Chondrogenic גלולה היווצרות דם טבורי הנגזרות Pluripotent תאים גזעיים

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

כאן, אנו מציעים פרוטוקול לבידול chondrogenic מ דם טבורי mononuclear תאים נגזר האדם המושרה בתאי גזע pluripotent.

Cite this Article

Copy Citation | Download Citations

Nam, Y., Rim, Y. A., Ju, J. H. Chondrogenic Pellet Formation from Cord Blood-derived Induced Pluripotent Stem Cells. J. Vis. Exp. (124), e55988, doi:10.3791/55988 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

לסחוס המפרקי של האדם אין יכולת לתקן את עצמו. ניוון הסחוס ולכן מטופל לא על ידי טיפולים שמרניים אלא על ידי שמרני. נכון לעכשיו, המאמצים נעשים כדי לחדש סחוס פגום עם chivrocytes לשעבר vivo מורחבת או מוח העצם נגזר תאי גזע mesenchymal (BMSCs). עם זאת, המוגבלות הכדאיות וחוסר היציבות של תאים אלה להגביל את היישום שלהם שחזור סחוס. תאי גזע pluripotent האדם המושרה (hiPSCs) קיבלו תשומת לב מדעית כחלופה חדשה ליישומים משובי. עם יכולת חידוש עצמי בלתי מוגבלת ורב-יכולות, hiPSCs הודגשו כמקור חלופי חדש לתיקון סחוס. עם זאת, השגת כמות גבוהה של כדורי chondrogenic באיכות גבוהה היא אתגר גדול היישום הקליני שלהם. במחקר זה, השתמשנו בתאי גדילה של תאי גופרית (EB). CHondrogenesis מוצלח אושרה על ידי PCR אD מכתים עם כחול alcian, כחול toluidine, ונוגדנים נגד סוגי קולגן I ו- II (COL1A1 ו COL2A1, בהתאמה). אנו מספקים שיטה מפורטת להבדיל של דם טבורי mononuclear תא נגזר iPSCs (CBMC-hiPSCs) לתוך כדורי chondrogenic.

Introduction

השימוש hiPSCs מייצג אסטרטגיה חדשה עבור בדיקות סמים ומחקרים מכניסטיים של מחלות שונות. מנקודת מבט משובי, hiPSCs הם גם מקור פוטנציאלי להחלפת רקמות שנפגעו בעלי יכולת ריפוי מוגבלת, כגון סחוס מפרקי 1 , 2 .

התחדשות של סחוס articular יליד כבר אתגר במשך כמה עשרות שנים. סחוס המפרק הוא רקמה רכה, לבנה, המעטפת את קצה העצמות ומגינה עליהם מפני חיכוך. עם זאת, יש לו יכולת regenerative מוגבל כאשר פגום, מה שהופך תיקון עצמי כמעט בלתי אפשרי. לכן, מחקר התמקדות התחדשות הסחוס כבר מתמשך במשך כמה עשורים.

בעבר, ב מבחנה חוץ גופית לתוך השושלת chondrogenic בוצעה בדרך כלל עם BMSCs או chondrocytes יליד מבודד מפרק הברך 3 . בשל TO הפוטנציאל chondrogenic שלהם, BMSCs ו chondrocytes יליד יש יתרונות רבים התומכים בשימוש שלהם chondrogenesis. עם זאת, בשל ההתפשטות המוגבלת שלהם פנוטיפ יציב, תאים אלה בפני מספר מגבלות שחזור של מומים הסחוס המפרקי. תחת תנאים תרבות חוץ גופית , תאים אלה נוטים לאבד את המאפיינים שלהם לאחר 3-4 מעברים, אשר בסופו של דבר משפיע על יכולות ההבחנה שלהם 4 . כמו כן, במקרה של chondrocytes יליד, נזק נוסף למפרק הברך הוא בלתי נמנע בעת קבלת תאים אלה.

שלא כמו BMSCs או chondrocytes יליד, hiPSCs יכול להאריך ללא הגבלת במבחנה . עם התנאים תרבות נאותה, hiPSCs יש פוטנציאל גדול כמקור חלופי עבור בידול chondrogenic. עם זאת, זה מאתגר לשנות את המאפיינים המהותיים של hiPSCs 5 . יתר על כן, זה לוקח כמה מסובך במבחנה stePS לכוון את גורלם של hiPSCs לסוג תא מסוים. למרות סיבוכים אלה, השימוש hiPSCs עדיין מומלץ בשל יכולת ההתחדשות העצמית שלהם ואת יכולתם להבדיל תאים ממוקד, כולל chondrocytes 6 .

בידול chondrogenic נעשה בדרך כלל עם מערכות תרבות תלת מימדי, כגון תרבות גלולה או תרבות micromass, באמצעות תאים MSC כמו. אם באמצעות hiPSCs, פרוטוקול לייצר תאים כמו MSC כמו שונה הפרוטוקולים הקיימים. כמה קבוצות להשתמש בתרבות monolayer של hiPSCs כדי להמיר ישירות את הפנוטיפ לתוך תאים כמו MSC 7 . עם זאת, רוב המחקרים משתמשים ב- EBS כדי ליצור תאי תמותה הדומים ל- MSC 8 , 9 , 10 , 11 .

סוגים שונים של גורמי גדילה משמשים לגרום chondrogeNesis. בדרך כלל, BMP ו TGFβ משפחה חלבונים משמשים, לבד או בשילוב. הבידול גם הוא המושרה עם גורמים אחרים, כגון GDF5, FGF2, ו IGF1 12 , 13 , 14 , 15 . TGFβ1 הוכח לעורר chondrogenesis באופן תלוי מינון MSCs 16 . בהשוואה לאיזוטופיפ השני, TGFβ3, TGFβ1 גורם chondrogenesis על ידי הגדלת pre-cartilage תא התעבות mesenchymal מראש. TGFβ3 גורם chondrogenesis על ידי הגדלה משמעותית של התפשטות תאים mesenchymal 17 . עם זאת, TGFβ3 משמש לעתים קרובות יותר על ידי חוקרים מאשר TGFβ1 7 , 10 , 18 , 19 . BMP2 משפר את הביטוי של גנים הקשורים רכיבים chondrogenic מטריקס האדםChondrocytes מפרקי תחת בתנאים חוץ גופית 20 . BMP2 מגביר את הביטוי של גנים קריטיים להיווצרות סחוס ב- MSCs בשילוב עם חלבונים TGFβ 21 . כמו כן הוכח כי BMP2 סינרגיסטי משפר את ההשפעה של TGFβ3 דרך מסלולי Smad ו- MAPK 22 .

במחקר זה, CBMC-hiPSCs היו מצטברים לתוך EBS באמצעות EB בינוני בצלחת פטרי מצורף נמוך. תאי תולדה נגרמו על ידי הצמדת ה- EBS לצלחת מצופה ג'לטין. בידול chondrogenic באמצעות תאים תולדה בוצעה על ידי תרבות גלולה. טיפול עם שני BMP2 ו TGFβ3 בהצלחה מרוכז התאים המושרה תאי מטריקס תאי (ECM) הצטברות חלבון עבור היווצרות chondrogenic גלולה. מחקר זה מציע פרוטוקול בידול chondrogenic פשוטה אך יעילה באמצעות CBMC-hiPSCs.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

פרוטוקול זה אושר על ידי המועצה המוסדית סקירה של האוניברסיטה הקתולית של קוריאה (KC12TISI0861). CBMCs המשמשים לתכנות מחדש הושגו ישירות מהבנק הטבורי של בית החולים סנט מרי בסיאול.

1. בידול Chondrogenic מ iPSCs

  1. הדור CBMC-iPSC
    1. צור CBMC-hiPSCs באמצעות פרוטוקול המוצג בעבודה הקודמת שלנו 23 .
    2. לאסוף את תאי הדם בצינור חרוטי 15 מ"ל לספור אותם באמצעות hemocytometer.
    3. הכן 3 x 10 5 תאים צנטריפוגה אותם 5 דקות ב 515 xg ו RT. מחק supernatant על ידי יניקה resuspend התאים 0.5 מ"ל של המדיום תא דם.
    4. מעבירים את התאים היטב של צלחת לא מצופה היטב 24-ולהוסיף את תערובת וירוס Sendai, בעקבות המלצות היצרן.
    5. צנטריפוגה צלחת במשך 30 דקות ב X150 1,50 ו 30 ° C.
    6. אחורהצנטריפוגה אה, דגירה התאים לילה (O / N) ב 37 מעלות צלזיוס 5% CO 2 .
    7. למחרת, להעביר את התאים transduced כדי מצופה היטב מטריצה. צנטריפוגה את הצלחת ב XG 1,150 במשך 30 דקות ב 30 מעלות צלזיוס.
    8. לאחר צנטריפוגה, להסיר את supernatant, להוסיף 1 מ"ל של המדיום iPSC, ולשמור על התאים O / N ב 37 מעלות צלזיוס ב 5% CO 2 .
    9. שמור על התאים המצורפים על 37 מעלות צלזיוס 5% CO 2 . שנה את המדיום מדי יום, והחלפתו במדיום iPSC טרי.
      הערה: המושבות יופיעו ביום 14-21 לאחר התמרה.
  2. הדור EB
    1. לשמור על hiPSCs ב 37 ° C ו 5% CO 2 . שנה את המדיום היומי, להחליף אותו עם Essential 8 חדש (E8) בינוני.
    2. הכן 2 x 10 6 hiPSCs בצלחת vitronectin מצופה, 100 מ"מ ב E8 בינוני.
    3. הסר את המדיום E8 מהצלחת תרבות לשטוף עם מלוחים סטרילי פוספט שנאגרו (PBS).
    4. הוסף 1מ"ל של 1 mM ethylenediaminetetraacetic חומצה (EDTA) ו דגירה על 37 מעלות צלזיוס 5% CO 2 עבור 2 דקות.
    5. קציר התאים עם 3 מ"ל של מדיום E8 ולהעביר אותם צינור חדש חרוטי 15 מ"ל. צנטריפוגה התאים ב XG 250 בטמפרטורת החדר (RT) במשך 2 דקות.
    6. לשאוב את supernatant מבלי להפריע תא גלולה resuspend התאים 5 מ"ל של מדיום E8.
    7. לספור את התאים באמצעות hemocytometer ולהכין 2 x 10 6 תאים עבור כל צלחת פטרי 100 מ"מ. Resuspend התאים מוכנים בתערובת 10 מ"ל של E8 ו EB בינוני (1: 1) עם 10 מיקרומטר rho- הקשורים מעכב Kinase (ROCK).
    8. דגירה התאים O / N עבור צבירה ב 37 ° C ו 5% CO 2 .
    9. ביום המחרת, למסוק את EBS המצטבר על ידי pipetting. צנטריפוגה התאים ב 250 xg במשך 1 דקות. הסר את supernatant ו resuspend EBS ב 10 מ"ל של מדיום E8 טרי.
    10. הגדל את EBS שנוצר במשך 5 ימים, ביצוע שינויים יומיים עם fresשעה E8 בינוני. להבשלה נוספת, לשנות את המדיום תרבות בינוני E7. שמור על EBS ב 37 ° C ו 5% CO 2 במשך 5 ימים נוספים, ביצוע שינויים בינוניים מדי יום עם בינוני E7 טרי.
      הערה: המדיום E7 הוא בינוני E8 ללא FGF2.
  3. אינדוקציה תא תא מתוך EBS
    1. הוסף 6 מ"ל של ג'לטין 1% למאכל 100 מ"מ ו דגירה על 37 מעלות צלזיוס 5% CO 2 למשך 30 דקות.
    2. מוציאים את הג'לטין ומייבשים את התבשיל לחלוטין למשך 2-3 שעות לפני השימוש.
    3. מעבירים את EBS לצינור חרוטי 50 מ"ל. אפשר EBs להתיישב לתחתית של צינור חרוטי. הסר את supernatant מבלי להפריע EBS.
    4. Resuspend EBS ב 10 מ"ל של Dulbecco השתנה של נשר בינוני (DMEM) עם 20% בסרום שור עוברית (FBS). מעבירים את EBS לצלחת מצופה ג'לטין, 100 מ"מ. הוסף 10 מיקרומטר ROCK inhibitor.
    5. דגירה ולשמור על התאים ב 37 ° C ו 5% CO 2 במשך 7 ימים. לשנות נושאDium כל יום ללא הוספת מעכב ROCK.
  4. היווצרות chondrogenic גלולה
    1. לשאוב את המדיום תרבות מהצלחת לשטוף את התאים שלוש פעמים עם PBS.
    2. החל 1 מ"ל של 1 מ"מ EDTA ו דגירה על 37 מעלות צלזיוס 5% CO 2 עבור 2 דקות.
    3. קציר התאים באמצעות 5 מ"ל של DMEM עם 20% FBS ולהעביר אותם צינור חדש חרוטי 15 מ"ל.
    4. צנטריפוגה התאים דקות 2 ב 250 xg ו RT. מחק supernatant ו resuspend גלולה ב 10 מ"ל של DMEM עם 20% FBS.
    5. סינון להשליך את גושי התא באמצעות מסננת תא 40 מיקרומטר ומסיק את התאים בודדים. ספירת תאים בודדים באמצעות hemocytometer.
    6. צנטריפוגה התאים דקות 2 ב 250 xg ו RT. הסר את supernatant וזרע 3 x 10 5 תאים לכל גלולה בצינור חרוטי 15 מ"ל עם μL 300 של המדידה בידול chondrogenic (CDM).
    7. עבור היווצרות גלולה, צנטריפוגה התאים במשך 5 דקות ב680 xg ו- RT.
      הערה: כדורי נשמרים ב 15 צינורות חרוטי מ"ל במהלך בידול של כדורי chondrogenic.
    8. דגירה התאים לילה ב 37 מעלות צלזיוס 5% CO 2 .
    9. שנה את ה- CDM כל 2-3 ימים. תוך 3 ימים, כדורי יציגו מורפולוגים שטוחים, spheroidal. לשמור על כדורי 21 ימים ב 37 ° C ו 5% CO 2 .

2. אפיון Chondrogenic גלולה על ידי מכתים

  1. הטבעה chondrogenic
    1. לפני הטבעה, להכין להמיס פרפין ב 58 ° C.
    2. תקן את כדורי 1 מ"ל של paraformaldehyde 4% עבור 2 שעות ב RT בצינור 1.5 מ"ל.
      זהירות: Paraformaldehyde הוא רעיל מאוד. הימנע ממגע עם עיניים, עור או ריריות. למזער את החשיפה ולמנוע שאיפה בעת הכנתו.
    3. מניחים שכבה אחת של גזה על הקלטת ולהעביר את כדורי קבוע באמצעות פיפטה. לכסות את גלולה על ידי קיפול thגזה וסוגר את מכסה הקלטת.
    4. ייזום התייבשות ב 100 מ"ל של 70% אתנול (EtOH) פעמיים, 10 דקות כל אחד. מייבשים את כדורי דרך שוטף 10 דקות שוטף 80% ו 95% EtOH.
    5. מעבירים את כדורי 100% EtOH למשך 10 דקות. חזור שלוש פעמים עם EtOH טרי.
    6. עבור "ניקוי", להחליף את הפתרון של 100 מ"ל, 1: 1 תערובת של EtOH ו קסילן, ואחריו תערובת של 1: 2 של EtOH ו קסילן במשך 10 דקות כל אחד. נקה את EtOH הנותרים על ידי דוגרים את כדורי פעמיים 100% xylene, 10 דקות כל אחד.
    7. עבור חדירת פרפין, דגירה של כדורי ב קסילן רציף תערובות פרפין. בצע את תהליך חדירת הפרפין כולו ב 58 ° C. לדגור את כדורי ב 100 מ"ל של תערובת 2: 1 של קסילן פרפין במשך 30 דקות.
    8. החלף את הפתרון עבור 100 מ"ל של תערובת 1: 1 של קסילן פרפין ו דגירה במשך 30 דקות.
    9. החלף את הפתרון עבור 100 מ"ל של תערובת 1: 2 של קסילן פרפין ו דגירה עבור 30 דקות.
    10. עבור חדירת הסופי, להעביר את כדורי לאמבט הראשון של פרפין 100% ו דגירה של 2 שעות.
    11. מעבירים את כדורי לאמבט השני של פרפין 100% ו דגירה O / N ב 58 ° C.
    12. למחרת, בעדינות להעביר את הכדורים עובש באמצעות פינצטה. הוסף פרפין כדי עובש מן מתקן פרפין. לחזק את הפרפין במשך 30 דקות על 4 מעלות צלזיוס.
    13. פורסים את הסעיפים ב 7 מיקרומטר ולהעביר את החלקים על השקופית. אפשר את השקופיות לייבוש לילה ולאחסן את השקופיות ב RT עד שהם מוכנים לשימוש.
  2. הכנת שקופיות
    1. Deparaffinize שקופיות על ידי הזזת אותם דרך 100 מ"ל של 100%, 90%, 80%, ו 70% EtOH ברצף במשך 5 דקות כל אחד.
    2. מניחים את השקופיות בצנצנת זכוכית ולשטוף עם מי ברז במשך 5 דקות.
  3. כתמים כחולים Alcian
    1. דגירה השקופיות 50 מ"ל של תמיסה 1% alcian כחול במשך 30 דקות.
      לֹאE: כחול Alcian הוא מדולל פתרון חומצה אצטית 3%. התאם את pH ל 2.5 באמצעות חומצה אצטית.
    2. מניחים את השקופיות בתוך צנצנת זכוכית ולשטוף עם מי ברז במשך 2 דקות.
    3. שוטפים את השקופיות במים deionized (DW) ו counterstain עם פתרון גרעיני אדום מהיר במשך 2 דקות.
    4. מניחים את השקופיות בצנצנת זכוכית ולשטוף עם מי ברז במשך 1 דקות.
    5. 2.3.5) המשך להתייבש ולהרכיב את השקופיות בשלב 2.6.
  4. טולואידין כתם כחול
    1. דגירה שקופיות 50 מ"ל של תמיסה כחולה toluidine במשך 4 דקות.
    2. מניחים את השקופיות בצנצנת זכוכית ולשטוף עם מי ברז במשך 5 דקות.
    3. המשך לייבש ולהעלות את השקופיות בשלב 2.6.
  5. מכתים אימונוהיסטוכימיים
    1. דגירה שקופיות 3% H 2 O 2 במשך 15 דקות עבור חסימת peroxidase אנדוגני.
    2. החל 200 μL של נוגדנים ראשוניים (אנטי COL1A1 ו - COL2A1) מדולל 1: 100 ב tris-bu(TBS) המכיל 1% אלבומין בסרום שור (BSA) ו 5% סרום עזים נורמלי (NGS) את השקופיות דגירה O / N ב 4 ° C.
    3. למחרת, במקום שקופיות בצנצנת זכוכית ולשטוף אותם עם 50 מ"ל של כפות המכיל 0.1% polysorbate 20 (TBST) שלוש פעמים במשך 5 דקות כל אחד.
    4. החל 200 μL של נוגדן משני (נוגדנים נגד ארנב IgG נוגדן, מדולל 1: 200 ב TBS המכיל 1% BSA ו 5% NGS) את השקופיות דגירה ב RT במשך 40 דקות.
    5. מניחים את השקופיות בצנצנת זכוכית ולשטוף אותם שלוש פעמים עם 50 מ"ל, 5 דקות כל אחד.
    6. עבור הגברה האות, להחיל HRP מצמידים פתרון streptavidin את השקופיות דגירה במשך 10 דקות.
    7. מניחים את השקופיות בצנצנת זכוכית ולשטוף אותם שלוש פעמים עם 50 מ"ל, 5 דקות כל אחד.
    8. מערבבים את תמיסת המצע DAB-peroxidase, להחיל 200 μL של פתרון לשקופית כל, דגירה במשך 1 דקות.
    9. מניחים את השקופיות בצנצנת זכוכית ולשטוף עם מי ברז במשך 5 דקות.
    10. קונטרסטאיןעם hematoxylin מאייר במשך 1 דקות.
    11. לשטוף את השקופיות עם DW.
    12. המשך לייבש ולהעלות את השקופיות בשלב 2.6.
  6. התייבשות הרכבה
    1. לייבש את השקופיות על ידי הזזת אותם ברצף דרך 100 מ"ל של 70%, 80%, 90%, ו 100% EtOH, 30 s כל אחד.
    2. טובלים את השקופיות לתוך שני שינויים של קסילן במשך 1 דקות כל אחד.
    3. הוסף 50 μL של פתרון הרכבה coverslips ומניחים את השקופיות על גבי.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

במחקר זה, יצרנו כדורי chondrogenic מ CBMC-hiPSCs על ידי גרימת תאים outgrowth מ EBS. בידול chondrogenic היה המושרה באמצעות CBMC-hiPSCs עם pluripotency 1 אישר 11 . תוכנית פשוטה של ​​הפרוטוקול שלנו מוצג באיור 1A . לפני בידול, מושבות iPSC הורחבו ( איור 1 ב ). IPSCs המורחבת היו מורכבים כמו EBS ליזום בידול ( איור 1 ג ). EBS שנוצר צורפו מנות מצופות ג'לטין כדי לגרום לתאים outgrowth ( איור 1D ). לאחר מכן, התאים בצובר נקצרו והשתמשו ליצירת כדורי chondrogenic. לאחר 21 ימים של בידול, קטן, חרוזים דמויי כדורי chondrogenic הושגו ושימשו אפיון נוסף ( איור 1E ). איכותו של הצמח במבחנהכדורי drogenic אושרה באמצעות מבחני שונים.

אנו היסטולוגית העריכו את האיכות של כדורי chondrogenic ביום 21. BMSC chondrogenic כדורי שימשו שליטה חיובית. הצטברות של חלבונים ECM מופרשים על ידי chondrocytes הבדיל אושרה על ידי מכתים כחול כחול אלוליאני ב איור 2 א . המאפיינים העיקריים של סחוס בריא, כגון lacuna ו proteoglycan הייצור, גדל ככל תהליך ההבחנה נמשך מעל 21 ימים. כדורי chondrogenic שנוצר CBMC- hiPSCs הביע COL2A1, המהווה את רכיב ECM העיקרי סחוס בריא ( איור 2 ב ). הביטוי COL2A1 של CBMC-hiPSC נגזרות כדורי היה גבוה יותר מזה של BMSC הנגזרות כדורי. הביטוי של קולגן סוג אני, סמן עבור הסחוס fibrotic, היה נמוך יותר ב CBMC-hiPSC נגזרות כדורי לעומת הביטוי של COL2A1. ביטוי גנים של סחוס ECM חלבונים ביום 21 כדורי chondrogenic אושרה על ידי PCR בזמן אמת. הביטוי aggrecan (ACAN) של CBMC- hiPSC נגזרות כדורי היה דומה לזה של BMSC נגזרות כדורי ( איור 3 א ). הביטוי של COL2A1 היה גבוה משמעותית ב CBMC-hiPSC נגזרות כדורי ( איור 3 ב ). הביטוי של האזור הקובע את המין Y-box 9 (Sox9), סמן ילידי chondrogenic, הוערך גם. כדורי שנוצר CBMC- hiPSCs הביע רמות גבוהות של Sox9 ( איור 3 ג ). אנו אישר כי גנים אלה היו upregulated משמעותי ב CBMC-hiPSC כדורי chondrogenic לעומת כדורי שליטה BMSC ביום 21. הביטוי של סמן היפרטרופי, COL1A1, הוערך ( איור 3D ). הביטוי של COL1A1 ב CBMC-hiPSC נגזרות כדורי הופחת לעומת זה ב BMSC-deriVed כדורי. יעילות ההבחנה נותחה על ידי היחס בין COL2A1 ל COL1A1 ( איור 3E ). התוספת של היחס ב CBMC-hiPSC נגזרות כדורי הוכיח את הביטוי הגבוה יחסית של COL2A1 לעומת COL1A1. לסיכום, יש לנו אישר את יכולת הבדל chondrogenic של CBMC-hiPSCs. איכות של cMC-hiPSC הנגזרות condrogenic כדורי היו באיכות תואם עם זה של BMSCs.

איור 1
איור 1: בידול Chondrogenic של hiPSCs. ( א ) Scheme של גלולה chondrogenic הדור מ hiPSCs. ( ב ) מורפולוגיה של CBMC-hiPSC שנוצר. ( ג ) מורפולוגיה של EBS שנוצר. ( ד ) תאים outgrowth נגזר EBs המצורפת צלחת ג 'לטין מצופים תרבות. ( ה ) תמונה של t הוא chondrogenic גלולה לאחר 21 ימים של הבחנה. יחידות המרווחים מוצגים במילימטרים. סולם ברים = 200 מיקרומטר. אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

איור 2
איור 2: ניתוח היסטולוגית של גלולה chondrogenic. ( A ) הערכה היסטולוגית של כדורי chondrogenic ביום 21 באמצעות מכתים כחול אלכיאן כחול טולוידין. ( ב ) תמונה אימונוהיסטוכימיה של כדורי chondrogenic מוכתמים נוגדנים COL1A1 ו COL2A1. סולם ברים = 100 מיקרומטר. אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

1 "> איור 3
איור 3: ביטוי גנים של גלולה chondrogenic. ( א ) ביטוי גנטי יחסית של ACAN. ( ב ) ביטוי גנטי יחסית של COL2A1. ( ג ) ביטוי גנטי יחסית של SOX9. ( D ) ביטוי גנטי יחסית של COL1A1. ( ה ) ביטוי גנים של COL1A1. ( F ) ביטוי גנים של COL10A1. ( G ) היחס של COL2A1: COL1A1 ביטוי גנים. כדורי נקצרו ונותחו לאחר 21 ימים של הבחנה. הנתונים התקבלו באמצעות PCR בזמן אמת ומוצג כמו הממוצע שגיאה שגיאה של ניסויים בשלושה עותקים לכל מדגם (n = 3). ביטוי הגן מנורמל ל- GAPDH כבקרה פנימית. (* P <0.05, ** p <0.01, *** p <0.001).K "> אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

מספר פלאפון תולדה התא outgrowth תשואה גלולה
HiPSCs 2 x 10 6 2-5 x 10 7 70-150
MSC 2 x 10 6 - 6

טבלה 1: השוואת תשואות של MSC ו- hiPSCs.

שם יעד כיוון רצף פריימר גודל
קָדִימָה TTCCGCGACGTGGACAT 77 bp
לַהֲפוֹך TCAAACTCGTTGACATCGAAGTT
פחית קָדִימָה AGCCTGCGCTCCAATGACT 107 bp
לַהֲפוֹך טאטגאגאקגאטגטקטקה
COL2A1 קָדִימָה GGCAATAGCAGGTTCACGACA 79 bp
לַהֲפוֹך CGATAACAGTCTTGCCCCACTTA
COL1A1 קָדִימָה CCCCTGGAAAGAATGGAGATG 148 bp
לַהֲפוֹך TCCAAACCACTGAAACCTCTG

טבלה 2: רצפים של primers נגד סמנים chondrogenic בזמן אמת PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

פרוטוקול זה נוצר בהצלחה hiPSCs מ CBMCs. אנחנו תכנות מחדש CBMCs כדי hiPSCs באמצעות וקטור ויראלי Sendai המכיל גורמים Yamanaka 24 . שלושה מקרים שימשו בידול, וכל הניסויים בהצלחה נוצר chondrogenic pellets באמצעות פרוטוקול זה. מחקרים רבים דיווחו על פרוטוקולים להבחנה של hiPSCs לתוך chondrocytes 25 , 26 , 27 , 28 . עם זאת, מחקר נוסף נדרש כדי לאשר את השימוש CBMC-hiPSCs מועמד התחדשות הסחוס והתאוששות.

Chondrogenesis אושרה באמצעות hiPSCs שנוצר סוגי תאים סומטיים שונים 11 , 25 , 26 , 27 , 29 . דוחות רבים מדגימיםכי המוצא של התא הסומטי המשמש לתכנות מחדש יכול להשפיע על תוצאות ההבחנה של hiPSCs 30 , 31 , 32 , 33 . דם טבורי הוא מקור מועשר ב- HSCs ו- MSC. אין דיווח על ההבדל בין תאים שמקורם בדם טבורי, כגון תאי דם או MSC. עם זאת, מחקרים קודמים הראו כי hiPSCs הנגזרים chondrocyte נוטים יותר לעבור chondrogenesis מאשר hiPSCs שנוצר דם טבורי או fibroblasts העור 29 . תוצאות מ בידול האנדותל באמצעות hiPSCs שנוצר fibroblasts, תאי אב לב, ותאי האנדותל הוכיחו כי רקמת המוצא יכולה לשקף את הזיכרון הסומטי ספציפי רקמות ב הגזירה iPSC מובחנת סופית, במיוחד בפסוקים המוקדמים, בין 10 ל - 20 34 . במעברים הראשונים של hiPSCs, אנדותל תא deriVed hiPSCs הבדיל בצורה יעילה יותר לתוך השושלת האנדותל. עם זאת, ההבדל המשמעותי בין שורות תאים אלה נעלם hiPSCs מעל 20 מעברים. לכן, חשוב לשקול היטב את הזיכרון הסומטי נשאו על ידי hiPSCs במעברים הראשונים כאשר הם משמשים במחקר קליני.

לאחרונה, פותחו נהלים שונים לתיקון הסחוס המפרקי. Microfracture נעשה על ידי קידוח חורים מרובים העצם כדי לעורר את זרם מוח העצם לתיקון טבעי 35 . החלפת הברך, הידוע גם בשם arthroplasty הברך, משמש להחליף את הסחוס פגום. עם זאת, microfracture אינו שימושי עבור נזק סחוס חמור, ואת הכלי המשמש להחלפות הברך יש לשנות כל 10-15 שנים.

בימים אלה, טיפולים מבוססי תאים הם שיטה חלופית מבטיחה לתיקון סחוס. השתלת chondrocyte אוטולוגי (ACI) הוא רחבLy המשמש התאוששות סחוס מבוסס התא. ACI נעשה על ידי הזרקת chondrocytes אוטומטית לתוך המום. עם זאת, chondrocytes עצמי להפוך לתאים דמויי fibroblast תחת בתנאי גידול במבחנה . נזק נוסף הוא גם בלתי נמנע במהלך תהליך הקציר של chondrocytes אוטולוגיות. MSCs הוצעו כמקור התא להתאוששות הסחוס. דם טבורי הוא מקור תא שימושי ונגיש של MSCs עבור סחוס הנדסי 36 . שיעור ההצלחה לבידוד MSCs דם טבורי, לעומת זאת, הוא שנוי במחלוקת 37 , 38 . מחקרים רבים מדווחים על בידוד מוצלח של תאי דם טבורי. מספר מחקרים הראו כי נפח הדם הטבורי הוא פרמטר קריטי שיכול להשפיע על שיעור התשואה של בידוד MSC 36 , 39 . כדי לרכוש MSCs באיכות גבוהה, המעבר של התאים הוא קריטי גם. מחקרים קודמים מצביעים על כךT MSCs יש תוחלת חיים מוגבלת לאחר מספר מסוים התא חלוקת. על ידי הזנת ההזדקנות, MSC מאופיינים על ידי הפחתת התפשטות, כמו בכל תא סומטי רגיל 40 . לכן, MSCs נגזר דם טבורי חייב לשמש לפני המעבר השישי, כדי למנוע הזדקנות התא ואת chromosomal abnormalities 41 .

כדי להימנע ממגבלות אלה, iPSCs אנושיים פתחו אפשרות חדשה עבור טיפול מותאם אישית המבוסס על תאים עם פרודוקטיביות גבוהה 11 . HiPSCs הוקמה יכול תיאורטית להתרבות ללא גבול. כמו כן, עם זהות החיסונית זהה לתורם, הם יכולים למנוע דחייה ותופעות לוואי נמוכות יותר כאשר מושתלים in vivo . המעבר של בנקים טבורי דם לבנקים hiPSC לטיפול רפואי אלוגני יש אפשרות עצומה פוטנציאל 42 . ההקרנה של הומוגיאזי HLA מוקלד CBMCs לפני תכנות מחדש יכול לנצל באופן נרחב את הקווים iPSC allogeneicטיפול קליני. קווים iPSC הומוזיגיים יכולים למנוע תגובות החיסונית לאחר השתלת allograft. רעיון זה יכול להיות מיושם גם על התחדשות הסחוס על ידי יצירת סחוס HLA-homozygous 11 .

בדרך כלל, הבידול chondrogenic מבוצעת באמצעות שני שלבים קריטיים: אינדוקציה של EB- נגזרות תאים outgrowth ו היווצרות גלולה. ההבחנה הראשונית של hiPSCs לתוך EB- נגזר תאים outgrowth הוא קריטי כדי להגדיל את פוטנציאל הבידול chondrogenic שלהם. תאים outgrowth מובחנת מן hiPSCs הם פונקציונלית ו מולקולרית דומה BMSCs יליד 7 , 43 . מחקרים קודמים השתמשו בתרבות monolayer או תרבות EB כצעד pre-differentiation לגרום תאים mesenchymal כמו 10 , 43 . עם זאת, הבחנה ישירה על ידי תרבות monolayer הוא זמן רב בהשוואה לשימוש של EBS, ו ch כדורי אודרוגני נוטים להבדיל לתוך fibrocartilage עם מאפיינים hypertrophic. נמסר כי מורפולוגיה התא פוטנציאל בידול chondrogenic של תאים mesenchymal שנוצר כמו אב שונה מאוד על פי צפיפות התא של monolayer התא 9 .

השתמשנו EBs כדי לגרום לתאים outgrowth, שהיא שיטה מהירה יחסית פשוטה בהשוואה לתרבות monolayer. באמצעות פרוטוקול זה, הצלחנו לייצר כדורי רבים באמצעות מספר קטן יחסית של hiPSCs ( טבלה 1 ). הגודל והמספר של EBS היו קריטיים עבור מוצלח chondrogenic גלולה ייצור המוני. מסיבה זו, הגדלנו את EBS המצטבר E8 בינוני, עד יותר ממחצית EBS שנוצר היו גדולים מ -100 מיקרומטר. לאחר הגדלת ה- EB, שמרנו על ה- EBS במדיום E8 ללא FGF2. בעבר, החוקרים שמרו EBS שנוצר ללא FGF2 עבור אינדוקציה השושלת mesodermalXref "> 9.

למרות שניסינו לשמור על התאים שנולדו בצפיפות גבוהה באיכות טובה יותר, עדיין נותרו מספר מגבלות. בעוד יש לנו אישר כי התאים שנוצר מחוץ לחלוק מורפולוגיה דומה, התאים עשויים להיות הטרוגניים עדיין. מחקרים קודמים ניסו למיין סוג תא מסוים; עם זאת, הליך זה הביא לאיסוף של מספר נמוך של תאים. ניסיון חדש לבודד תאים תולעים הומוגניים בקנה מידה גדול יותר יידרש כדי לייצר כמות גדולה של כדורי chondrogenic עם תכונות משופרות.

קבוצות שונות מעוררים תאים אב מן hiPSCs באמצעות monolayer או תרבות EB. אינדוקציה של תאים אב עם דמיון גבוה MSCs יכול להיות המפתח להשגת כדורי chondrogenic באיכות גבוהה יותר. תאים אלה אב נגזר EBs יש מאפיינים דומים לאלה של MSCs. עם זאת, זה יכול להיות בגללאופי פיברובלסטי. לכן, נדרש מחקר מפורט על תאי התולדה.

במחקר זה, אנו מציעים פרוטוקול שיכול לייצר כמות גדולה יחסית של כדורי chondrogenic. אנו אישר כי הסחוס התחדש באמצעות CBMC-hiPSCs הראה פנוטיפ בריא יכול לשמש חומר עבור התחדשות רקמות. עם זאת, שיטה משופרת עם ציר הזמן בידול קצר נדרש ליישום נוסף. פיתוח נוסף של תקני בקרת איכות כדי לאמת סחוס עם רמה גבוהה יותר של היילין נדרש גם עבור יישומים עתידיים של CBMC-hiPSCs כחומר התא עבור התחדשות הסחוס. הפרוטוקול הוא פשוט אך יעיל ואינו דורש שום תהליכי מיון נוספים לפני היווצרות גלולה. לסיכום, באמצעות פרוטוקול זה, באיכות גבוהה chondrogenic pellets יכול להיות שנוצר עבור מחקרים על מודלים המחלה, סמים ההקרנה, ואת regenerative רפואה כדי לקדם את הבנתנוהוא טבע הסחוס.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

למחברים אין מה לחשוף.

Acknowledgements

עבודה זו נתמכה על ידי מענק מהפרויקט למחקר ופיתוח של טכנולוגיה בקוריאה, משרד הבריאות, הרווחה והמשפחה, הרפובליקה של קוריאה (HI16C2177).

Materials

Name Company Catalog Number Comments
Plasticware
100 mm Dish TPP 93100
6-well Plate TPP 92006
50 mL Cornical Tube SPL 50050
15 mL Cornical Tube SPL 50015
10 mL Disposable Pipette Falcon 7551
5 mL Disposable Pipette Falcon 7543
12-well Plate TPP 92012
Name Company Catalog Number Description
E8 Medium Materials
DMEM/F12, HEPES Life Technologies 11330-057 E8 Medium (500 mL)
Sodium Bicarbonate Life Technologies 25080-094 E8 Medium (Conc.: 543 μg/mL)
Sodium Selenite Sigma Aldrich S5261 E8 Medium  (Conc.: 14 ng/mL)
Human Transfferin Sigma Aldrich T3705 E8 Medium (Conc.: 10.7 μg/mL)
Basic FGF2 Peprotech 100-18B E8 Medium  (Conc.: 100 ng/mL)
Human Insulin Life Technologies 12585-014 E8 Medium (Conc.: 20 μg/mL)
Human TGFβ1 Peprotech 100-21 E8 Medium (Conc.: 2 ng/mL)
Ascorbic Acid Sigma Aldrich A8960 E8 Medium  (Conc.: 64 μg/mL)
DPBS Life Technologies 14190-144
Vitronectin Life Technologies A14700
ROCK Inhibitor Sigma Aldrich Y0503
Name Company Catalog Number Description
Quality Control Materials
18 mm Cover Glass Superior HSU-0111580
4% Paraformaldyhyde Tech & Innovation BPP-9004
Triton X-100 BIOSESANG 9002-93-1
Bovine Serum Albumin Vector Lab SP-5050
Anti-SSEA4 Antibody Millipore MAB4304
Anti-Oct4 Antibody Santa Cruz SC9081
Anti-TRA-1-60 Antibody Millipore MAB4360
Anti-Sox2 Antibody Biolegend 630801
Anti-TRA-1-81 Antibody Millipore MAB4381
Anti-Klf4 Antibody Abcam ab151733
Alexa Fluor 488 goat anti-mouse IgG (H+L) antibody Molecular Probe A11029
Alexa Fluor 594 goat anti-rabbit IgG (H+L) antibody Molecular Probe A11037
DAPI Molecular Probe D1306
Prolong gold antifade reagent Invitrogen P36934
4% Paraformaldyhyde Tech & Innovation BPP-9004
Tween 20 BIOSESANG T1027
Bovine Serum Albumin Vector Lab SP-5050
Anti-Collagen II antibody abcam  ab34712 1:100
Alcian blue Sigma Aldrich A3157-10G
Fast Green FCF Sigma Aldrich F7252-25G
Safranin O Sigma Aldrich 090m0039v
Nuclear fast red Americanmastertech STNFR100 
xylene Duksan 115 
Ethanol Duksan 64-17-5
Mayer's hematoxylin solution wako pure chemical industries LAK7534
DAP VECTOR LABORATORIES SK-4100
Slide Glass, Coated Hyun Il Lab-Mate HMA-S9914
Trizol Invitrogen 15596-018
Chloroform Sigma Aldrich 366919
Isoprypylalcohol Millipore 109634
Ethanol Duksan 64-17-5
RevertAid First Strand cDNA Synthesis kit Thermo Scientfic K1622
Name Company Catalog Number Description
Chondrogenic Differentiation Materials
DMEM Life Technologies 11885 Chondrogenic media component (500 mL)
Penicilin Streptomycin Life Technologies P4333 Chondrogenic media component (Conc.: 1%)
Ascorbic Acid Sigma Aldrich A8960 Chondrogenic media component (Conc.: 64 μg/mL) 
MEM Non-Essential Amino Acids Solution (100x) Life Technologies 11140-050 Chondrogenic media component (Conc.: 100 mM)
rhBMP-2 R&D 355-BM-050 Chondrogenic media component (Conc.:100 ng/ml)
Recombinant Hman TGF-beta3 R&D 243-B3-002 Chondrogenic media component (Conc.:10 ng/ml)
KnockOut Serum Replacement Life Technologies 10828-028 Chondrogenic media component (Conc.: 1%)
ITS+ Premix BD 354352 Chondrogenic media component (Conc.: 1%)
Dexamethasone-Water Soluble  Sigma Aldrich D2915-100MG Chondrogenic media component (Conc.:10-7 M)
GlutaMAX Supplement Life Technologies 35050-061 Chondrogenic media component (Conc.: 1%)
Sodium pyruvate solution Sigma Aldrich S8636 Chondrogenic media component (Conc.: 1%)
L-Proline Sigma Aldrich P5607-25G Chondrogenic media component (40 μg/ml)

DOWNLOAD MATERIALS LIST

References

  1. van Osch, G. J., et al. Cartilage repair: past and future--lessons for regenerative medicine. J Cell Mol Med. 13, (5), 792-810 (2009).
  2. Ahmed, T. A., Hincke, M. T. Strategies for articular cartilage lesion repair and functional restoration. Tissue Eng Part B Rev. 16, (3), 305-329 (2010).
  3. Diekman, B. O., et al. Cartilage tissue engineering using differentiated and purified induced pluripotent stem cells. Proc Natl Acad Sci USA. 109, (47), 19172-19177 (2012).
  4. Solchaga, L. A., Penick, K., Goldberg, V. M., Caplan, A. I., Welter, J. F. Fibroblast growth factor-2 enhances proliferation and delays loss of chondrogenic potential in human adult bone-marrow-derived mesenchymal stem cells. Tissue Eng Part A. 16, (3), 1009-1019 (2010).
  5. Guzzo, R. M., Drissi, H. Differentiation of Human Induced Pluripotent Stem Cells to Chondrocytes. Methods Mol Biol. 1340, 79-95 (2015).
  6. Drissi, H., Gibson, J. D., Guzzo, R. M., Xu, R. H. Derivation and Chondrogenic Commitment of Human Embryonic Stem Cell-Derived Mesenchymal Progenitors. Methods Mol Biol. 1340, 65-78 (2015).
  7. Nejadnik, H., et al. Improved approach for chondrogenic differentiation of human induced pluripotent stem cells. Stem Cell Rev. 11, (2), 242-253 (2015).
  8. Teramura, T., et al. Induction of mesenchymal progenitor cells with chondrogenic property from mouse-induced pluripotent stem cells. Cell Reprogram. 12, (3), 249-261 (2010).
  9. Koyama, N., et al. Human induced pluripotent stem cells differentiated into chondrogenic lineage via generation of mesenchymal progenitor cells. Stem Cells Dev. 22, (1), 102-113 (2013).
  10. Ko, J. Y., Kim, K. I., Park, S., Im, G. I. In vitro chondrogenesis and in vivo repair of osteochondral defect with human induced pluripotent stem cells. Biomaterials. 35, (11), 3571-3581 (2014).
  11. Nam, Y., Rim, Y. A., Jung, S. M., Ju, J. H. Cord blood cell-derived iPSCs as a new candidate for chondrogenic differentiation and cartilage regeneration. Stem Cell Res Ther. 8, (1), 16 (2017).
  12. Hotten, G. C., et al. Recombinant human growth/differentiation factor 5 stimulates mesenchyme aggregation and chondrogenesis responsible for the skeletal development of limbs. Growth Factors. 13, (1-2), 65-74 (1996).
  13. Murphy, M. K., Huey, D. J., Hu, J. C., Athanasiou, K. A. TGF-beta1, GDF-5, and BMP-2 stimulation induces chondrogenesis in expanded human articular chondrocytes and marrow-derived stromal cells. Stem Cells. 33, (3), 762-773 (2015).
  14. Shintani, N., Siebenrock, K. A., Hunziker, E. B. TGF-ss1 enhances the BMP-2-induced chondrogenesis of bovine synovial explants and arrests downstream differentiation at an early stage of hypertrophy. PLoS One. 8, (1), e53086 (2013).
  15. Fukumoto, T., et al. Combined effects of insulin-like growth factor-1 and transforming growth factor-beta1 on periosteal mesenchymal cells during chondrogenesis in vitro. Osteoarthritis Cartilage. 11, (1), 55-64 (2003).
  16. Worster, A. A., Nixon, A. J., Brower-Toland, B. D., Williams, J. Effect of transforming growth factor beta1 on chondrogenic differentiation of cultured equine mesenchymal stem cells. Am J Vet Res. 61, (9), 1003-1010 (2000).
  17. Knippenberg, M., et al. Differential effects of bone morphogenetic protein-2 and transforming growth factor-beta1 on gene expression of collagen-modifying enzymes in human adipose tissue-derived mesenchymal stem cells. Tissue Eng Part A. 15, (8), 2213-2225 (2009).
  18. Jang, Y., et al. Centrifugal gravity-induced BMP4 induces chondrogenic differentiation of adipose-derived stem cells via SOX9 upregulation. Stem Cell Res Ther. 7, (1), 184 (2016).
  19. Kang, R., et al. Mesenchymal stem cells derived from human induced pluripotent stem cells retain adequate osteogenicity and chondrogenicity but less adipogenicity. Stem Cell Res Ther. 6, 144 (2015).
  20. Tao, H., et al. Biological evaluation of human degenerated nucleus pulposus cells in functionalized self-assembling peptide nanofiber hydrogel scaffold. Tissue Eng Part A. 20, (11-12), 1621-1631 (2014).
  21. Sekiya, I., Larson, B. L., Vuoristo, J. T., Reger, R. L., Prockop, D. J. Comparison of effect of BMP-2, -4, and -6 on in vitro cartilage formation of human adult stem cells from bone marrow stroma. Cell Tissue Res. 320, (2), 269-276 (2005).
  22. Shen, B., Wei, A., Tao, H., Diwan, A. D., Ma, D. D. BMP-2 enhances TGF-beta3-mediated chondrogenic differentiation of human bone marrow multipotent mesenchymal stromal cells in alginate bead culture. Tissue Eng Part A. 15, (6), 1311-1320 (2009).
  23. Rim, Y. A., Nam, Y., Ju, J. H. Induced Pluripotent Stem Cell Generation from Blood Cells Using Sendai Virus and Centrifugation. J Vis Exp. (118), (2016).
  24. Kim, Y., et al. The Generation of Human Induced Pluripotent Stem Cells from Blood Cells: An Efficient Protocol Using Serial Plating of Reprogrammed Cells by Centrifugation. Stem Cells Int. 2016, 1329459 (2016).
  25. Oldershaw, R. A., et al. Directed differentiation of human embryonic stem cells toward chondrocytes. Nat Biotechnol. 28, (11), 1187-1194 (2010).
  26. Toh, W. S., et al. Differentiation and enrichment of expandable chondrogenic cells from human embryonic stem cells in vitro. J Cell Mol Med. 13, (9B), 3570-3590 (2009).
  27. Hwang, N. S., Varghese, S., Elisseeff, J. Derivation of chondrogenically-committed cells from human embryonic cells for cartilage tissue regeneration. PLoS One. 3, (6), e2498 (2008).
  28. Nakagawa, T., Lee, S. Y., Reddi, A. H. Induction of chondrogenesis from human embryonic stem cells without embryoid body formation by bone morphogenetic protein 7 and transforming growth factor beta1. Arthritis Rheum. 60, (12), 3686-3692 (2009).
  29. Guzzo, R. M., Scanlon, V., Sanjay, A., Xu, R. H., Drissi, H. Establishment of human cell type-specific iPS cells with enhanced chondrogenic potential. Stem Cell Rev. 10, (6), 820-829 (2014).
  30. Rim, Y. A., Park, N., Nam, Y., Ju, J. H. Generation of Induced-pluripotent Stem Cells Using Fibroblast-like Synoviocytes Isolated from Joints of Rheumatoid Arthritis Patients. J Vis Exp. (116), (2016).
  31. Pfaff, N., et al. Efficient hematopoietic redifferentiation of induced pluripotent stem cells derived from primitive murine bone marrow cells. Stem Cells Dev. 21, (5), 689-701 (2012).
  32. Xu, H., et al. Highly efficient derivation of ventricular cardiomyocytes from induced pluripotent stem cells with a distinct epigenetic signature. Cell Res. 22, (1), 142-154 (2012).
  33. Lee, S. B., et al. Contribution of hepatic lineage stage-specific donor memory to the differential potential of induced mouse pluripotent stem cells. Stem Cells. 30, (5), 997-1007 (2012).
  34. Hu, S., et al. Effects of cellular origin on differentiation of human induced pluripotent stem cell-derived endothelial cells. JCI Insight. 1, (8), 1-12 (2016).
  35. Vonk, L. A., de Windt, T. S., Slaper-Cortenbach, I. C., Saris, D. B. Autologous, allogeneic, induced pluripotent stem cell or a combination stem cell therapy? Where are we headed in cartilage repair and why: a concise review. Stem Cell Res Ther. 6, (94), 1-11 (2015).
  36. Gomez-Leduc, T., et al. Chondrogenic commitment of human umbilical cord blood-derived mesenchymal stem cells in collagen matrices for cartilage engineering. Sci Rep. 6, 32786 (2016).
  37. Mareschi, K., et al. Isolation of human mesenchymal stem cells: bone marrow versus umbilical cord blood. Haematologica. 86, (10), 1099-1100 (2001).
  38. Wexler, S. A., et al. Adult bone marrow is a rich source of human mesenchymal 'stem' cells but umbilical cord and mobilized adult blood are not. Br J Haematol. 121, (2), 368-374 (2003).
  39. Zhang, X., et al. Isolation and characterization of mesenchymal stem cells from human umbilical cord blood: reevaluation of critical factors for successful isolation and high ability to proliferate and differentiate to chondrocytes as compared to mesenchymal stem cells from bone marrow and adipose tissue. J Cell Biochem. 112, (4), 1206-1218 (2011).
  40. Wagner, W., et al. Replicative senescence of mesenchymal stem cells: a continuous and organized process. PLoS One. 3, (5), e2213 (2008).
  41. Tarte, K., et al. Clinical-grade production of human mesenchymal stromal cells: occurrence of aneuploidy without transformation. Blood. 115, (8), 1549-1553 (2010).
  42. Chen, W. C., et al. Prediction of poor survival by cyclooxygenase-2 in patients with T4 nasopharyngeal cancer treated by radiation therapy: clinical and in vitro studies. Head Neck. 27, (6), 503-512 (2005).
  43. Guzzo, R. M., Gibson, J., Xu, R. H., Lee, F. Y., Drissi, H. Efficient differentiation of human iPSC-derived mesenchymal stem cells to chondroprogenitor cells. J Cell Biochem. 114, (2), 480-490 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics