Kondrogen pelletsdannelse fra ledningsblod-afledte inducerede pluripotente stamceller

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Her foreslår vi en protokol for chondrogen differentiering fra ledningsblodmononukleære celleafledte humant inducerede pluripotente stamceller.

Cite this Article

Copy Citation | Download Citations

Nam, Y., Rim, Y. A., Ju, J. H. Chondrogenic Pellet Formation from Cord Blood-derived Induced Pluripotent Stem Cells. J. Vis. Exp. (124), e55988, doi:10.3791/55988 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Human ledbrusk mangler evnen til at reparere sig selv. Bruskdegeneration behandles således ikke ved helbredende men ved konservative behandlinger. I øjeblikket bestræbes der på at regenerere beskadiget brusk med ex vivo ekspanderede chondrocytter eller knoglemarvafledte mesenkymale stamceller (BMSC'er). Den begrænsede levedygtighed og ustabilitet af disse celler begrænse deres anvendelse i brusk-rekonstruktion. Humant inducerede pluripotente stamceller (hiPSCs) har modtaget videnskabelig opmærksomhed som et nyt alternativ til regenerative applikationer. Med ubegrænset selvfornyelsesevne og multipotens er hiPSCs blevet fremhævet som en ny erstatningscellekilde til bruskreparation. At opnå en høj mængde chondrogenpellets af høj kvalitet er imidlertid en stor udfordring for deres kliniske anvendelse. I denne undersøgelse anvendte vi embryoidlegeme (EB) -afledte udvækstceller til chondrogen differentiering. Succesfuld chondrogenese blev bekræftet af PCR anD farvning med alcianblåt, toluidinblåt og antistoffer mod henholdsvis kollagentyperne I og II (henholdsvis COL1A1 og COL2A1). Vi tilvejebringer en detaljeret metode til differentiering af blodmononukleære celleafledte iPSC'er (CBMC-hiPSC'er) til chondrogenpellets.

Introduction

Brugen af ​​hiPSC'er repræsenterer en ny strategi for lægemiddel screening og mekanistiske undersøgelser af forskellige sygdomme. Fra et regenerativt perspektiv er hiPSC'er også en potentiel kilde til udskiftning af beskadigede væv, der har begrænset helbredelsesevne, såsom ledbrusk 1 , 2 .

Regenerering af indfødt leddbrusk har været en udfordring i flere årtier. Ledbrusk er et blødt, hvidt væv, der strækker slutningen af ​​knoglerne og beskytter dem mod friktion. Det har dog begrænset regenerativ evne, når den er beskadiget, hvilket gør selvreparation næsten umulig. Derfor har forskning fokuseret på bruskregenerering været igangværende i flere årtier.

Tidligere blev in vitro differentiering i den kondrogeniske linie sædvanligvis udført med BMSC'er eller native chondrocytter isoleret fra knæleddet 3 . På grund af tO deres chondrogen potentiale, BMSC'er og native kondrocytter har mange fordele, der støtter deres anvendelse i chondrogenese. På grund af deres begrænsede ekspansion og ustabile fænotype står disse celler imidlertid over for flere begrænsninger ved genopbygningen af ​​leddbruskdefekter. Under in vitro kulturbetingelser har disse celler tendens til at miste deres egen karakteristika efter 3-4 passager, hvilket i sidste ende påvirker deres differentieringsevner 4 . Også i tilfælde af native kondrocytter er yderligere skader på knæleddet uundgåeligt, når man opnår disse celler.

I modsætning til BMSC'er eller native kondrocytter kan hiPSC'er uendeligt udvide in vitro . Med de rette kulturbetingelser har hiPSC'er stort potentiale som en erstatningskilde for chondrogen differentiering. Imidlertid er det udfordrende at ændre de høje egenskaber hos hiPSCs 5 . Desuden tager det flere komplicerede in vitro stePs til at styre hiPSCs skæbne til en bestemt celletype. På trods af disse komplikationer anbefales brug af hiPSC'er stadig på grund af deres høje selvfornyelsesevner og deres evne til at differentiere til målrettede celler, herunder chondrocytter 6 .

Kondrogene differentiering udføres sædvanligvis med tredimensionale dyrkningssystemer, såsom pelletkulturen eller mikromassekulturen ved anvendelse af MSC-lignende stamceller. Hvis du bruger hiPSC'er, adskiller protokollen til at generere MSC-lignende stamceller fra de eksisterende protokoller. Nogle grupper bruger monolagskultur af hiPSC'er til direkte at omdanne fænotypen til MSC-lignende celler 7 . De fleste studier bruger dog EB'er til at generere udvækstceller, der ligner MSC 8 , 9 , 10 , 11 .

Forskellige typer vækstfaktorer anvendes til at fremkalde chondrogeNesis. Normalt anvendes BMP- og TGFβ-familieproteiner alene eller i kombination. Differentiering er også blevet induceret med andre faktorer, såsom GDF5, FGF2 og IGF1 12 , 13 , 14 , 15 . TGFβ1 har vist sig at stimulere chondrogenese på en dosisafhængig måde i MSC'er 16 . Sammenlignet med den anden isotype, TGFβ3, inducerer TGFβ1 chondrogenese ved at forøge præ-brusk-mesenkymcellekondensationen. TGFβ3 inducerer chondrogenese ved signifikant at forøge mesenchymcelleproliferationen 17 . Imidlertid anvendes TGFβ3 oftere af forskere end TGFβ1 7 , 10 , 18 , 19 . BMP2 forøger ekspressionen af ​​gener relateret til de chondrogeniske matrixkomponenter i humantArtikulære chondrocytter under in vitro betingelser 20 . BMP2 øger ekspressionen af ​​gener, der er kritiske for bruskdannelse i MSC'er i kombination med TGFβ-proteiner 21 . Det har også vist sig, at BMP2 synergistisk forøger effekten af ​​TGFβ3 gennem Smad- og MAPK-banerne 22 .

I denne undersøgelse blev CBMC-hiPSC'er aggregeret i EB'er ved anvendelse af EB-medium i en petriskål med lav vedhæftning. Udvækstceller blev induceret ved at binde EB'erne til en gelatinecoated skål. Kondrogene differentiering ved hjælp af udvækstceller blev udført ved pellets kultur. Behandling med både BMP2 og TGFβ3 kondenserede succesfuldt cellerne og induceret ekstracellulær matrix (ECM) proteinakkumulering til chondrogen pelletsdannelse. Denne undersøgelse antyder en simpel, men effektiv chondrogene differentieringsprotokol ved anvendelse af CBMC-hiPSC'er.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Denne protokol blev godkendt af det institutionelle reviewskort i det katolske universitet i Korea (KC12TISI0861). CBMC'er, der blev anvendt til omprogrammering, blev direkte hentet fra Cord Blood Bank i Seoul St. Mary's Hospital.

1. Chondrogen Differentiering fra iPSCs

  1. CBMC-iPSC generation
    1. Generer CBMC-hiPSC'er ved hjælp af protokollen vist i vores tidligere arbejde 23 .
    2. Saml blodcellerne i et 15 ml konisk rør og tæl dem med et hæmocytometer.
    3. Klargør 3 x 10 5 celler og centrifuger dem i 5 minutter ved 515 xg og RT. Kassér supernatanten ved sugning og resuspender cellerne i 0,5 ml blodcellemedium.
    4. Overfør cellerne til en brønd i en ikke-belagt 24-brønds plade og tilsæt Sendai-virusblandingen efter producentens anbefalinger.
    5. Centrifuger pladen i 30 minutter ved 1.150 xg og 30 ° C.
    6. AftCentrifugering inkuberer cellerne natten over (O / N) ved 37 ° C i 5% C02.
    7. Den næste dag overfører de transducerede celler til en matrixbelagt brønd. Centrifuger pladen ved 1.150 xg i 30 minutter ved 30 ° C.
    8. Efter centrifugering fjernes supernatanten, tilsættes 1 ml iPSC-medium og opretholder cellerne O / N ved 37 ° C i 5% CO 2 .
    9. Vedligehold de vedhæftede celler ved 37 ° C og 5% CO 2 . Skift mediet dagligt, og udskift det med nyt iPSC-medium.
      BEMÆRK: Kolonier vises på dag 14-21 efter transduktion.
  2. EB generation
    1. Vedligehold hiPSC'erne ved 37 ° C og 5% CO 2 . Ændre mediet dagligt, erstatte det med frisk Essential 8 (E8) medium.
    2. Klargør 2 x 10 6 hiPSC'er i en Vitronectin-belagt, 100 mm skål i E8-medium.
    3. Fjern E8-mediet fra dyrkningsskålen og vask med sterilt phosphatbufret saltvand (PBS).
    4. Tilføj 1Ml 1 mM ethylendiamintetraeddikesyre (EDTA) og inkuber ved 37 ° C og 5% CO2 i 2 minutter.
    5. Høst cellerne med 3 ml E8-medium og overfør dem til et nyt 15 ml konisk rør. Centrifuger cellerne ved 250 xg ved stuetemperatur (RT) i 2 minutter.
    6. Aspirer supernatanten uden at forstyrre cellepellet og resuspender cellerne i 5 ml E8-medium.
    7. Tæl cellerne ved hjælp af et hæmocytometer og tilbered 2 x 10 6 celler for hver 100 mm petriskål. Resuspender de fremstillede celler i en 10 ml blanding af E8 og EB-medium (1: 1) med 10 μM rho-associeret kinase (ROCK) inhibitor.
    8. Inkuber cellerne O / N til aggregering ved 37 ° C og 5% CO2.
    9. På den følgende dag høste de aggregerede EB'er ved pipettering. Centrifuger cellerne ved 250 xg i 1 min. Fjern supernatanten og resuspender EB'erne i 10 ml frisk E8-medium.
    10. Forstør de genererede EB'er i 5 dage, udfører daglige ændringer med fresH E8 medium. For yderligere modning, skift kulturmediet til E7-medium. Vedligeholde EB'erne ved 37 ° C og 5% CO 2 i yderligere 5 dage, og udfør daglige medieændringer med frisk E7-medium.
      BEMÆRK: E7-medium er E8-medium uden FGF2.
  3. Udvækstcelleinduktion fra EB'er
    1. Tilsæt 6 ml 1% gelatine til en 100 mm skål og inkuber ved 37 ° C og 5% CO2 i 30 minutter.
    2. Fjern gelatinen og tør retten helt i 2-3 timer før brug.
    3. Overfør EB'erne til et 50 ml konisk rør. Lad EB'erne sætte sig i bunden af ​​det koniske rør. Fjern supernatanten uden at forstyrre EB'erne.
    4. Resuspender EB'erne i 10 ml Dulbecco's Modified Eagle's Medium (DMEM) med 20% føtalt bovint serum (FBS). Overfør EB'erne til den gelatinekovertede 100 mm skål. Tilsæt 10 μM ROCK inhibitor.
    5. Inkubér og vedligehold cellerne ved 37 ° C og 5% CO2 i 7 dage. Skift migDium hver anden dag uden at tilføje ROCK-hæmmer.
  4. Kondrogen pelletsdannelse
    1. Aspirér kulturmediet fra parabolanten og vask cellerne tre gange med PBS.
    2. Påfør 1 ml 1 mM EDTA og inkuber ved 37 ° C og 5% CO2 i 2 minutter.
    3. Høst cellerne ved at bruge 5 ml DMEM med 20% FBS og overfør dem til et nyt 15 ml konisk rør.
    4. Centrifuger cellerne i 2 minutter ved 250 xg og RT. Kassér supernatanten og resuspender pelleten i 10 ml DMEM med 20% FBS.
    5. Filtrer og kassér celleklumperne ved brug af en 40 μm cellefil og høst enkeltcellerne. Tæl de enkelte celler ved hjælp af et hæmocytometer.
    6. Centrifuger cellerne i 2 minutter ved 250 xg og RT. Fjern supernatanten og frø 3 x 10 5 celler pr. Pille i et 15 ml konisk rør med 300 μl chondrogen differentieringsmedium (CDM).
    7. Til pelletsdannelse centrifugeres cellerne i 5 minutter ved680 xg og RT.
      BEMÆRK: Pellets opretholdes i 15 ml koniske rør under differentieringen af ​​de kondrogeniske pellets.
    8. Inkuber cellerne natten over ved 37 ° C og 5% CO2.
    9. Skift CDM hver 2-3 dage. Inden for 3 dage vil pellets udvise fladede, sfæriske morfologier. Vedligeholdelse af pellets i 21 dage ved 37 ° C og 5% CO2.

2. Kondrogen pellets karakterisering ved farvning

  1. Kondrogen indlejring
    1. Før indlejring skal du forberede og smelte paraffin ved 58 ° C.
    2. Fastgør pellets i 1 ml 4% paraformaldehyd i 2 timer ved stuetemperatur i et 1,5 ml rør.
      Forsigtig: Paraformaldehyd er meget giftig. Undgå kontakt med øjne, hud eller slimhinder. Minimere eksponeringen og undgå indånding under forberedelsen.
    3. Anbring et lag af gasbind på kassetten og overfør de faste piller med en pipette. Dæk pelleten ved at folde denE gasbind og luk kassettekslet.
    4. Start dehydrering i 100 ml 70% ethanol (EtOH) to gange, 10 minutter hver. Dehydrere pellets gennem sekventielle 10 minutters vask i 80% og 95% EtOH.
    5. Overfør pelletsene til 100% EtOH i 10 minutter. Gentag tre gange med frisk EtOH.
    6. Til "clearing" bytter opløsningen til en 100 ml, 1: 1 blanding af EtOH og xylen efterfulgt af en 1: 2 blanding af EtOH og xylen i 10 minutter hver. Ryd de resterende EtOH ved inkubation af pellets to gange i 100% xylen, 10 minutter hver.
    7. Til paraffininfiltrering inkuberes pelletsene i sekventielle xylen- og paraffinblandinger. Udfør hele paraffininfiltreringsprocessen ved 58 ° C. Inkuber pellets i 100 ml af en 2: 1 blanding af xylen og paraffin i 30 minutter.
    8. Udveksl opløsningen til 100 ml af en 1: 1 blanding af xylen og paraffin og inkuber i 30 minutter.
    9. Udveksl opløsningen til 100 ml af en 1: 2 blanding af xylen og paraffin og inkuber for 30 min.
    10. Til den endelige infiltration overføres pelletsene til det første bad af 100% paraffin og inkuberes i 2 timer.
    11. Overfør pellets til det andet bad med 100% paraffin og inkuber O / N ved 58 ° C.
    12. Den næste dag overfør pelletsne forsigtigt til en form ved hjælp af en pinde. Tilsæt paraffin til støbeformen fra paraffindispenseren. Stiv paraffinen i 30 minutter ved 4 ° C.
    13. Skær sektionerne på 7 μm og overfør sektionerne på diaset. Lad gliderne tørre natten over og opbevar gliderne ved stuetemperatur, indtil de er klar til brug.
  2. Slide forberedelse
    1. Deparaffiniser diasene ved at flytte dem gennem 100 ml 100%, 90%, 80% og 70% EtOH sekventielt i 5 minutter hver.
    2. Placer diasene i en glasburk og skyl det med vand fra vand i 5 minutter.
  3. Alcian blå farvning
    1. Inkubér diasene i 50 ml 1% alcianblåt opløsning i 30 minutter.
      IKKEE: Alcian blue fortyndes i 3% eddikesyreopløsning. Juster pH til 2,5 med eddikesyre.
    2. Placér diasene i en glasburk og skyll med vandhanen i 2 min.
    3. Skyl diaserne i deioniseret vand (DW) og modstain med nuklear hurtig rød opløsning i 2 min.
    4. Placer diasene i en glasburk og skyl det med vand fra ledningen i 1 minut.
    5. 2.3.5) Fortsæt med at dehydrere og montere diasene i trin 2.6.
  4. Toluidine blå farvning
    1. Inkuber dias i 50 ml toluidinblåt opløsning i 4 min.
    2. Placer diasene i en glasburk og skyl det med vand fra vand i 5 minutter.
    3. Fortsæt med at dehydrere og montere diasene i trin 2.6.
  5. Immunohistokemisk farvning
    1. Inkubér diaserne i 3% H202 i 15 minutter til endogen peroxidase-blokering.
    2. Påfør 200 μl primært antistof (anti-COL1A1 og -COL2A1) fortyndet 1: 100 i tris-buFerseret saltvand (TBS) indeholdende 1% bovint serumalbumin (BSA) og 5% normalt gedsserum (NGS) til gliderne og inkuberer O / N ved 4 ° C.
    3. Næste dag skal du placere diasene i en glasbeholder og vaske dem med 50 ml TBS indeholdende 0,1% polysorbat 20 (TBST) tre gange i 5 minutter hver.
    4. Påfør 200 μL sekundært antistof (gede anti-kanin IgG antistof, fortyndet 1: 200 i TBS indeholdende 1% BSA og 5% NGS) til gliderne og inkuber ved RT i 40 minutter.
    5. Placer diasene i en glasburk og vask dem tre gange med 50 ml, 5 min hver.
    6. Til signalforstærkning anvender HRP-konjugat streptavidinopløsning til gliderne og inkuberes i 10 minutter.
    7. Placer diasene i en glasburk og vask dem tre gange med 50 ml, 5 min hver.
    8. Bland DAB-peroxidasubstratopløsningen, påfør 200 μl opløsning på hvert dias, og inkuber i 1 min.
    9. Placer diasene i en glasburk og skyl det med vand fra vand i 5 minutter.
    10. kontrafarveMed Mayer's hæmatoxylin i 1 min.
    11. Vask diasene med DW.
    12. Fortsæt med at dehydrere og montere diasene i trin 2.6.
  6. Dehydrering og montering
    1. Dehydrer diaserne ved at bevæge dem sekventielt gennem 100 ml 70%, 80%, 90% og 100% EtOH, 30 s hver.
    2. Dip gliderne i to ændringer af xylen i 1 min hver.
    3. Tilsæt 50 μL monteringsopløsning til dækslipene og læg gliderne ovenpå.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

I dette studie genererede vi chondrogenpellets fra CBMC-hiPSC'er ved at fremkalde udvækstceller fra EB'er. Kondrogene differentiering blev induceret under anvendelse af CBMC-hiPSC'er med bekræftet høj pluripotens 11 . En simpel skema af vores protokol er vist i figur 1A . Før differentiering blev iPSC-kolonier ekspanderet ( figur 1B ). De udvidede iPSC'er blev samlet som EB'er for at initiere differentiering ( figur 1C ). De dannede EB'er blev bundet til gelatineovertrækede skåle for at inducere udvækstceller ( figur 1D ). Derefter blev udvækstcellerne høstet og anvendt til at danne chondrogenpellets. Efter 21 dages differentiering blev små, perlelignende chondrogenpellets opnået og anvendt til yderligere karakterisering ( figur 1E ). Kvaliteten af ​​den in vitro-genererede chonTørre pellets blev bekræftet gennem forskellige assays.

Vi evaluerede histologisk kvaliteten af ​​de kondrogeniske pellets på dag 21. BMSC-chondrogenpellets blev anvendt som positiv kontrol. Akkumuleringen af ​​ECM proteiner udskilt af de differentierede chondrocytter blev bekræftet ved alcianblåt og toluidinblåt farvning i figur 2A . Hovedegenskaberne ved sund brusk, såsom lacuna og proteoglycanproduktion, steg, da differentieringsprocessen fortsatte i løbet af 21 dage. Kondrogene pellets frembragt fra CBMC-hiPSC'er udtrykte COL2A1, som er den vigtigste ECM-komponent i sund brusk ( figur 2B ). COL2A1-ekspressionen af ​​CBMC-hiPSC-afledte pellets var højere end for BMSC-afledte pellets. Udtrykket af kollagen type I, en markør for fibrotisk brusk, var lavere i CBMC-hiPSC-afledte pellets sammenlignet med ekspressionen af ​​COL2A1. Genekspression af brusk ECM proteiner i dag 21 chondrogen pellets blev bekræftet ved realtids PCR. Agrecan (ACAN) -ekspression af CBMC-hiPSC-afledte pellets lignede den af ​​BMSC-afledte pellets ( Figur 3A ). Udtrykket af COL2A1 var signifikant højere i CBMC-hiPSC-afledte pellets ( Figur 3B ). Udtrykket af kønsbestemmende region Y-box 9 (Sox9), en chondrogen progenitor markør, blev også evalueret. Pellets frembragt fra CBMC-hiPSC'er udtrykte høje niveauer af Sox9 ( figur 3C ). Vi bekræftede, at disse gener var signifikant opreguleret i CBMC-hiPSC-chondrogenpellets sammenlignet med BMSC-kontrolpellets på dag 21. Udtrykket af en hypertrofisk markør, COL1A1, blev evalueret ( Figur 3D ). Udtrykket af COL1A1 i CBMC-hiPSC-afledte pellets blev reduceret sammenlignet med det i BMSC-deriVed pellets. Differentieringseffektiviteten blev analyseret ved forholdet mellem COL2A1 og COL1A1 ( Figur 3E ). Forøgelsen af ​​forholdet i CBMC-hiPSC-afledte pellets viste den relativt høje ekspression af COL2A1 sammenlignet med COL1A1. Som konklusion har vi bekræftet den chondrogeniske differentieringskapacitet hos CBMC-hiPSC'er. Kvaliteten af ​​de dannede CBMC-hiPSC-afledte chondrogenpellets havde en kvalitet, der var forenelig med den for BMSC'er.

figur 1
Figur 1: Kondrogen differentiering af hiPSC'er. ( A ) Skema af chondrogen pelletsgenerering fra hiPSC'er. ( B ) Morfologi af den genererede CBMC-hiPSC. ( C ) Morfologi af genererede EB'er. ( D ) Udvækstceller afledt af EB'er bundet til en gelatinecoated kulturskål. ( E ) Billede af t Han chondrogen pellet efter 21 dages differentiering. Enhederne af intervallerne er vist i millimeter. Skalestænger = 200 μm. Klik her for at se en større version af denne figur.

Figur 2
Figur 2: Histologisk analyse af den kondrogeniske pellet. ( A ) Histologisk evaluering af chondrogenpellets på dag 21 ved anvendelse af alcianblåt og toluidinblåt farvning. ( B ) Immunohistokemi billede af kondrogen pellets farvet med COL1A1 og COL2A1 antistoffer. Skalestænger = 100 μm. Klik her for at se en større version af denne figur.

1" > Figur 3
Figur 3: Genekspression af den kondrogeniske pellet. ( A ) Relativ genekspression af ACAN. ( B ) Relativ genekspression af COL2A1. ( C ) Relativ genekspression af SOX9. ( D ) Relativ genekspression af COL1A1. ( E ) Genekspression af COL1A1. ( F ) Genekspression af COL10A1. ( G ) Forholdet mellem COL2A1: COL1A1-genekspression. Pellets blev høstet og analyseret efter 21 dages differentiering. Data blev opnået ved anvendelse af realtids-PCR og vist som den gennemsnitlige standardfejl af triplikateksperimenter pr. Prøve (n = 3). Genekspression blev normaliseret til GAPDH som en intern kontrol. (* P <0,05, ** p <0,01, *** p <0,001).K "> Venligst klik her for at se en større version af denne figur.

Mobilnummer Udvækstcelleudbytte Pellet udbytte
hiPSCs 2 x 10 6 2-5 x 10 7 70-150
MSC 2 x 10 6 - 6

Tabel 1: Udbytte sammenligning af MSC og hiPSCs.

Målnavn Retning Primer sekvens Størrelse
Frem TTCCGCGACGTGGACAT 77 bp
Bagside TCAAACTCGTTGACATCGAAGGT
EN DÅSE Frem AGCCTGCGCTCCAATGACT 107 bp
Bagside TAATGGAACACGATGCCTTTCA
COL2A1 Frem GGCAATAGCAGGTTCACGTACA 79 bp
Bagside CGATAACAGTCTTGCCCCACTTA
COL1A1 Frem CCCCTGGAAAGAATGGAGATG 148 bp
Bagside TCCAAACCACTGAAACCTCTG

Tabel 2: Sekvenser af primere mod chondrogenmarkører i realtids-PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Denne protokol genererede succesfulde hiPSC'er fra CBMC'er. Vi omprogrammerede CBMC'er til hiPSC'er ved anvendelse af en Sendai viral vektor indeholdende Yamanaka faktorer 24 . Tre sager blev anvendt i differentiering, og alle forsøg med succes fremkaldte chondrogenpellets ved anvendelse af denne protokol. Talrige undersøgelser har rapporteret protokoller til differentieringen af ​​hiPSC'er i chondrocytter 25 , 26 , 27 , 28 . Der kræves dog yderligere forskning for at bekræfte brugen af ​​CBMC-hiPSC'er som en kandidat til regenerering og genopretning af brusk.

Chondrogenese blev bekræftet under anvendelse af hiPSC'er genereret fra forskellige somatiske celletyper 11 , 25 , 26 , 27 , 29 . Mange rapporter viserAt oprindelsen af ​​den somatiske celle, der anvendes til omprogrammering, kan påvirke differentieringsudfaldet af hiPSC'erne 30 , 31 , 32 , 33 . Ledningsblod er en kilde beriget med HSC og MSC'er. Der er ingen rapport om forskellen mellem ledningsblod-afledte celler, såsom blodceller eller MSC'er. Tidligere undersøgelser har imidlertid vist, at ledige chondrocyt-afledte hiPSC'er er mere tilbøjelige til at gå gennem chondrogenese end hiPSC'er genereret fra ledningsblod eller hudfibroblaster 29 . Resultater fra endoteldifferentiering ved hjælp af hiPSC'er frembragt fra fibroblaster, hjerteprogenitorceller og endotelceller viste, at oprindelsesvævet kan reflektere den vævsspecifikke somatiske hukommelse i terminalt differentieret iPSC-derivation, især ved tidlige passager mellem 10 og 20 34 . I tidlige passager af hiPSC'er, endotelcelle-deriVed hiPSC'er differentierede mere effektivt til endotelcellen. Den betydelige forskel mellem disse cellelinier forsvandt dog i hiPSCs over 20 passager. Derfor er det vigtigt at nøje overveje den somatiske hukommelse, der bæres af hiPSC'erne i tidlige passager, når de anvendes i klinisk forskning.

For nylig er der udviklet forskellige procedurer til reparation af defekt ledbrusk. Mikrofraktur udføres ved at bore flere huller i knoglen for at fremkalde tilstrømning af knoglemarv til naturlig reparation 35 . Knæudskiftning, også kendt som knæartroplastisk, bruges til at erstatte det beskadigede brusk. Imidlertid er mikrofraktur ikke anvendelig til alvorlig leddbruskskade, og instrumentet, der anvendes til knæudskiftninger, skal ændres hvert 10.-15. År.

Disse dage er cellebaserede terapier en lovende alternativ metode til brusk reparation. Autolog chondrocytimplantation (ACI) er bredBruges til cellebaseret bruskudvinning. ACI udføres ved direkte injicering af autologe chondrocytter i defekten. Imidlertid omdannes autologe chondrocytter til fibroblastlignende celler under dyrkningsbetingelser in vitro . Yderligere skade er også uundgåelig under høstprocessen af ​​autologe chondrocytter. MSC'er er blevet foreslået som en cellekilde til genfinding af brusk. Ledningsblod er en nyttig og tilgængelig cellekilde til MSC'er til engineering brosk 36 . Succesraten for isolering af lednings-blod-MSC'er er imidlertid kontroversiel 37 , 38 . Talrige undersøgelser rapporterer om vellykket isolering af lednings-blod-MSC'er. Flere undersøgelser har vist, at ledningsblodvolumen er en kritisk parameter, som kan påvirke udbyttet af MSC-isolation 36 , 39 . For at erhverve højkvalitets MSC'er er passagen af ​​cellerne også kritisk. Tidligere undersøgelser angiver thaMSC'er har begrænset levetid efter et bestemt celleopdelingsnummer. Ved at indtaste senescence er MSC'er præget af nedsat proliferation som med enhver normal somatisk celle 40 . Derfor skal ledningsblodafledte MSC'er anvendes før den sjette passage for at undgå celle senescens og kromosomale abnormiteter 41 .

For at undgå disse begrænsninger åbnede menneskelige iPSC'er en ny mulighed for personlig, cellebaseret terapi med høj produktivitet 11 . Etablerede hiPSC'er kan teoretisk proliferere grænseløst. Også med samme immunidentitet som donoren kan de undgå afvisning og lavere bivirkninger, når de implanteres in vivo . Overgangen af ​​trådblodbanker til hiPSC-banker til allogen medicinsk behandling har en enorm mulighed og potentiale 42 . Screeningen af ​​homozygote HLA-typede CBMC'er før omprogrammering kan i vidt omfang udnytte de allogene iPSC linjer foR klinisk behandling. Homozygote iPSC-linjer kan undgå immunologiske reaktioner efter allograftransplantation. Dette koncept kan også anvendes til bruskregenerering ved at generere HLA-homozygot brusk 11 .

Normalt udføres chondrogen differentiering gennem to kritiske trin: induktionen af ​​EB-afledte udvækstceller og pelletdannelse. Den oprindelige differentiering af hiPSC'er til EB-afledte udvækstceller er kritisk for at øge deres chondrogene differentieringspotentiale. Udvækstceller differentieret fra hiPSC'er er funktionelt og molekylært svarende til native BMSC'er 7 , 43 . Tidligere undersøgelser anvendte monolagskultur eller EB-kultur som et pre-differentieringstrin for at inducere mesenkymlignende celler 10 , 43 . Imidlertid er direkte differentiering ved monolagskultur tidskrævende sammenlignet med brugen af ​​EB'er og ch Ondrogene pellets har tendens til at differentiere til fibrocartilage med hypertrofe egenskaber. Det blev rapporteret, at cellemorfologi og det chondrogeniske differentieringspotentiale for genererede mesenkymlignende progenitorceller adskiller sig meget afhængigt af celletætheden af ​​cellemonolaget 9 .

Vi brugte EB'er til at inducere udvækstceller, hvilket er en relativt hurtig og enkel metode i forhold til monolagskulturen. Ved hjælp af denne protokol kunne vi generere mange pellets ved hjælp af et relativt lille antal hiPSC'er ( tabel 1 ). Størrelsen og antallet af EB'er var kritiske for succesfuld chondrogen pelletsmasseproduktion. Derfor udvide vi de aggregerede EB'er i E8-medium, indtil mere end halvdelen af ​​de genererede EB'er var større end 100 μm. Efter EB-udvidelsen opretholdt vi EB'erne i E8-medium uden FGF2. Tidligere opretholdt forskere genererede EB'er uden FGF2 til mesodermal linieinduktionXref "> 9.

Selvom vi forsøgte at opretholde de dannede vækstvoksceller ved en høj densitet for bedre kvalitet, er der stadig flere begrænsninger. Selvom vi har bekræftet, at de frembragte vækstvoksne deler en lignende morfologi, kan cellerne stadig være heterogene. Tidligere undersøgelser har forsøgt at sortere for en bestemt celletype; Denne procedure har imidlertid resulteret i indsamling af et lavt antal celler. Et nyt forsøg på at isolere homogene udvækstceller i større målestok vil være påkrævet for at frembringe en stor mængde chondrogenpellets med forbedrede egenskaber.

Forskellige grupper inducerer progenitorceller fra hiPSC'er ved anvendelse af monolag eller EB-kultur. Induktionen af ​​stamceller med høj lighed med MSC'er kan være nøglen til opnåelse af chondrogenpellets af højere kvalitet. Disse stamceller, der er afledt af EB'er, har egenskaber, der ligner dem hos MSC'er. Dette kan dog være på grund afIr fibroblastisk natur. Derfor er der behov for en detaljeret valideringsundersøgelse af udvækstcellerne.

I denne undersøgelse foreslår vi en protokol, der kan generere en forholdsvis stor mængde chondrogenpellets. Vi bekræftede, at brusk regenereret ved hjælp af CBMC-hiPSC'er viste en sund fænotype og kan bruges som materiale til vævsregenerering. En forbedret metode med en kortere differentierings tidslinje er imidlertid nødvendig for yderligere anvendelse. Den videre udvikling af kvalitetskontrolstandarder til validering af brusk med et højere niveau af hyalin er også nødvendigt for fremtidige anvendelser af CBMC-hiPSC'er som cellemateriale til bruskregenerering. Protokollen er enkel, men effektiv og kræver ikke yderligere sorteringsprocesser før pelletsdannelse. Som konklusion kan der ved anvendelse af denne protokol genereres chondrogenpellets af høj kvalitet til undersøgelser af sygdomsmodellering, lægemiddel screening og regenerativ medicin for at fremme vores forståelse af tHan karakter af brusk.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har intet at afsløre.

Acknowledgements

Dette arbejde blev støttet af et tilskud fra Korea Healthcare Technology R & D-projektet, Ministeriet for Sundhed, Velfærd og Familie, Republikken Korea (HI16C2177).

Materials

Name Company Catalog Number Comments
Plasticware
100 mm Dish TPP 93100
6-well Plate TPP 92006
50 mL Cornical Tube SPL 50050
15 mL Cornical Tube SPL 50015
10 mL Disposable Pipette Falcon 7551
5 mL Disposable Pipette Falcon 7543
12-well Plate TPP 92012
Name Company Catalog Number Description
E8 Medium Materials
DMEM/F12, HEPES Life Technologies 11330-057 E8 Medium (500 mL)
Sodium Bicarbonate Life Technologies 25080-094 E8 Medium (Conc.: 543 μg/mL)
Sodium Selenite Sigma Aldrich S5261 E8 Medium  (Conc.: 14 ng/mL)
Human Transfferin Sigma Aldrich T3705 E8 Medium (Conc.: 10.7 μg/mL)
Basic FGF2 Peprotech 100-18B E8 Medium  (Conc.: 100 ng/mL)
Human Insulin Life Technologies 12585-014 E8 Medium (Conc.: 20 μg/mL)
Human TGFβ1 Peprotech 100-21 E8 Medium (Conc.: 2 ng/mL)
Ascorbic Acid Sigma Aldrich A8960 E8 Medium  (Conc.: 64 μg/mL)
DPBS Life Technologies 14190-144
Vitronectin Life Technologies A14700
ROCK Inhibitor Sigma Aldrich Y0503
Name Company Catalog Number Description
Quality Control Materials
18 mm Cover Glass Superior HSU-0111580
4% Paraformaldyhyde Tech & Innovation BPP-9004
Triton X-100 BIOSESANG 9002-93-1
Bovine Serum Albumin Vector Lab SP-5050
Anti-SSEA4 Antibody Millipore MAB4304
Anti-Oct4 Antibody Santa Cruz SC9081
Anti-TRA-1-60 Antibody Millipore MAB4360
Anti-Sox2 Antibody Biolegend 630801
Anti-TRA-1-81 Antibody Millipore MAB4381
Anti-Klf4 Antibody Abcam ab151733
Alexa Fluor 488 goat anti-mouse IgG (H+L) antibody Molecular Probe A11029
Alexa Fluor 594 goat anti-rabbit IgG (H+L) antibody Molecular Probe A11037
DAPI Molecular Probe D1306
Prolong gold antifade reagent Invitrogen P36934
4% Paraformaldyhyde Tech & Innovation BPP-9004
Tween 20 BIOSESANG T1027
Bovine Serum Albumin Vector Lab SP-5050
Anti-Collagen II antibody abcam  ab34712 1:100
Alcian blue Sigma Aldrich A3157-10G
Fast Green FCF Sigma Aldrich F7252-25G
Safranin O Sigma Aldrich 090m0039v
Nuclear fast red Americanmastertech STNFR100 
xylene Duksan 115 
Ethanol Duksan 64-17-5
Mayer's hematoxylin solution wako pure chemical industries LAK7534
DAP VECTOR LABORATORIES SK-4100
Slide Glass, Coated Hyun Il Lab-Mate HMA-S9914
Trizol Invitrogen 15596-018
Chloroform Sigma Aldrich 366919
Isoprypylalcohol Millipore 109634
Ethanol Duksan 64-17-5
RevertAid First Strand cDNA Synthesis kit Thermo Scientfic K1622
Name Company Catalog Number Description
Chondrogenic Differentiation Materials
DMEM Life Technologies 11885 Chondrogenic media component (500 mL)
Penicilin Streptomycin Life Technologies P4333 Chondrogenic media component (Conc.: 1%)
Ascorbic Acid Sigma Aldrich A8960 Chondrogenic media component (Conc.: 64 μg/mL) 
MEM Non-Essential Amino Acids Solution (100x) Life Technologies 11140-050 Chondrogenic media component (Conc.: 100 mM)
rhBMP-2 R&D 355-BM-050 Chondrogenic media component (Conc.:100 ng/ml)
Recombinant Hman TGF-beta3 R&D 243-B3-002 Chondrogenic media component (Conc.:10 ng/ml)
KnockOut Serum Replacement Life Technologies 10828-028 Chondrogenic media component (Conc.: 1%)
ITS+ Premix BD 354352 Chondrogenic media component (Conc.: 1%)
Dexamethasone-Water Soluble  Sigma Aldrich D2915-100MG Chondrogenic media component (Conc.:10-7 M)
GlutaMAX Supplement Life Technologies 35050-061 Chondrogenic media component (Conc.: 1%)
Sodium pyruvate solution Sigma Aldrich S8636 Chondrogenic media component (Conc.: 1%)
L-Proline Sigma Aldrich P5607-25G Chondrogenic media component (40 μg/ml)

DOWNLOAD MATERIALS LIST

References

  1. van Osch, G. J., et al. Cartilage repair: past and future--lessons for regenerative medicine. J Cell Mol Med. 13, (5), 792-810 (2009).
  2. Ahmed, T. A., Hincke, M. T. Strategies for articular cartilage lesion repair and functional restoration. Tissue Eng Part B Rev. 16, (3), 305-329 (2010).
  3. Diekman, B. O., et al. Cartilage tissue engineering using differentiated and purified induced pluripotent stem cells. Proc Natl Acad Sci USA. 109, (47), 19172-19177 (2012).
  4. Solchaga, L. A., Penick, K., Goldberg, V. M., Caplan, A. I., Welter, J. F. Fibroblast growth factor-2 enhances proliferation and delays loss of chondrogenic potential in human adult bone-marrow-derived mesenchymal stem cells. Tissue Eng Part A. 16, (3), 1009-1019 (2010).
  5. Guzzo, R. M., Drissi, H. Differentiation of Human Induced Pluripotent Stem Cells to Chondrocytes. Methods Mol Biol. 1340, 79-95 (2015).
  6. Drissi, H., Gibson, J. D., Guzzo, R. M., Xu, R. H. Derivation and Chondrogenic Commitment of Human Embryonic Stem Cell-Derived Mesenchymal Progenitors. Methods Mol Biol. 1340, 65-78 (2015).
  7. Nejadnik, H., et al. Improved approach for chondrogenic differentiation of human induced pluripotent stem cells. Stem Cell Rev. 11, (2), 242-253 (2015).
  8. Teramura, T., et al. Induction of mesenchymal progenitor cells with chondrogenic property from mouse-induced pluripotent stem cells. Cell Reprogram. 12, (3), 249-261 (2010).
  9. Koyama, N., et al. Human induced pluripotent stem cells differentiated into chondrogenic lineage via generation of mesenchymal progenitor cells. Stem Cells Dev. 22, (1), 102-113 (2013).
  10. Ko, J. Y., Kim, K. I., Park, S., Im, G. I. In vitro chondrogenesis and in vivo repair of osteochondral defect with human induced pluripotent stem cells. Biomaterials. 35, (11), 3571-3581 (2014).
  11. Nam, Y., Rim, Y. A., Jung, S. M., Ju, J. H. Cord blood cell-derived iPSCs as a new candidate for chondrogenic differentiation and cartilage regeneration. Stem Cell Res Ther. 8, (1), 16 (2017).
  12. Hotten, G. C., et al. Recombinant human growth/differentiation factor 5 stimulates mesenchyme aggregation and chondrogenesis responsible for the skeletal development of limbs. Growth Factors. 13, (1-2), 65-74 (1996).
  13. Murphy, M. K., Huey, D. J., Hu, J. C., Athanasiou, K. A. TGF-beta1, GDF-5, and BMP-2 stimulation induces chondrogenesis in expanded human articular chondrocytes and marrow-derived stromal cells. Stem Cells. 33, (3), 762-773 (2015).
  14. Shintani, N., Siebenrock, K. A., Hunziker, E. B. TGF-ss1 enhances the BMP-2-induced chondrogenesis of bovine synovial explants and arrests downstream differentiation at an early stage of hypertrophy. PLoS One. 8, (1), e53086 (2013).
  15. Fukumoto, T., et al. Combined effects of insulin-like growth factor-1 and transforming growth factor-beta1 on periosteal mesenchymal cells during chondrogenesis in vitro. Osteoarthritis Cartilage. 11, (1), 55-64 (2003).
  16. Worster, A. A., Nixon, A. J., Brower-Toland, B. D., Williams, J. Effect of transforming growth factor beta1 on chondrogenic differentiation of cultured equine mesenchymal stem cells. Am J Vet Res. 61, (9), 1003-1010 (2000).
  17. Knippenberg, M., et al. Differential effects of bone morphogenetic protein-2 and transforming growth factor-beta1 on gene expression of collagen-modifying enzymes in human adipose tissue-derived mesenchymal stem cells. Tissue Eng Part A. 15, (8), 2213-2225 (2009).
  18. Jang, Y., et al. Centrifugal gravity-induced BMP4 induces chondrogenic differentiation of adipose-derived stem cells via SOX9 upregulation. Stem Cell Res Ther. 7, (1), 184 (2016).
  19. Kang, R., et al. Mesenchymal stem cells derived from human induced pluripotent stem cells retain adequate osteogenicity and chondrogenicity but less adipogenicity. Stem Cell Res Ther. 6, 144 (2015).
  20. Tao, H., et al. Biological evaluation of human degenerated nucleus pulposus cells in functionalized self-assembling peptide nanofiber hydrogel scaffold. Tissue Eng Part A. 20, (11-12), 1621-1631 (2014).
  21. Sekiya, I., Larson, B. L., Vuoristo, J. T., Reger, R. L., Prockop, D. J. Comparison of effect of BMP-2, -4, and -6 on in vitro cartilage formation of human adult stem cells from bone marrow stroma. Cell Tissue Res. 320, (2), 269-276 (2005).
  22. Shen, B., Wei, A., Tao, H., Diwan, A. D., Ma, D. D. BMP-2 enhances TGF-beta3-mediated chondrogenic differentiation of human bone marrow multipotent mesenchymal stromal cells in alginate bead culture. Tissue Eng Part A. 15, (6), 1311-1320 (2009).
  23. Rim, Y. A., Nam, Y., Ju, J. H. Induced Pluripotent Stem Cell Generation from Blood Cells Using Sendai Virus and Centrifugation. J Vis Exp. (118), (2016).
  24. Kim, Y., et al. The Generation of Human Induced Pluripotent Stem Cells from Blood Cells: An Efficient Protocol Using Serial Plating of Reprogrammed Cells by Centrifugation. Stem Cells Int. 2016, 1329459 (2016).
  25. Oldershaw, R. A., et al. Directed differentiation of human embryonic stem cells toward chondrocytes. Nat Biotechnol. 28, (11), 1187-1194 (2010).
  26. Toh, W. S., et al. Differentiation and enrichment of expandable chondrogenic cells from human embryonic stem cells in vitro. J Cell Mol Med. 13, (9B), 3570-3590 (2009).
  27. Hwang, N. S., Varghese, S., Elisseeff, J. Derivation of chondrogenically-committed cells from human embryonic cells for cartilage tissue regeneration. PLoS One. 3, (6), e2498 (2008).
  28. Nakagawa, T., Lee, S. Y., Reddi, A. H. Induction of chondrogenesis from human embryonic stem cells without embryoid body formation by bone morphogenetic protein 7 and transforming growth factor beta1. Arthritis Rheum. 60, (12), 3686-3692 (2009).
  29. Guzzo, R. M., Scanlon, V., Sanjay, A., Xu, R. H., Drissi, H. Establishment of human cell type-specific iPS cells with enhanced chondrogenic potential. Stem Cell Rev. 10, (6), 820-829 (2014).
  30. Rim, Y. A., Park, N., Nam, Y., Ju, J. H. Generation of Induced-pluripotent Stem Cells Using Fibroblast-like Synoviocytes Isolated from Joints of Rheumatoid Arthritis Patients. J Vis Exp. (116), (2016).
  31. Pfaff, N., et al. Efficient hematopoietic redifferentiation of induced pluripotent stem cells derived from primitive murine bone marrow cells. Stem Cells Dev. 21, (5), 689-701 (2012).
  32. Xu, H., et al. Highly efficient derivation of ventricular cardiomyocytes from induced pluripotent stem cells with a distinct epigenetic signature. Cell Res. 22, (1), 142-154 (2012).
  33. Lee, S. B., et al. Contribution of hepatic lineage stage-specific donor memory to the differential potential of induced mouse pluripotent stem cells. Stem Cells. 30, (5), 997-1007 (2012).
  34. Hu, S., et al. Effects of cellular origin on differentiation of human induced pluripotent stem cell-derived endothelial cells. JCI Insight. 1, (8), 1-12 (2016).
  35. Vonk, L. A., de Windt, T. S., Slaper-Cortenbach, I. C., Saris, D. B. Autologous, allogeneic, induced pluripotent stem cell or a combination stem cell therapy? Where are we headed in cartilage repair and why: a concise review. Stem Cell Res Ther. 6, (94), 1-11 (2015).
  36. Gomez-Leduc, T., et al. Chondrogenic commitment of human umbilical cord blood-derived mesenchymal stem cells in collagen matrices for cartilage engineering. Sci Rep. 6, 32786 (2016).
  37. Mareschi, K., et al. Isolation of human mesenchymal stem cells: bone marrow versus umbilical cord blood. Haematologica. 86, (10), 1099-1100 (2001).
  38. Wexler, S. A., et al. Adult bone marrow is a rich source of human mesenchymal 'stem' cells but umbilical cord and mobilized adult blood are not. Br J Haematol. 121, (2), 368-374 (2003).
  39. Zhang, X., et al. Isolation and characterization of mesenchymal stem cells from human umbilical cord blood: reevaluation of critical factors for successful isolation and high ability to proliferate and differentiate to chondrocytes as compared to mesenchymal stem cells from bone marrow and adipose tissue. J Cell Biochem. 112, (4), 1206-1218 (2011).
  40. Wagner, W., et al. Replicative senescence of mesenchymal stem cells: a continuous and organized process. PLoS One. 3, (5), e2213 (2008).
  41. Tarte, K., et al. Clinical-grade production of human mesenchymal stromal cells: occurrence of aneuploidy without transformation. Blood. 115, (8), 1549-1553 (2010).
  42. Chen, W. C., et al. Prediction of poor survival by cyclooxygenase-2 in patients with T4 nasopharyngeal cancer treated by radiation therapy: clinical and in vitro studies. Head Neck. 27, (6), 503-512 (2005).
  43. Guzzo, R. M., Gibson, J., Xu, R. H., Lee, F. Y., Drissi, H. Efficient differentiation of human iPSC-derived mesenchymal stem cells to chondroprogenitor cells. J Cell Biochem. 114, (2), 480-490 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics