Formação de grânulos condrogénicos a partir de células-tronco pluripotentes induzidas por sangue do cordão umbilical

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Aqui, propomos um protocolo para a diferenciação condrogênica das células-tronco pluripotentes induzidas por células derivadas de células mononucleares do sangue do cordão umbilical.

Cite this Article

Copy Citation | Download Citations

Nam, Y., Rim, Y. A., Ju, J. H. Chondrogenic Pellet Formation from Cord Blood-derived Induced Pluripotent Stem Cells. J. Vis. Exp. (124), e55988, doi:10.3791/55988 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

A cartilagem articular humana não possui a capacidade de se reparar. A degeneração da cartilagem é assim tratada não por curativo, mas por tratamentos conservadores. Atualmente, estão sendo feitos esforços para regenerar a cartilagem danificada com condrócitos expandidos ex vivo ou células estaminais mesenquimais derivadas da medula óssea (BMSCs). No entanto, a viabilidade restrita e a instabilidade destas células limitam a sua aplicação na reconstrução da cartilagem. As células-tronco pluripotentes induzidas por humanos (hiPSCs) receberam atenção científica como uma nova alternativa para aplicações regenerativas. Com capacidade de auto-renovação ilimitada e multipotência, os hiPSCs foram destacados como uma nova fonte celular de substituição para o reparo da cartilagem. No entanto, a obtenção de uma grande quantidade de grânulos condrogénicos de alta qualidade é um desafio importante para a sua aplicação clínica. Neste estudo, utilizamos células de crescimento indireto do corpo embrionário (EB) para diferenciação condrogênica. A condrogênese bem sucedida foi confirmada por PCR eD coloração com azul alciano, azul de toluidina e anticorpos contra os tipos de colágeno I e II (COL1A1 e COL2A1, respectivamente). Nós fornecemos um método detalhado para a diferenciação de iPSCs derivadas de células mononucleares de sangue do cordão umbilical (CBMC-hiPSCs) em pellets condrogênicos.

Introduction

O uso de hiPSCs representa uma nova estratégia para rastreamento de drogas e estudos mecanicistas de várias doenças. Do ponto de vista regenerativo, os hiPSCs também são uma fonte potencial para a substituição de tecidos danificados que têm capacidade de cura limitada, como a cartilagem articular 1 , 2 .

A regeneração da cartilagem articular nativa tem sido um desafio há várias décadas. A cartilagem articular é um tecido macio e branco que abaixa a extremidade dos ossos, protegendo-os da fricção. No entanto, tem habilidade regenerativa limitada quando danificada, o que torna o auto-reparo quase impossível. Portanto, as pesquisas voltadas para a regeneração da cartilagem estão em curso há várias décadas.

Anteriormente, a diferenciação in vitro na linhagem condrogênica geralmente era realizada com BMSC ou condrocitos nativos isolados da articulação do joelho 3 . Devido tO seu potencial condrogênico, BMSCs e condrócitos nativos têm inúmeros méritos que suportam seu uso na condrogênese. No entanto, devido à sua expansão limitada e fenótipo instável, essas células enfrentam várias limitações na reconstrução de defeitos da cartilagem articular. Sob condições de cultura in vitro , essas células tendem a perder suas próprias características após 3-4 passagens, o que eventualmente afeta suas habilidades de diferenciação 4 . Além disso, no caso de condrócitos nativos, danos adicionais na articulação do joelho são inevitáveis ​​na obtenção dessas células.

Ao contrário de BMSCs ou condrócitos nativos, os hiPSCs podem expandir-se indefinidamente in vitro . Com as condições de cultura adequadas, os hiPSCs têm um grande potencial como fonte de substituição para a diferenciação condrogênica. No entanto, é um desafio mudar as características intrínsecas dos hiPSCs 5 . Além disso, é necessário vários in vitro complicadosPs para direcionar o destino dos hiPSCs para um tipo de célula específico. Apesar dessas complicações, o uso de HiPSCs ainda é recomendado devido às suas altas habilidades de auto-renovação e sua capacidade de se diferenciar em células específicas, incluindo condrócitos 6 .

A diferenciação condrogénica é geralmente feita com sistemas de cultura tridimensionais, como a cultura de pelotização ou a cultura de micromassas, usando células progenitoras semelhantes a MSC. Se estiver usando o HiPSCs, o protocolo para gerar células progenitoras do tipo MSC difere dos protocolos existentes. Alguns grupos usam cultura monocamada de hiPSCs para converter diretamente o fenótipo em células tipo MSC 7 . No entanto, a maioria dos estudos usa EBs para gerar células de crescimento que se assemelham aos MSC 8 , 9 , 10 , 11 .

Vários tipos de fatores de crescimento são usados ​​para induzir ChondrogeNesis. Geralmente, as proteínas da família BMP e TGFβ são usadas, sozinhas ou em combinação. A diferenciação também foi induzida com outros fatores, como GDF5, FGF2 e IGF1 12 , 13 , 14 , 15 . Foi demonstrado que TGFβ1 estimula a condrogênese de uma maneira dose-dependente em MSCs 16 . Comparado com o outro isotipo, TGFβ3, TGFβ1 induz condrogênese, aumentando a condensação da célula pré-cartilagea mesenquimatosa.TGFβ3 induz condrogênese aumentando significativamente a proliferação celular mesenquimatosa 17 . No entanto, o TGFβ3 é utilizado mais frequentemente por pesquisadores do que TGFβ1 7 , 10 , 18 , 19 . BMP2 aumenta a expressão de genes relacionados aos componentes da matriz condrogênica em humanosCondrócitos articulares sob condições in vitro 20 . BMP2 aumenta a expressão de genes críticos para a formação de cartilagem em MSCs em combinação com proteínas TGFβ 21 . Também foi demonstrado que BMP2 melhora sinergicamente o efeito do TGFβ3 através das vias Smad e MAPK 22 .

Neste estudo, os CBMC-hiPSCs foram agregados em EBs usando meio EB em uma placa Petri de baixo valor. As células de ultrapassagem foram induzidas ao unir os EBs a um prato revestido com gelatina. A diferenciação condrogénica utilizando células secundárias foi realizada por cultura de pelota. O tratamento com BMP2 e TGFβ3 condensou com sucesso as células e induziu a acumulação de proteína da matriz extracelular (ECM) para a formação de grânulos condrogénicos. Este estudo sugere um protocolo de diferenciação condrogénica simples, mas eficiente, usando CBMC-hiPSCs.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Este protocolo foi aprovado pelo conselho de revisão institucional da Universidade Católica da Coreia (KC12TISI0861). Os CBMCs utilizados para a reprogramação foram obtidos diretamente do Cord Blood Bank do Seoul St. Mary's Hospital.

1. Diferenciação condrogênica de iPSCs

  1. Geração CBMC-iPSC
    1. Gerar CBMC-hiPSCs usando o protocolo mostrado em nosso trabalho anterior 23 .
    2. Colecione as células sanguíneas em um tubo cônico de 15 mL e conte-as usando um hemocitômetro.
    3. Prepare 3 x 10 5 células e centrifugá-las por 5 minutos a 515 xg e RT. Descarte o sobrenadante por sucção e ressuspenda as células em 0,5 mL de meio de células sanguíneas.
    4. Transfira as células para um poço de uma placa não revestida de 24 poços e adicione a mistura de vírus Sendai, seguindo as recomendações do fabricante.
    5. Centrifugue a placa por 30 min a 1.150 xg e 30 ° C.
    6. AtrásPor centrifugação, incubar as células durante a noite (O / N) a 37 ° C em 5% de CO2.
    7. No dia seguinte, transfira as células transduzidas para um poço revestido com matriz. Centrifugue a placa a 1.150 xg durante 30 min a 30 ° C.
    8. Após a centrifugação, remova o sobrenadante, adicione 1 mL de meio iPSC e mantenha as células O / N a 37 ° C em 5% de CO 2 .
    9. Manter as células anexadas a 37 ° C e 5% de CO 2 . Mude o meio diariamente, substituindo-o por meio de iPSC fresco.
      NOTA: As colônias aparecerão no dia 14-21 após a transdução.
  2. Geração EB
    1. Manter o hiPSCs a 37 ° C e 5% de CO 2 . Mude o meio diariamente, substituindo-o pelo meio essencial Essential 8 (E8).
    2. Prepare 2 x 10 6 hiPSCs em uma placa revestida de vitronectina de 100 mm em meio E8.
    3. Retire o meio E8 do prato de cultura e lave com solução salina tamponada com fosfato estéril (PBS).
    4. Adicione 1ML de ácido etilenodiaminotetracético 1 mM (EDTA) e incubar a 37 ° C e 5% de CO 2 durante 2 min.
    5. Colher as células com 3 mL de meio E8 e transferi-las para um novo tubo cônico de 15 mL. Centrifugar as células a 250 xg à temperatura ambiente (RT) durante 2 min.
    6. Aspirar o sobrenadante sem perturbar o sedimento celular e ressuspender as células em 5 mL de meio E8.
    7. Contar as células usando um hemocitômetro e preparar 2 x 10 6 células para cada 100 mm de placa de Petri. Ressuspender as células preparadas em uma mistura de 10 mL de meio E8 e EB (1: 1) com 10 μM de inibidor de quinase associada a rho (ROCK).
    8. Incube as células O / N para agregação a 37 ° C e 5% de CO 2 .
    9. No dia seguinte, colhe os EBs agregados por pipetagem. Centrifugar as células a 250 xg durante 1 min. Remova o sobrenadante e ressuspenda os EBs em 10 mL de meio E8 fresco.
    10. Amplie os EBs gerados por 5 dias, realizando mudanças diárias com fresH E8 médio. Para uma maior maturação, mude o meio de cultura para o meio E7. Manter os EBs a 37 ° C e 5% de CO 2 por mais 5 dias, realizando mudanças médias diárias com meio E7 fresco.
      NOTA: O meio E7 é meio E8 sem FGF2.
  3. Indução de células de crescimento de EBs
    1. Adicionar 6 mL de gelatina a 1% a uma placa de 100 mm e incubar a 37 ° C e 5% de CO 2 durante 30 min.
    2. Retire a gelatina e retire o prato completamente por 2-3 h antes de usar.
    3. Transfira os EBs para um tubo cônico de 50 mL. Permita que os EBs se instalem na parte inferior do tubo cônico. Remova o sobrenadante sem perturbar os EBs.
    4. Ressuspender os EBs em 10 mL do Meio de Eagle Modificado de Dulbecco (DMEM) com 20% de soro bovino fetal (FBS). Transfira os EBs para o prato 100 mm revestido com gelatina. Adicionar 10 μM ROCK inibidor.
    5. Incubar e manter as células a 37 ° C e 5% de CO 2 durante 7 dias. Mudar temaDiariamente, sem adição de inibidor de ROCK.
  4. Formação de grânulos condrogénicos
    1. Aspirar o meio de cultura do prato e lavar as células três vezes com PBS.
    2. Aplicar 1 mL de EDTA 1 mM e incubar a 37 ° C e 5% de CO 2 durante 2 min.
    3. Colher as células usando 5 mL de DMEM com 20% de FBS e transferi-las para um novo tubo cônico de 15 mL.
    4. Centrifugar as células por 2 minutos a 250 xg e RT. Descarte o sobrenadante e ressuspenda o grânulo em 10 mL de DMEM com FBS a 20%.
    5. Filtre e descarte os aglomerados de células usando um filtro de células de 40 μm e colhe as células individuais. Contar as células individuais usando um hemocitômetro.
    6. Centrifugar as células por 2 minutos a 250 xg e RT. Remova o sobrenadante e semeie 3 x 10 5 células por pelotização em um tubo cônico de 15 mL com 300 μL de meio de diferenciação condrogênica (MDL).
    7. Para a formação de pelozes, centrifugar as células por 5 min a680 xg e RT.
      NOTA: Os grânulos são mantidos em tubos cônicos de 15 mL durante a diferenciação dos grânulos condrogénicos.
    8. Incubar as células durante a noite a 37 ° C e 5% de CO 2 .
    9. Altere o MDL a cada 2-3 dias. Dentro de 3 dias, os grânulos exibirão morfologias esferóides achatadas e esferoidais. Manter as pastilhas por 21 dias a 37 ° C e 5% de CO 2 .

2. Caracterização de pelozes condrogénicas por coloração

  1. Incorporação condrogênica
    1. Antes de incorporar, preparar e derreter a parafina a 58 ° C.
    2. Corrigir os grânulos em 1 mL de paraformaldeído a 4% durante 2 h à TA em um tubo de 1,5 mL.
      Atenção: o paraformaldeído é altamente tóxico. Evite o contato com os olhos, a pele ou as mucosas. Minimize a exposição e evite a inalação enquanto a prepara.
    3. Coloque uma camada de gaze na cassete e transfira as pastilhas fixas usando uma pipeta. Cubra a pelota dobrandoFaça uma gaze e feche a tampa da cassete.
    4. Inicie a desidratação em 100 mL de etanol a 70% (EtOH) duas vezes, 10 min cada. Desidratar os grânulos através de lavagens sequenciais de 10 minutos em 80% e EtOH a 95%.
    5. Transfira os grânulos para 100% de EtOH durante 10 min. Repita três vezes com EtOH fresco.
    6. Para "limpeza", troque a solução para uma mistura de 100 mL, 1: 1 de EtOH e xileno, seguido de uma mistura 1: 2 de EtOH e xileno durante 10 min cada. Limpe o EtOH restante incubando os grânulos duas vezes em 100% de xileno, 10 min cada.
    7. Para infiltração de parafina, incubar os grânulos em misturas sequenciais de xileno e parafina. Execute todo o processo de infiltração de parafina a 58 ° C. Incubar os grânulos em 100 mL de uma mistura 2: 1 de xileno e parafina durante 30 min.
    8. Troque a solução para 100 mL de uma mistura 1: 1 de xileno e parafina e incube durante 30 min.
    9. Troque a solução para 100 mL de uma mistura 1: 2 de xileno e parafina e incube por 30 min.
    10. Para a infiltração final, transfira os grânulos para o primeiro banho de parafina 100% e incube durante 2 h.
    11. Transferir os grânulos para o segundo banho de parafina 100% e incubar O / N a 58 ° C.
    12. No dia seguinte, transfira suavemente os grânulos para um molde usando uma pinça. Adicione a parafina ao molde do dispensador de parafina. Solidifique a parafina durante 30 min a 4 ° C.
    13. Cortar as secções a 7 μm e transferir as seções para o slide. Deixe as lâminas secar durante a noite e guarde as lâminas na RT até que estejam prontas para uso.
  2. Preparação da corrediça
    1. Desparafinize as lâminas movendo-as através de 100 mL de 100%, 90%, 80% e 70% de EtOH sequencialmente durante 5 minutos cada.
    2. Coloque as lâminas em uma jarra de vidro e enxaguar com água da torneira por 5 min.
  3. Coloração azul alcian
    1. Incubar as lâminas em 50 mL de solução alcian azul a 1% durante 30 min.
      NÃOE: Azul alcalino é diluído em solução a 3% de ácido acético. Ajuste o pH para 2,5 usando ácido acético.
    2. Coloque as lâminas em uma jarra de vidro e enxaguar com água da torneira por 2 min.
    3. Enxágüe as lâminas em água desionizada (DW) e compareça com solução nuclear rápida por 2 min.
    4. Coloque as lâminas em uma jarra de vidro e enxaguar com água da torneira por 1 min.
    5. 2.3.5) Proceda para desidratar e montar as lâminas no passo 2.6.
  4. Mancha de azul de toluidina
    1. Incubar lâminas em 50 mL de solução de azul de toluidina durante 4 min.
    2. Coloque as lâminas em uma jarra de vidro e enxaguar com água da torneira por 5 min.
    3. Proceda para desidratar e montar as lâminas no passo 2.6.
  5. Coloração imuno-histoquímica
    1. Incubar as lâminas em 3% de H 2 O 2 durante 15 min para o bloqueio da peroxidase endógena.
    2. Aplicar 200 μL de anticorpo primário (anti-COL1A1 e -COL2A1) diluído 1: 100 em tris-buSoro férreo (TBS) contendo 1% de albumina de soro bovino (BSA) e 5% de soro de cabra normal (NGS) para as lâminas e incubar O / N a 4 ° C.
    3. No dia seguinte, coloque as lâminas em uma jarra de vidro e lave-os com 50 mL de TBS contendo 0,1% de polissorbato 20 (TBST) três vezes por 5 minutos cada.
    4. Aplicar 200 μL de anticorpo secundário (anticorpo IgG de cabra anti-coelho, diluído 1: 200 em TBS contendo 1% de BSA e 5% NGS) para as lâminas e incubar à TA durante 40 min.
    5. Coloque as lâminas em uma jarra de vidro e lave-as três vezes com 50 mL, 5 minutos cada.
    6. Para amplificação de sinal, aplique solução de estreptavidina conjugada com HRP para as lâminas e incube durante 10 min.
    7. Coloque as lâminas em uma jarra de vidro e lave-as três vezes com 50 mL, 5 minutos cada.
    8. Misture a solução de substrato DAB-peroxidase, aplique 200 μL de solução a cada lâmina e incube durante 1 min.
    9. Coloque as lâminas em uma jarra de vidro e enxaguar com água da torneira por 5 min.
    10. CounterstainCom hematoxilina de Mayer durante 1 min.
    11. Lave as lâminas com DW.
    12. Proceda para desidratar e montar as lâminas no passo 2.6.
  6. Desidratação e montagem
    1. Desidratar os slides movendo-os sequencialmente através de 100 mL de 70%, 80%, 90% e 100% EtOH, 30 s cada.
    2. Mergulhe os slides em duas mudanças de xileno durante 1 min cada.
    3. Adicione 50 μL de solução de montagem aos lamínulas e coloque as lâminas na parte superior.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Neste estudo, geramos grânulos condrogénicos de CBMC-hiPSCs induzindo células de crescimento de EBs. A diferenciação condrogênica foi induzida usando CBMC-hiPSCs com alta pluripotência confirmada 11 . Um esquema simples de nosso protocolo é mostrado na Figura 1A . Antes da diferenciação, as colônias iPSC foram expandidas ( Figura 1B ). Os iPSC expandidos foram montados como EBs para iniciar a diferenciação ( Figura 1C ). Os EBs gerados foram anexados a pratos revestidos com gelatina para induzir células de crescimento ( Figura 1D ). Em seguida, as células de crescimento foram colhidas e utilizadas para gerar grânulos condrogénicos. Após 21 dias de diferenciação, foram obtidos pequenos grânulos condrogénicos semelhantes a grânulos e utilizados para maior caracterização ( Figura 1E ). A qualidade do chon gerado in vitroOs grânulos de drogénio foram confirmados através de vários ensaios.

Avaliamos histologicamente a qualidade dos grânulos condrogénicos no dia 21. Os grânulos condrogénicos BMSC foram utilizados como controle positivo. A acumulação de proteínas ECM segregadas pelos condrócitos diferenciados foi confirmada por coloração azul alciano e azul de toluidina na Figura 2A . As principais características da cartilagem saudável, como a produção de lacunas e proteoglicanos, aumentaram à medida que o processo de diferenciação continuou ao longo de 21 dias. Os grânulos condrogénicos gerados a partir de CBMC-hiPSCs expressaram COL2A1, que é o principal componente de ECM em cartilagem saudável ( Figura 2B ). A expressão de COL2A1 de grânulos derivados de CBMC-hiPSC foi maior do que a das pastilhas derivadas de BMSC. A expressão de colágeno tipo I, um marcador para cartilagem fibrótica, foi menor em grânulos derivados de CBMC-hiPSC em comparação com a expressão de COL2A1. A expressão gênica das proteínas ECM da cartilagem no período de 21 grânulos condrogénicos foi confirmada por PCR em tempo real. A expressão de agrecana (ACAN) de grânulos derivados de CBMC-hiPSC foi semelhante à dos grânulos derivados de BMSC ( Figura 3A ). A expressão de COL2A1 foi significativamente maior nas pastilhas CBMC-HiPSC derivadas ( Figura 3B ). A expressão da região Y-box 9 (Sox9) determinante do sexo, um marcador progenitor condrogênico, também foi avaliada. Pellets gerados a partir de CBMC-hiPSCs expressaram altos níveis de Sox9 ( Figura 3C ). Confirmamos que esses genes foram significativamente aumentados em bolinhas condrogênicas de CBMC-hiPSC em comparação com os grânulos de controle de BMSC no dia 21. A expressão de um marcador hipertrófico, COL1A1, foi avaliada ( Figura 3D ). A expressão de COL1A1 em grânulos derivados de CBMC-hiPSC foi reduzida em comparação com a de BMSC-deriPellets ved. A eficiência de diferenciação foi analisada pela proporção de COL2A1 para COL1A1 ( Figura 3E ). O incremento da proporção em grânulos derivados de CBMC-hiPSC demonstrou a expressão relativamente alta de COL2A1 em comparação com COL1A1. Em conclusão, confirmamos a capacidade de diferenciação condrogênica de CBMC-hiPSCs. A qualidade dos grânulos carbonatados derivados de CBMC-hiPSC gerados possuía uma qualidade compatível com a dos BMSCs.

figura 1
Figura 1: diferenciação condrogênica de hiPSCs. ( A ) Esquema da geração de grânulos condrogénicos de hiPSCs. ( B ) Morfologia do CBMC-hiPSC gerado. ( C ) Morfologia de EBs gerados. ( D ) Células de crescimento derivadas de EBs ligadas a um prato de cultura revestido com gelatina. ( E ) Imagem de t Ele granulado condrogênico após 21 dias de diferenciação. As unidades dos intervalos são mostradas em milímetros. Barras de escala = 200 μm. Clique aqui para ver uma versão maior desta figura.

Figura 2
Figura 2: Análise histológica do grânulo condrogénico. ( A ) Avaliação histológica de grânulos condrogénicos no dia 21 usando coloração azul alciano e azul de toluidina. ( B ) Imagem imuno-histoquímica de grânulos condrogénicos corados com anticorpos COL1A1 e COL2A1. Barras de escala = 100 μm. Clique aqui para ver uma versão maior desta figura.

1 "> Figura 3
Figura 3: Expressão genética do grânulo condrogénico. ( A ) Expressão gênica relativa de ACAN. ( B ) Expressão gênica relativa de COL2A1. ( C ) Expressão gênica relativa de SOX9. ( D ) Expressão gênica relativa de COL1A1. ( E ) Expressão genética de COL1A1. ( F ) Expressão genética de COL10A1. ( G ) A proporção da expressão do gene COL2A1: COL1A1. Os pellets foram colhidos e analisados ​​após 21 dias de diferenciação. Os dados foram obtidos usando PCR em tempo real e exibidos como o erro padrão médio de experiências triplicadas por amostra (n = 3). A expressão do gene foi normalizada para GAPDH como um controle interno. (* P <0,05, ** p <0,01, *** p <0,001).K "> Por favor, clique aqui para ver uma versão maior desta figura.

Número do celular Rendimento das células de crescimento Produção de pelota
HiPSCs 2 x 10 6 2-5 x 10 7 70-150
MSC 2 x 10 6 - 6

Tabela 1: Comparação de rendimento de MSC e HiPSCs.

Nome do alvo Direção Seqüência de iniciador Tamanho
progressivo TTCCGCGACGTGGACAT 77 pb
Marcha ré TCAAACTCGTTGACATCGAAGGT
UMA LATA progressivo AGCCTGCGCTCCAATGACT 107 pb
Marcha ré TAATGGAACACGATGCCTTTCA
COL2A1 progressivo GGCAATAGCAGGTTCACGTACA 79 pb
Marcha ré CGATAACAGTCTTGCCCCACTTA
COL1A1 progressivo CCCCTGGAAAGAATGGAGATG 148 pb
Marcha ré TCCAAACCACTGAAACCTCTG

Tabela 2: Seqüências de iniciadores contra marcadores condrogênicos em PCR em tempo real.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Este protocolo gerou com êxito hiPSCs de CBMCs. Nós reprogramamos CBMCs para HiPSCs usando um vetor viral Sendai contendo fatores Yamanaka 24 . Três casos foram utilizados na diferenciação, e todas as experiências geraram com sucesso grânulos condrogénicos usando este protocolo. Numerosos estudos relataram protocolos para a diferenciação de hiPSCs em condrócitos 25 , 26 , 27 , 28 . No entanto, pesquisas adicionais são necessárias para confirmar o uso de CBMC-hiPSCs um candidato para regeneração e recuperação de cartilagens.

A condrogênese foi confirmada usando oiPSCs gerados a partir de vários tipos de células somáticas 11 , 25 , 26 , 27 , 29 . Muitos relatórios demonstramQue a origem da célula somática usada na reprogramação pode afetar o resultado de diferenciação dos hiPSCs 30 , 31 , 32 , 33 . O sangue do cordão é uma fonte enriquecida com HSCs e MSCs. Não há nenhum relatório sobre a diferença entre células derivadas do sangue do cordão umbilical, como células de sangue ou MSCs. No entanto, estudos prévios mostraram que os hiPSCs derivados de condrócitos articulares são mais propensos a passar pela condrogênese do que o HiPSCs gerados a partir de sangue de cordão ou fibroblastos de pele 29 . Os resultados da diferenciação endotelial utilizando HiPSCs gerados a partir de fibroblastos, células progenitoras cardíacas e células endoteliais demonstraram que o tecido de origem pode refletir a memória somática específica de tecido na derivação iPSC terminalmente diferenciada, especialmente em passagens precoces, entre 10 e 20 34 . Nas primeiras passagens de hiPSCs, derma de células endoteliaisOs hiPSCs diferenciaram-se de forma mais eficiente na linhagem endotelial. No entanto, a diferença significativa entre essas linhas celulares desapareceu em hiPSCs em mais de 20 passagens. Portanto, é importante considerar cuidadosamente a memória somática realizada pelos hiPSCs em primeiras passagens quando são utilizadas na pesquisa clínica.

Recentemente, vários procedimentos foram desenvolvidos para reparar a cartilagem articular deserta. A microfractura é feita perfurando múltiplos orifícios no osso para induzir o influxo de medula óssea para reparo natural 35 . A substituição do joelho, também conhecida como artroplastia do joelho, é usada para substituir a cartilagem danificada. No entanto, a microfracção não é útil para danos graves na cartilagem articular, e o instrumento utilizado para substituições do joelho deve ser alterado a cada 10-15 anos.

Atualmente, as terapias baseadas em células são um método alternativo promissor para o reparo da cartilagem. O implante de condrócitos autólogos (ACI) é amploUsado para recuperação de cartilagem baseada em células. O ACI é feito por injeção direta de condrócitos autólogos no defeito. No entanto, os condrócitos autólogos se transformam em células semelhantes a fibroblastos sob condições de cultivo in vitro . Danos adicionais também são inevitáveis ​​durante o processo de colheita de condrócitos autólogos. MSCs foram sugeridos como uma fonte celular para a recuperação da cartilagem. O sangue do cordão é uma fonte celular útil e acessível de MSCs para engenharia de cartilagem 36 . A taxa de sucesso para isolar MSC de sangue de cordão, no entanto, é controversa 37 , 38 . Numerosos estudos relatam o isolamento bem sucedido de MSC de sangue de cordão. Vários estudos mostraram que o volume de sangue do cordão umbilical é um parâmetro crítico que pode afetar a taxa de rendimento do isolamento MSC 36 , 39 . Para adquirir MSC de alta qualidade, a passagem das células também é crítica. Estudos anteriores indicam queOs MSCs têm uma vida restrita após um determinado número de divisão celular. Ao entrar na senescência, os MSCs são caracterizados por uma diminuição da proliferação, como acontece com qualquer célula somática normal 40 . Portanto, os MSC derivados do sangue do cordão umbilical devem ser utilizados antes da sexta passagem para evitar a senescência celular e anormalidades cromossômicas 41 .

Para evitar essas limitações, os iPSCs humanos abriram uma nova possibilidade de terapia personalizada baseada em células com alta produtividade 11 . Os hiPSCs estabelecidos teoricamente podem proliferar sem limites. Além disso, com a mesma identidade imune que o doador, eles podem evitar rejeição e menores efeitos colaterais quando implantados in vivo . A transição de bancos de sangue do cordão umbilical para bancos de hiPSC para tratamento médico alogênico tem tremenda possibilidade e potencial 42 . A triagem dos CBMC homozigotos HLA-tipados antes da reprogramação pode utilizar amplamente as linhas alogogênicas do iPSC paraR tratamento clínico. As linhas iPSC enzimáticas podem evitar reações imunológicas após o transplante de aloenxertos. Este conceito também pode ser aplicado à regeneração da cartilagem através da geração de cartilagem HLA-homozigoto 11 .

Geralmente, a diferenciação condrogênica é realizada através de dois passos críticos: a indução de células derivadas de EB e a formação de grânulos. A diferenciação inicial de hiPSCs em células derivadas de EB derivadas é crítica para aumentar seu potencial de diferenciação condrogênica. As células ultrapassadas diferenciadas dos hiPSCs são funcionalmente e molecularmente semelhantes às BMSC nativas 7 , 43 . Estudos anteriores usaram cultura de monocamada ou cultura EB como um passo de pré-diferenciação para induzir células do tipo mesenquimal 10 , 43 . No entanto, a diferenciação direta por cultura monocamada é demorada em comparação com o uso de EBs e ch Os grânulos ondrogenianos tendem a se diferenciar em fibrocartilagens com características hipertróficas. Foi relatado que a morfologia celular e o potencial de diferenciação condrogênica de células progenitoras geradas como mesenquimatos diferem muito de acordo com a densidade celular da monocamada celular 9 .

Usamos EBs para induzir células de crescimento, que é um método relativamente rápido e simples em comparação com a cultura monocamada. Usando este protocolo, conseguimos gerar muitos pellets usando um número relativamente pequeno de HiPSCs ( Tabela 1 ). O tamanho eo número de EBs foram críticos para a produção em massa de pelotização condrogênica bem-sucedida. Por essa razão, ampliamos os EBs agregados no médio E8, até mais de metade dos EBs gerados serem maiores que 100 μm. Após o alargamento EB, mantivemos os EBs em meio E8 sem FGF2. Anteriormente, os pesquisadores mantiveram EBs gerados sem FGF2 para indução de linhagem mesodermalXref "> 9.

Embora tenhamos tentado manter as células de crescimento gerado em alta densidade para uma melhor qualidade, ainda existem várias limitações. Embora tenhamos confirmado que as células de crescimento gerado compartilham uma morfologia similar, as células podem ser ainda heterogêneas. Estudos anteriores tentaram classificar para um tipo de célula específico; No entanto, esse procedimento resultou na coleta de um número reduzido de células. Uma nova tentativa de isolar células de crescimento prolongado em uma escala maior será necessária para gerar uma grande quantidade de grânulos condrogênicos com características aprimoradas.

Vários grupos estão induzindo células progenitoras de hiPSCs usando monocamada ou EB cultura. A indução de células progenitoras com alta similaridade com MSCs pode ser a chave para a obtenção de grânulos condrogénicos de maior qualidade. Essas células progenitoras derivadas de EBs apresentam características semelhantes às dos MSCs. No entanto, isso pode ser devido àNatureza fibroblástica. Portanto, é necessário um estudo de validação detalhado sobre as células de crescimento.

Neste estudo, sugerimos um protocolo que possa gerar uma quantidade relativamente grande de grânulos condrogênicos. Confirmamos que a cartilagem regenerada usando CBMC-hiPSCs mostrou um fenótipo saudável e pode ser usada como material para regeneração de tecidos. No entanto, um método melhorado com uma linha de tempo de diferenciação mais curta é necessário para uma aplicação posterior. O desenvolvimento adicional de padrões de controle de qualidade para validar a cartilagem com um nível mais alto de hialina também é necessário para futuras aplicações de CBMC-hiPSCs como material celular para regeneração de cartilagem. O protocolo é simples, mas eficaz, e não exige nenhum processo de triagem adicional antes da formação de pelozes. Em conclusão, usando este protocolo, pellets condrogênicos de alta qualidade podem ser gerados para estudos sobre modelagem de doenças, rastreio de drogas e medicamentos regenerativos para promover nossa compreensão de tA natureza da cartilagem.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores não têm nada a revelar.

Acknowledgements

Este trabalho foi apoiado por uma doação do projeto de pesquisa e desenvolvimento em tecnologia de saúde da Coréia, Ministério da Saúde, Assistência e Assuntos Familiares, República da Coréia (HI16C2177).

Materials

Name Company Catalog Number Comments
Plasticware
100 mm Dish TPP 93100
6-well Plate TPP 92006
50 mL Cornical Tube SPL 50050
15 mL Cornical Tube SPL 50015
10 mL Disposable Pipette Falcon 7551
5 mL Disposable Pipette Falcon 7543
12-well Plate TPP 92012
Name Company Catalog Number Description
E8 Medium Materials
DMEM/F12, HEPES Life Technologies 11330-057 E8 Medium (500 mL)
Sodium Bicarbonate Life Technologies 25080-094 E8 Medium (Conc.: 543 μg/mL)
Sodium Selenite Sigma Aldrich S5261 E8 Medium  (Conc.: 14 ng/mL)
Human Transfferin Sigma Aldrich T3705 E8 Medium (Conc.: 10.7 μg/mL)
Basic FGF2 Peprotech 100-18B E8 Medium  (Conc.: 100 ng/mL)
Human Insulin Life Technologies 12585-014 E8 Medium (Conc.: 20 μg/mL)
Human TGFβ1 Peprotech 100-21 E8 Medium (Conc.: 2 ng/mL)
Ascorbic Acid Sigma Aldrich A8960 E8 Medium  (Conc.: 64 μg/mL)
DPBS Life Technologies 14190-144
Vitronectin Life Technologies A14700
ROCK Inhibitor Sigma Aldrich Y0503
Name Company Catalog Number Description
Quality Control Materials
18 mm Cover Glass Superior HSU-0111580
4% Paraformaldyhyde Tech & Innovation BPP-9004
Triton X-100 BIOSESANG 9002-93-1
Bovine Serum Albumin Vector Lab SP-5050
Anti-SSEA4 Antibody Millipore MAB4304
Anti-Oct4 Antibody Santa Cruz SC9081
Anti-TRA-1-60 Antibody Millipore MAB4360
Anti-Sox2 Antibody Biolegend 630801
Anti-TRA-1-81 Antibody Millipore MAB4381
Anti-Klf4 Antibody Abcam ab151733
Alexa Fluor 488 goat anti-mouse IgG (H+L) antibody Molecular Probe A11029
Alexa Fluor 594 goat anti-rabbit IgG (H+L) antibody Molecular Probe A11037
DAPI Molecular Probe D1306
Prolong gold antifade reagent Invitrogen P36934
4% Paraformaldyhyde Tech & Innovation BPP-9004
Tween 20 BIOSESANG T1027
Bovine Serum Albumin Vector Lab SP-5050
Anti-Collagen II antibody abcam  ab34712 1:100
Alcian blue Sigma Aldrich A3157-10G
Fast Green FCF Sigma Aldrich F7252-25G
Safranin O Sigma Aldrich 090m0039v
Nuclear fast red Americanmastertech STNFR100 
xylene Duksan 115 
Ethanol Duksan 64-17-5
Mayer's hematoxylin solution wako pure chemical industries LAK7534
DAP VECTOR LABORATORIES SK-4100
Slide Glass, Coated Hyun Il Lab-Mate HMA-S9914
Trizol Invitrogen 15596-018
Chloroform Sigma Aldrich 366919
Isoprypylalcohol Millipore 109634
Ethanol Duksan 64-17-5
RevertAid First Strand cDNA Synthesis kit Thermo Scientfic K1622
Name Company Catalog Number Description
Chondrogenic Differentiation Materials
DMEM Life Technologies 11885 Chondrogenic media component (500 mL)
Penicilin Streptomycin Life Technologies P4333 Chondrogenic media component (Conc.: 1%)
Ascorbic Acid Sigma Aldrich A8960 Chondrogenic media component (Conc.: 64 μg/mL) 
MEM Non-Essential Amino Acids Solution (100x) Life Technologies 11140-050 Chondrogenic media component (Conc.: 100 mM)
rhBMP-2 R&D 355-BM-050 Chondrogenic media component (Conc.:100 ng/ml)
Recombinant Hman TGF-beta3 R&D 243-B3-002 Chondrogenic media component (Conc.:10 ng/ml)
KnockOut Serum Replacement Life Technologies 10828-028 Chondrogenic media component (Conc.: 1%)
ITS+ Premix BD 354352 Chondrogenic media component (Conc.: 1%)
Dexamethasone-Water Soluble  Sigma Aldrich D2915-100MG Chondrogenic media component (Conc.:10-7 M)
GlutaMAX Supplement Life Technologies 35050-061 Chondrogenic media component (Conc.: 1%)
Sodium pyruvate solution Sigma Aldrich S8636 Chondrogenic media component (Conc.: 1%)
L-Proline Sigma Aldrich P5607-25G Chondrogenic media component (40 μg/ml)

DOWNLOAD MATERIALS LIST

References

  1. van Osch, G. J., et al. Cartilage repair: past and future--lessons for regenerative medicine. J Cell Mol Med. 13, (5), 792-810 (2009).
  2. Ahmed, T. A., Hincke, M. T. Strategies for articular cartilage lesion repair and functional restoration. Tissue Eng Part B Rev. 16, (3), 305-329 (2010).
  3. Diekman, B. O., et al. Cartilage tissue engineering using differentiated and purified induced pluripotent stem cells. Proc Natl Acad Sci USA. 109, (47), 19172-19177 (2012).
  4. Solchaga, L. A., Penick, K., Goldberg, V. M., Caplan, A. I., Welter, J. F. Fibroblast growth factor-2 enhances proliferation and delays loss of chondrogenic potential in human adult bone-marrow-derived mesenchymal stem cells. Tissue Eng Part A. 16, (3), 1009-1019 (2010).
  5. Guzzo, R. M., Drissi, H. Differentiation of Human Induced Pluripotent Stem Cells to Chondrocytes. Methods Mol Biol. 1340, 79-95 (2015).
  6. Drissi, H., Gibson, J. D., Guzzo, R. M., Xu, R. H. Derivation and Chondrogenic Commitment of Human Embryonic Stem Cell-Derived Mesenchymal Progenitors. Methods Mol Biol. 1340, 65-78 (2015).
  7. Nejadnik, H., et al. Improved approach for chondrogenic differentiation of human induced pluripotent stem cells. Stem Cell Rev. 11, (2), 242-253 (2015).
  8. Teramura, T., et al. Induction of mesenchymal progenitor cells with chondrogenic property from mouse-induced pluripotent stem cells. Cell Reprogram. 12, (3), 249-261 (2010).
  9. Koyama, N., et al. Human induced pluripotent stem cells differentiated into chondrogenic lineage via generation of mesenchymal progenitor cells. Stem Cells Dev. 22, (1), 102-113 (2013).
  10. Ko, J. Y., Kim, K. I., Park, S., Im, G. I. In vitro chondrogenesis and in vivo repair of osteochondral defect with human induced pluripotent stem cells. Biomaterials. 35, (11), 3571-3581 (2014).
  11. Nam, Y., Rim, Y. A., Jung, S. M., Ju, J. H. Cord blood cell-derived iPSCs as a new candidate for chondrogenic differentiation and cartilage regeneration. Stem Cell Res Ther. 8, (1), 16 (2017).
  12. Hotten, G. C., et al. Recombinant human growth/differentiation factor 5 stimulates mesenchyme aggregation and chondrogenesis responsible for the skeletal development of limbs. Growth Factors. 13, (1-2), 65-74 (1996).
  13. Murphy, M. K., Huey, D. J., Hu, J. C., Athanasiou, K. A. TGF-beta1, GDF-5, and BMP-2 stimulation induces chondrogenesis in expanded human articular chondrocytes and marrow-derived stromal cells. Stem Cells. 33, (3), 762-773 (2015).
  14. Shintani, N., Siebenrock, K. A., Hunziker, E. B. TGF-ss1 enhances the BMP-2-induced chondrogenesis of bovine synovial explants and arrests downstream differentiation at an early stage of hypertrophy. PLoS One. 8, (1), e53086 (2013).
  15. Fukumoto, T., et al. Combined effects of insulin-like growth factor-1 and transforming growth factor-beta1 on periosteal mesenchymal cells during chondrogenesis in vitro. Osteoarthritis Cartilage. 11, (1), 55-64 (2003).
  16. Worster, A. A., Nixon, A. J., Brower-Toland, B. D., Williams, J. Effect of transforming growth factor beta1 on chondrogenic differentiation of cultured equine mesenchymal stem cells. Am J Vet Res. 61, (9), 1003-1010 (2000).
  17. Knippenberg, M., et al. Differential effects of bone morphogenetic protein-2 and transforming growth factor-beta1 on gene expression of collagen-modifying enzymes in human adipose tissue-derived mesenchymal stem cells. Tissue Eng Part A. 15, (8), 2213-2225 (2009).
  18. Jang, Y., et al. Centrifugal gravity-induced BMP4 induces chondrogenic differentiation of adipose-derived stem cells via SOX9 upregulation. Stem Cell Res Ther. 7, (1), 184 (2016).
  19. Kang, R., et al. Mesenchymal stem cells derived from human induced pluripotent stem cells retain adequate osteogenicity and chondrogenicity but less adipogenicity. Stem Cell Res Ther. 6, 144 (2015).
  20. Tao, H., et al. Biological evaluation of human degenerated nucleus pulposus cells in functionalized self-assembling peptide nanofiber hydrogel scaffold. Tissue Eng Part A. 20, (11-12), 1621-1631 (2014).
  21. Sekiya, I., Larson, B. L., Vuoristo, J. T., Reger, R. L., Prockop, D. J. Comparison of effect of BMP-2, -4, and -6 on in vitro cartilage formation of human adult stem cells from bone marrow stroma. Cell Tissue Res. 320, (2), 269-276 (2005).
  22. Shen, B., Wei, A., Tao, H., Diwan, A. D., Ma, D. D. BMP-2 enhances TGF-beta3-mediated chondrogenic differentiation of human bone marrow multipotent mesenchymal stromal cells in alginate bead culture. Tissue Eng Part A. 15, (6), 1311-1320 (2009).
  23. Rim, Y. A., Nam, Y., Ju, J. H. Induced Pluripotent Stem Cell Generation from Blood Cells Using Sendai Virus and Centrifugation. J Vis Exp. (118), (2016).
  24. Kim, Y., et al. The Generation of Human Induced Pluripotent Stem Cells from Blood Cells: An Efficient Protocol Using Serial Plating of Reprogrammed Cells by Centrifugation. Stem Cells Int. 2016, 1329459 (2016).
  25. Oldershaw, R. A., et al. Directed differentiation of human embryonic stem cells toward chondrocytes. Nat Biotechnol. 28, (11), 1187-1194 (2010).
  26. Toh, W. S., et al. Differentiation and enrichment of expandable chondrogenic cells from human embryonic stem cells in vitro. J Cell Mol Med. 13, (9B), 3570-3590 (2009).
  27. Hwang, N. S., Varghese, S., Elisseeff, J. Derivation of chondrogenically-committed cells from human embryonic cells for cartilage tissue regeneration. PLoS One. 3, (6), e2498 (2008).
  28. Nakagawa, T., Lee, S. Y., Reddi, A. H. Induction of chondrogenesis from human embryonic stem cells without embryoid body formation by bone morphogenetic protein 7 and transforming growth factor beta1. Arthritis Rheum. 60, (12), 3686-3692 (2009).
  29. Guzzo, R. M., Scanlon, V., Sanjay, A., Xu, R. H., Drissi, H. Establishment of human cell type-specific iPS cells with enhanced chondrogenic potential. Stem Cell Rev. 10, (6), 820-829 (2014).
  30. Rim, Y. A., Park, N., Nam, Y., Ju, J. H. Generation of Induced-pluripotent Stem Cells Using Fibroblast-like Synoviocytes Isolated from Joints of Rheumatoid Arthritis Patients. J Vis Exp. (116), (2016).
  31. Pfaff, N., et al. Efficient hematopoietic redifferentiation of induced pluripotent stem cells derived from primitive murine bone marrow cells. Stem Cells Dev. 21, (5), 689-701 (2012).
  32. Xu, H., et al. Highly efficient derivation of ventricular cardiomyocytes from induced pluripotent stem cells with a distinct epigenetic signature. Cell Res. 22, (1), 142-154 (2012).
  33. Lee, S. B., et al. Contribution of hepatic lineage stage-specific donor memory to the differential potential of induced mouse pluripotent stem cells. Stem Cells. 30, (5), 997-1007 (2012).
  34. Hu, S., et al. Effects of cellular origin on differentiation of human induced pluripotent stem cell-derived endothelial cells. JCI Insight. 1, (8), 1-12 (2016).
  35. Vonk, L. A., de Windt, T. S., Slaper-Cortenbach, I. C., Saris, D. B. Autologous, allogeneic, induced pluripotent stem cell or a combination stem cell therapy? Where are we headed in cartilage repair and why: a concise review. Stem Cell Res Ther. 6, (94), 1-11 (2015).
  36. Gomez-Leduc, T., et al. Chondrogenic commitment of human umbilical cord blood-derived mesenchymal stem cells in collagen matrices for cartilage engineering. Sci Rep. 6, 32786 (2016).
  37. Mareschi, K., et al. Isolation of human mesenchymal stem cells: bone marrow versus umbilical cord blood. Haematologica. 86, (10), 1099-1100 (2001).
  38. Wexler, S. A., et al. Adult bone marrow is a rich source of human mesenchymal 'stem' cells but umbilical cord and mobilized adult blood are not. Br J Haematol. 121, (2), 368-374 (2003).
  39. Zhang, X., et al. Isolation and characterization of mesenchymal stem cells from human umbilical cord blood: reevaluation of critical factors for successful isolation and high ability to proliferate and differentiate to chondrocytes as compared to mesenchymal stem cells from bone marrow and adipose tissue. J Cell Biochem. 112, (4), 1206-1218 (2011).
  40. Wagner, W., et al. Replicative senescence of mesenchymal stem cells: a continuous and organized process. PLoS One. 3, (5), e2213 (2008).
  41. Tarte, K., et al. Clinical-grade production of human mesenchymal stromal cells: occurrence of aneuploidy without transformation. Blood. 115, (8), 1549-1553 (2010).
  42. Chen, W. C., et al. Prediction of poor survival by cyclooxygenase-2 in patients with T4 nasopharyngeal cancer treated by radiation therapy: clinical and in vitro studies. Head Neck. 27, (6), 503-512 (2005).
  43. Guzzo, R. M., Gibson, J., Xu, R. H., Lee, F. Y., Drissi, H. Efficient differentiation of human iPSC-derived mesenchymal stem cells to chondroprogenitor cells. J Cell Biochem. 114, (2), 480-490 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics