertrophischen Markers, COL1A1, wurde ausgewertet (Abbildung 3D ). Die Expression von COL1A1 in CBMC-hiPSC-abgeleiteten Pellets wurde im Vergleich zu dem in BMSC-deri reduziertVed Pellets. Die Differenzierungseffizienz wurde durch das Verhältnis von COL2A1 zu COL1A1 (Abbildung 3E ) analysiert. Die Inkrementierung des Verhältnisses in CBMC-hiPSC-abgeleiteten Pellets zeigte die relativ hohe Expression von COL2A1 im Vergleich zu COL1A1. Abschließend haben wir die chondrogene Differenzierungskapazität von CBMC-hiPSCs bestätigt. Die Qualität der erzeugten CBMC-hiPSC-abgeleiteten chondrogenen Pellets hatte eine Qualität, die mit der von BMSCs kompatibel war.

Abbildung 1
Abbildung 1: Chondrogene Differenzierung von hiPSCs. ( A ) Schema der chondrogenen Pelletbildung aus hiPSCs. ( B ) Morphologie des erzeugten CBMC-hiPSC. ( C ) Morphologie der erzeugten EBs ( D ) Auswuchszellen, die von EBs abgeleitet sind, die an eine mit Gelatine beschichtete Kulturschale gebunden sind ( E ) Bild von t Er chondrogenes Pellet nach 21 Tagen Differenzierung. Die Einheiten der Intervalle sind in Millimeter angegeben. Maßstäbe = 200 μm Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Figur 2
Abbildung 2: Histologische Analyse des chondrogenen Pellets. ( A ) Histologische Auswertung von chondrogenen Pellets am Tag 21 unter Verwendung von alcianblauer und toluidinblauer Färbung ( B ) Immunhistochemiebild von chondrogenen Pellets, gefärbt mit COL1A1- und COL2A1-Antikörpern. Maßstäbe = 100 μm. Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

1 "> Abbildung 3
Abbildung 3: Genexpression des chondrogenen Pellets. ( A ) Relative Genexpression von ACAN ( B ) Relative Genexpression von COL2A1. ( C ) Relative Genexpression von SOX9 ( D ) Relative Genexpression von COL1A1. ( E ) Genexpression von COL1A1. ( F ) Genexpression von COL10A1. ( G ) Das Verhältnis von COL2A1: COL1A1-Genexpression Pellets wurden nach 21 Tagen Differenzierung geerntet und analysiert. Die Daten wurden unter Verwendung von Echtzeit-PCR erhalten und als mittlerer Standardfehler von dreifachen Experimenten pro Probe (n = 3) angezeigt. Die Genexpression wurde auf GAPDH als interne Kontrolle normalisiert. (* P <0,05, ** p <0,01, p <0,001).K "> Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Handynummer Auswuchszell-Ausbeute Pelletausbeute
HiPSCs 2 x 10 6 2-5 x 10 7 70-150
MSC 2 x 10 6 - 6

Tabelle 1: Ertragsvergleich von MSC und hiPSCs.

Zielname Richtung Primer Sequenz Größe
Vorwärts TTCCGCGACGTGGACAT 77 bp
Umkehren TCAAACTCGTTGACATCGAAGGT
EINE KANNE Vorwärts AGCCTGCGCTCCAATGACT 107 bp
Umkehren TAATGGAACACGATGCCTTTCA
COL2A1 Vorwärts GGCAATAGCAGGTTCACGTACA 79 bp
Umkehren CGATAACAGTCTTGCCCCACTTA
COL1A1 Vorwärts CCCCTGGAAAGAATGGAGATG 148 bp
Umkehren TCCAAACCACTGAAACCTCTG

Tabelle 2: Sequenzen von Primern gegen chondrogene Marker in Echtzeit-PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Dieses Protokoll hat erfolgreich HIPSCs von CBMCs generiert. Wir programmierten CBMCs zu hiPSCs unter Verwendung eines Sendai Virusvektors, der Yamanaka Faktoren enthält 24 . Drei Fälle wurden in der Differenzierung verwendet, und alle Experimente erzeugten erfolgreich chondrogene Pellets unter Verwendung dieses Protokolls. Zahlreiche Studien haben Protokolle für die Differenzierung von hiPSCs in Chondrozyten 25 , 26 , 27 , 28 gemeldet. Allerdings ist eine zusätzliche Forschung erforderlich, um die Verwendung von CBMC-hiPSCs einen Kandidaten für die Knorpelregeneration und -wiederherstellung zu bestätigen.

Die Chondrogenese wurde unter Verwendung von hiPSCs, die aus verschiedenen somatischen Zelltypen 11 , 25 , 26 , 27 , 29 erzeugt wurden, bestätigt. Viele Berichte zeigenDass der Ursprung der somatischen Zelle, die bei der Umprogrammierung verwendet wird, das Differenzierungsergebnis der hiPSCs 30 , 31 , 32 , 33 beeinflussen kann. Nabelschnurblut ist eine Quelle, die mit HSCs und MSCs angereichert ist. Es gibt keinen Bericht über den Unterschied zwischen Nabelschnurblut-abgeleiteten Zellen, wie Blutzellen oder MSCs. Allerdings haben frühere Studien gezeigt, dass artikuläre Chondrozyten-abgeleitete hiPSCs eher durch Chondrogenese als hiPSCs entstehen, die aus Nabelschnurblut oder Hautfibroblasten erzeugt werden 29 . Ergebnisse aus der endothelialen Differenzierung unter Verwendung von HiPSCs, die aus Fibroblasten, Herzvorläuferzellen und Endothelzellen erzeugt wurden, zeigten, dass das Gewebe des Ursprungs das gewebespezifische somatische Gedächtnis in der endständig differenzierten iPSC-Ableitung, insbesondere in frühen Passagen, zwischen 10 und 20 34 widerspiegeln kann. In frühen Passagen von hiPSCs, endothelialen Zell-DeriVed hiPSCs differenzierter effizienter in die endotheliale Linie. Allerdings verschwand der signifikante Unterschied zwischen diesen Zelllinien in hiPSCs über 20 Passagen. Daher ist es wichtig, das somatische Gedächtnis, das von den hiPSCs in frühen Passagen getragen wird, sorgfältig zu betrachten, wenn sie in der klinischen Forschung verwendet werden.

In letzter Zeit wurden verschiedene Verfahren entwickelt, um den defekten Gelenkknorpel zu reparieren. Die Mikrofraktur wird durch Bohren von mehreren Löchern im Knochen durchgeführt, um den Zustrom von Knochenmark für die natürliche Reparatur zu induzieren. Knie-Ersatz, auch bekannt als Knie-Arthroplastie, wird verwendet, um den beschädigten Knorpel zu ersetzen. Allerdings ist die Mikrofraktur nicht für schwere Gelenkknorpelschäden geeignet, und das für Knieersatz verwendete Instrument muss alle 10-15 Jahre gewechselt werden.

In diesen Tagen sind zellbasierte Therapien eine vielversprechende Alternative für die Knorpelreparatur. Die autologe Chondrozytenimplantation (ACI) ist breitFür die zellbasierte Knorpelgewinnung verwendet. ACI wird durch direktes Injizieren von autologen Chondrozyten in den Defekt durchgeführt. Allerdings verwandeln sich autologe Chondrozyten unter In-vitro- Kultivierungsbedingungen in fibroblastenähnliche Zellen. Zusätzlicher Schaden ist auch während des Ernteprozesses von autologen Chondrozyten unvermeidlich. MSCs wurden als Zellquelle für die Knorpelgewinnung vorgeschlagen. Nabelschnurblut ist eine nützliche und zugängliche Zellquelle von MSCs für den Konstruktionsknorpel 36 . Die Erfolgsquote für die Isolierung von Cord-Blut-MSCs ist jedoch umstritten 37 , 38 . Zahlreiche Studien berichten über die erfolgreiche Isolierung von Nabelschnurblut-MSCs. Mehrere Studien haben gezeigt, dass das Nabelschnurblutvolumen ein kritischer Parameter ist, der die Ausbeute der MSC-Isolation 36 , 39 beeinflussen kann . Um qualitativ hochwertige MSCs zu erwerben, ist auch der Durchgang der Zellen kritisch. Frühere Studien zeigen thaT MSCs haben eine eingeschränkte Lebensdauer nach einer bestimmten Zellteilungsnummer. Durch die Eingabe von Seneszenz sind die MSCs durch eine verminderte Proliferation gekennzeichnet, wie bei jeder normalen somatischen Zelle 40 . Daher müssen Nabelschnurblut-abgeleitete MSCs vor der sechsten Passage verwendet werden, um Zell-Seneszenz und chromosomale Anomalien zu vermeiden 41 .

Um diese Einschränkungen zu vermeiden, eröffnete menschliche iPSCs eine neue Möglichkeit für eine personalisierte, zellbasierte Therapie mit hoher Produktivität 11 . Etablierte hiPSCs können sich theoretisch grenzenlos vermehren. Auch mit der gleichen Immunidentität wie der Spender können sie Ablehnung und niedrigere Nebenwirkungen vermeiden, wenn sie in vivo implantiert werden . Der Übergang von Nabelschnurblutbanken in hiPSC-Banken für allogene medizinische Behandlung hat enorme Möglichkeiten und Potenziale 42 . Das Screening von homozygoten HLA-typisierten CBMCs vor der Umprogrammierung kann weitgehend die allogenen iPSC-Linien nutzenKlinische Behandlung. Homozygote iPSC-Linien können nach der Allotransplantation immunologische Reaktionen vermeiden. Dieses Konzept kann auch auf die Knorpelregeneration angewendet werden, indem man HLA-homozygoten Knorpel 11 erzeugt .

In der Regel wird die chondrogene Differenzierung durch zwei kritische Schritte durchgeführt: die Induktion von EB-abgeleiteten Auswuchszellen und Pelletbildung. Die anfängliche Differenzierung von hiPSCs in EB-abgeleitete Auswuchszellen ist entscheidend, um ihr chondrogenes Differenzierungspotential zu erhöhen. Auswuchszellen, die von hiPSCs differenziert sind, funktional und molekular ähnlich zu den nativen BMSCs 7 , 43 . Bisherige Studien verwendeten Monolayerkultur oder EB-Kultur als Prädifferenzierungsschritt zur Induktion mesenchymaler Zellen 10 , 43 . Allerdings ist die direkte Differenzierung durch Monolayer-Kultur zeitaufwändig im Vergleich zur Verwendung von EBs und ch Ondrogene Pellets neigen dazu, in Fibrocartilage mit hypertrophischen Eigenschaften zu differenzieren. Es wurde berichtet, dass die Zellmorphologie und das chondrogene Differenzierungspotential der erzeugten mesenchymalartigen Vorläuferzellen sich entsprechend der Zelldichte der Zellmonoschicht 9 stark unterscheiden.

Wir verwendeten EBs, um Auswuchszellen zu induzieren, was eine relativ schnelle und einfache Methode im Vergleich zur Monolayer-Kultur ist. Mit diesem Protokoll konnten wir viele Pellets mit einer relativ geringen Anzahl von hiPSCs ( Tabelle 1 ) erzeugen. Die Größe und die Anzahl der EBs waren für eine erfolgreiche chondrogene Pelletmassenproduktion entscheidend. Aus diesem Grund haben wir die aggregierten EBs im E8-Medium erweitert, bis mehr als die Hälfte der erzeugten EBs größer als 100 μm waren. Nach der EB-Erweiterung haben wir die EBs im E8-Medium ohne FGF2 gepflegt. Bisher haben die Forscher die EBs ohne FGF2 für die mesodermale Linieninduktion erhaltenXref "> 9

Auch wenn wir versuchten, die erzeugten Auswuchszellen mit hoher Dichte für eine bessere Qualität zu halten, bleiben noch mehrere Einschränkungen bestehen. Während wir bestätigt haben, dass die erzeugten Auswuchszellen eine ähnliche Morphologie aufweisen, können die Zellen noch heterogen sein. Bisherige Studien haben versucht, nach einem bestimmten Zelltyp zu sortieren; Jedoch hat diese Prozedur zur Sammlung einer geringen Anzahl von Zellen geführt. Ein neuer Versuch, homogene Auswuchszellen in einem größeren Maßstab zu isolieren, wird benötigt, um eine große Menge an chondrogenen Pellets mit verbesserten Eigenschaften zu erzeugen.

Verschiedene Gruppen induzieren Progenitorzellen aus hiPSCs unter Verwendung von Monolayer- oder EB-Kultur. Die Induktion von Progenitorzellen mit einer hohen Ähnlichkeit mit MSCs kann der Schlüssel zur Erzielung von chondrogenen Pellets höherer Qualität sein. Diese aus EBs abgeleiteten Vorläuferzellen haben ähnliche Eigenschaften wie MSCs. Allerdings könnte dies wegen derIr fibroblastic natur Daher ist eine detaillierte Validierungsstudie über die Auswuchszellen erforderlich.

In dieser Studie schlagen wir ein Protokoll vor, das eine relativ große Menge an chondrogenen Pellets erzeugen kann. Wir bestätigten, dass der mit CBMC-hiPSCs regenerierte Knorpel einen gesunden Phänotyp zeigte und als Material für die Geweberegeneration verwendet werden kann. Für eine weitere Anwendung ist jedoch ein verbessertes Verfahren mit einer kürzeren Differenzierungszeitleiste erforderlich. Für die zukünftige Anwendung von CBMC-hiPSCs als Zellmaterial für die Knorpelregeneration ist auch die Weiterentwicklung von Qualitätskontrollstandards zur Validierung von Knorpel mit höherem Hyalin-Gehalt erforderlich. Das Protokoll ist einfach und dennoch effektiv und erfordert keine zusätzlichen Sortierprozesse vor der Pelletbildung. Abschließend können mit diesem Protokoll qualitativ hochwertige chondrogene Pellets für Studien zur Krankheitsmodellierung, Arzneimittel-Screening und Regenerationsmedizin erstellt werden, um unser Verständnis von t zu fördernDie Natur des Knorpels.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren haben nichts zu offenbaren.

Acknowledgements

Diese Arbeit wurde durch einen Zuschuss aus dem Korea Healthcare Technology F & E Projekt, Ministerium für Gesundheit, Wohlfahrt & Familie, Republik Korea (HI16C2177) unterstützt.

Materials

Name Company Catalog Number Comments
Plasticware
100 mm Dish TPP 93100
6-well Plate TPP 92006
50 mL Cornical Tube SPL 50050
15 mL Cornical Tube SPL 50015
10 mL Disposable Pipette Falcon 7551
5 mL Disposable Pipette Falcon 7543
12-well Plate TPP 92012
Name Company Catalog Number Description
E8 Medium Materials
DMEM/F12, HEPES Life Technologies 11330-057 E8 Medium (500 mL)
Sodium Bicarbonate Life Technologies 25080-094 E8 Medium (Conc.: 543 μg/mL)
Sodium Selenite Sigma Aldrich S5261 E8 Medium  (Conc.: 14 ng/mL)
Human Transfferin Sigma Aldrich T3705 E8 Medium (Conc.: 10.7 μg/mL)
Basic FGF2 Peprotech 100-18B E8 Medium  (Conc.: 100 ng/mL)
Human Insulin Life Technologies 12585-014 E8 Medium (Conc.: 20 μg/mL)
Human TGFβ1 Peprotech 100-21 E8 Medium (Conc.: 2 ng/mL)
Ascorbic Acid Sigma Aldrich A8960 E8 Medium  (Conc.: 64 μg/mL)
DPBS Life Technologies 14190-144
Vitronectin Life Technologies A14700
ROCK Inhibitor Sigma Aldrich Y0503
Name Company Catalog Number Description
Quality Control Materials
18 mm Cover Glass Superior HSU-0111580
4% Paraformaldyhyde Tech & Innovation BPP-9004
Triton X-100 BIOSESANG 9002-93-1
Bovine Serum Albumin Vector Lab SP-5050
Anti-SSEA4 Antibody Millipore MAB4304
Anti-Oct4 Antibody Santa Cruz SC9081
Anti-TRA-1-60 Antibody Millipore MAB4360
Anti-Sox2 Antibody Biolegend 630801
Anti-TRA-1-81 Antibody Millipore MAB4381
Anti-Klf4 Antibody Abcam ab151733
Alexa Fluor 488 goat anti-mouse IgG (H+L) antibody Molecular Probe A11029
Alexa Fluor 594 goat anti-rabbit IgG (H+L) antibody Molecular Probe A11037
DAPI Molecular Probe D1306
Prolong gold antifade reagent Invitrogen P36934
4% Paraformaldyhyde Tech & Innovation BPP-9004
Tween 20 BIOSESANG T1027
Bovine Serum Albumin Vector Lab SP-5050
Anti-Collagen II antibody abcam  ab34712 1:100
Alcian blue Sigma Aldrich A3157-10G
Fast Green FCF Sigma Aldrich F7252-25G
Safranin O Sigma Aldrich 090m0039v
Nuclear fast red Americanmastertech STNFR100 
xylene Duksan 115 
Ethanol Duksan 64-17-5
Mayer's hematoxylin solution wako pure chemical industries LAK7534
DAP VECTOR LABORATORIES SK-4100
Slide Glass, Coated Hyun Il Lab-Mate HMA-S9914
Trizol Invitrogen 15596-018
Chloroform Sigma Aldrich 366919
Isoprypylalcohol Millipore 109634
Ethanol Duksan 64-17-5
RevertAid First Strand cDNA Synthesis kit Thermo Scientfic K1622
Name Company Catalog Number Description
Chondrogenic Differentiation Materials
DMEM Life Technologies 11885 Chondrogenic media component (500 mL)
Penicilin Streptomycin Life Technologies P4333 Chondrogenic media component (Conc.: 1%)
Ascorbic Acid Sigma Aldrich A8960 Chondrogenic media component (Conc.: 64 μg/mL) 
MEM Non-Essential Amino Acids Solution (100x) Life Technologies 11140-050 Chondrogenic media component (Conc.: 100 mM)
rhBMP-2 R&D 355-BM-050 Chondrogenic media component (Conc.:100 ng/ml)
Recombinant Hman TGF-beta3 R&D 243-B3-002 Chondrogenic media component (Conc.:10 ng/ml)
KnockOut Serum Replacement Life Technologies 10828-028 Chondrogenic media component (Conc.: 1%)
ITS+ Premix BD 354352 Chondrogenic media component (Conc.: 1%)
Dexamethasone-Water Soluble  Sigma Aldrich D2915-100MG Chondrogenic media component (Conc.:10-7 M)
GlutaMAX Supplement Life Technologies 35050-061 Chondrogenic media component (Conc.: 1%)
Sodium pyruvate solution Sigma Aldrich S8636 Chondrogenic media component (Conc.: 1%)
L-Proline Sigma Aldrich P5607-25G Chondrogenic media component (40 μg/ml)

DOWNLOAD MATERIALS LIST

References

  1. van Osch, G. J., et al. Cartilage repair: past and future--lessons for regenerative medicine. J Cell Mol Med. 13, (5), 792-810 (2009).
  2. Ahmed, T. A., Hincke, M. T. Strategies for articular cartilage lesion repair and functional restoration. Tissue Eng Part B Rev. 16, (3), 305-329 (2010).
  3. Diekman, B. O., et al. Cartilage tissue engineering using differentiated and purified induced pluripotent stem cells. Proc Natl Acad Sci USA. 109, (47), 19172-19177 (2012).
  4. Solchaga, L. A., Penick, K., Goldberg, V. M., Caplan, A. I., Welter, J. F. Fibroblast growth factor-2 enhances proliferation and delays loss of chondrogenic potential in human adult bone-marrow-derived mesenchymal stem cells. Tissue Eng Part A. 16, (3), 1009-1019 (2010).
  5. Guzzo, R. M., Drissi, H. Differentiation of Human Induced Pluripotent Stem Cells to Chondrocytes. Methods Mol Biol. 1340, 79-95 (2015).
  6. Drissi, H., Gibson, J. D., Guzzo, R. M., Xu, R. H. Derivation and Chondrogenic Commitment of Human Embryonic Stem Cell-Derived Mesenchymal Progenitors. Methods Mol Biol. 1340, 65-78 (2015).
  7. Nejadnik, H., et al. Improved approach for chondrogenic differentiation of human induced pluripotent stem cells. Stem Cell Rev. 11, (2), 242-253 (2015).
  8. Teramura, T., et al. Induction of mesenchymal progenitor cells with chondrogenic property from mouse-induced pluripotent stem cells. Cell Reprogram. 12, (3), 249-261 (2010).
  9. Koyama, N., et al. Human induced pluripotent stem cells differentiated into chondrogenic lineage via generation of mesenchymal progenitor cells. Stem Cells Dev. 22, (1), 102-113 (2013).
  10. Ko, J. Y., Kim, K. I., Park, S., Im, G. I. In vitro chondrogenesis and in vivo repair of osteochondral defect with human induced pluripotent stem cells. Biomaterials. 35, (11), 3571-3581 (2014).
  11. Nam, Y., Rim, Y. A., Jung, S. M., Ju, J. H. Cord blood cell-derived iPSCs as a new candidate for chondrogenic differentiation and cartilage regeneration. Stem Cell Res Ther. 8, (1), 16 (2017).
  12. Hotten, G. C., et al. Recombinant human growth/differentiation factor 5 stimulates mesenchyme aggregation and chondrogenesis responsible for the skeletal development of limbs. Growth Factors. 13, (1-2), 65-74 (1996).
  13. Murphy, M. K., Huey, D. J., Hu, J. C., Athanasiou, K. A. TGF-beta1, GDF-5, and BMP-2 stimulation induces chondrogenesis in expanded human articular chondrocytes and marrow-derived stromal cells. Stem Cells. 33, (3), 762-773 (2015).
  14. Shintani, N., Siebenrock, K. A., Hunziker, E. B. TGF-ss1 enhances the BMP-2-induced chondrogenesis of bovine synovial explants and arrests downstream differentiation at an early stage of hypertrophy. PLoS One. 8, (1), e53086 (2013).
  15. Fukumoto, T., et al. Combined effects of insulin-like growth factor-1 and transforming growth factor-beta1 on periosteal mesenchymal cells during chondrogenesis in vitro. Osteoarthritis Cartilage. 11, (1), 55-64 (2003).
  16. Worster, A. A., Nixon, A. J., Brower-Toland, B. D., Williams, J. Effect of transforming growth factor beta1 on chondrogenic differentiation of cultured equine mesenchymal stem cells. Am J Vet Res. 61, (9), 1003-1010 (2000).
  17. Knippenberg, M., et al. Differential effects of bone morphogenetic protein-2 and transforming growth factor-beta1 on gene expression of collagen-modifying enzymes in human adipose tissue-derived mesenchymal stem cells. Tissue Eng Part A. 15, (8), 2213-2225 (2009).
  18. Jang, Y., et al. Centrifugal gravity-induced BMP4 induces chondrogenic differentiation of adipose-derived stem cells via SOX9 upregulation. Stem Cell Res Ther. 7, (1), 184 (2016).
  19. Kang, R., et al. Mesenchymal stem cells derived from human induced pluripotent stem cells retain adequate osteogenicity and chondrogenicity but less adipogenicity. Stem Cell Res Ther. 6, 144 (2015).
  20. Tao, H., et al. Biological evaluation of human degenerated nucleus pulposus cells in functionalized self-assembling peptide nanofiber hydrogel scaffold. Tissue Eng Part A. 20, (11-12), 1621-1631 (2014).
  21. Sekiya, I., Larson, B. L., Vuoristo, J. T., Reger, R. L., Prockop, D. J. Comparison of effect of BMP-2, -4, and -6 on in vitro cartilage formation of human adult stem cells from bone marrow stroma. Cell Tissue Res. 320, (2), 269-276 (2005).
  22. Shen, B., Wei, A., Tao, H., Diwan, A. D., Ma, D. D. BMP-2 enhances TGF-beta3-mediated chondrogenic differentiation of human bone marrow multipotent mesenchymal stromal cells in alginate bead culture. Tissue Eng Part A. 15, (6), 1311-1320 (2009).
  23. Rim, Y. A., Nam, Y., Ju, J. H. Induced Pluripotent Stem Cell Generation from Blood Cells Using Sendai Virus and Centrifugation. J Vis Exp. (118), (2016).
  24. Kim, Y., et al. The Generation of Human Induced Pluripotent Stem Cells from Blood Cells: An Efficient Protocol Using Serial Plating of Reprogrammed Cells by Centrifugation. Stem Cells Int. 2016, 1329459 (2016).
  25. Oldershaw, R. A., et al. Directed differentiation of human embryonic stem cells toward chondrocytes. Nat Biotechnol. 28, (11), 1187-1194 (2010).
  26. Toh, W. S., et al. Differentiation and enrichment of expandable chondrogenic cells from human embryonic stem cells in vitro. J Cell Mol Med. 13, (9B), 3570-3590 (2009).
  27. Hwang, N. S., Varghese, S., Elisseeff, J. Derivation of chondrogenically-committed cells from human embryonic cells for cartilage tissue regeneration. PLoS One. 3, (6), e2498 (2008).
  28. Nakagawa, T., Lee, S. Y., Reddi, A. H. Induction of chondrogenesis from human embryonic stem cells without embryoid body formation by bone morphogenetic protein 7 and transforming growth factor beta1. Arthritis Rheum. 60, (12), 3686-3692 (2009).
  29. Guzzo, R. M., Scanlon, V., Sanjay, A., Xu, R. H., Drissi, H. Establishment of human cell type-specific iPS cells with enhanced chondrogenic potential. Stem Cell Rev. 10, (6), 820-829 (2014).
  30. Rim, Y. A., Park, N., Nam, Y., Ju, J. H. Generation of Induced-pluripotent Stem Cells Using Fibroblast-like Synoviocytes Isolated from Joints of Rheumatoid Arthritis Patients. J Vis Exp. (116), (2016).
  31. Pfaff, N., et al. Efficient hematopoietic redifferentiation of induced pluripotent stem cells derived from primitive murine bone marrow cells. Stem Cells Dev. 21, (5), 689-701 (2012).
  32. Xu, H., et al. Highly efficient derivation of ventricular cardiomyocytes from induced pluripotent stem cells with a distinct epigenetic signature. Cell Res. 22, (1), 142-154 (2012).
  33. Lee, S. B., et al. Contribution of hepatic lineage stage-specific donor memory to the differential potential of induced mouse pluripotent stem cells. Stem Cells. 30, (5), 997-1007 (2012).
  34. Hu, S., et al. Effects of cellular origin on differentiation of human induced pluripotent stem cell-derived endothelial cells. JCI Insight. 1, (8), 1-12 (2016).
  35. Vonk, L. A., de Windt, T. S., Slaper-Cortenbach, I. C., Saris, D. B. Autologous, allogeneic, induced pluripotent stem cell or a combination stem cell therapy? Where are we headed in cartilage repair and why: a concise review. Stem Cell Res Ther. 6, (94), 1-11 (2015).
  36. Gomez-Leduc, T., et al. Chondrogenic commitment of human umbilical cord blood-derived mesenchymal stem cells in collagen matrices for cartilage engineering. Sci Rep. 6, 32786 (2016).
  37. Mareschi, K., et al. Isolation of human mesenchymal stem cells: bone marrow versus umbilical cord blood. Haematologica. 86, (10), 1099-1100 (2001).
  38. Wexler, S. A., et al. Adult bone marrow is a rich source of human mesenchymal 'stem' cells but umbilical cord and mobilized adult blood are not. Br J Haematol. 121, (2), 368-374 (2003).
  39. Zhang, X., et al. Isolation and characterization of mesenchymal stem cells from human umbilical cord blood: reevaluation of critical factors for successful isolation and high ability to proliferate and differentiate to chondrocytes as compared to mesenchymal stem cells from bone marrow and adipose tissue. J Cell Biochem. 112, (4), 1206-1218 (2011).
  40. Wagner, W., et al. Replicative senescence of mesenchymal stem cells: a continuous and organized process. PLoS One. 3, (5), e2213 (2008).
  41. Tarte, K., et al. Clinical-grade production of human mesenchymal stromal cells: occurrence of aneuploidy without transformation. Blood. 115, (8), 1549-1553 (2010).
  42. Chen, W. C., et al. Prediction of poor survival by cyclooxygenase-2 in patients with T4 nasopharyngeal cancer treated by radiation therapy: clinical and in vitro studies. Head Neck. 27, (6), 503-512 (2005).
  43. Guzzo, R. M., Gibson, J., Xu, R. H., Lee, F. Y., Drissi, H. Efficient differentiation of human iPSC-derived mesenchymal stem cells to chondroprogenitor cells. J Cell Biochem. 114, (2), 480-490 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics